Lactic Acid Bacteria Lactobacillus Plantarum Research Articles

Enhancing ergogenic performance and antioxidant benefits of red sugarcane juice through probiotic fermentation

The potential of red sugarcane as a functional probiotic drink was investigated, with a focus on determining its physicochemical, ergogenic, and antioxidant activities. Three different variants of Malaysian red sugarcane, namely Ragnar, Kapur, and Serai, were selected for analysis. The concentrations of electrolytes (Na, K, Ca, Mg, Zn, and Fe) in sugarcane juice were determined using an inductively coupled plasma mass spectrophotometer (ICP-MS), while the antioxidant activity and Vitamin C were assessed through colorimetric assays. Additionally, the functionality of the optimal variant, Ragnar, was enhanced by inoculating it with lactic acid bacteria (LAB) Lactobacillus plantarum ATCC8014 and Lactobacillus casei Shirota. High antioxidative properties (TPC: 71.63 mg GAE/mL, FRAP: 2.76 mmol TE/mL, DPPH EC50: 55.66 µg/mL, and Vitamin C: 0.72 mg/100 g) were observed in the Ragnar, which tends to exhibit an attractive blue-yellow hue. K exhibited the highest concentration in all samples (126.31 – 229.95 mg/mL), followed by Na, Mg, Fe, and Zn, which exceeded the commercial isotonic drink. The viability of LAB (above 107 CFU/mL) and the production of gamma-aminobutyric acid (GABA) were satisfactory while reducing sugars were generally lower after the fermentation. The findings present red sugarcane as a potential natural source for the development of functional drinks.Graphical

Isolation and some basic characteristics of lactic acid bacteria from beetroot (Beta vulgaris L.) —A preliminary study

The carbohydrate content of fruit and vegetable juices has made them a suitable environment for the growth of lactic acid bacteria. Various studies have shown that beetroot can be a good substrate for the production of probiotic drinks for consumers. Therefore, this study was performed to isolate and identify lactic acid bacteria from beetroot juice. Beetroot juice was prepared from two kilograms of washed beetroot with a cold press. Sterile samples of beetroot juice were first enriched in MRS broth and then cultured on MRS agar. Gram and catalase tests were used for the initial detection of lactic acid bacteria. Then, to identify the species of lactic acid bacteria, biochemical confirmation tests such as the melting of gelatin, and the growth of bacteria has been studied in the ideal condition that is 15-45° C, sugars fermentation, gas production from glucose, and growth in at different concentrations of salt were performed. The final verification of species was done using polymerase chain reaction-amplified 16S rRNA-specific DNA. All isolates formed creamy white round colonies on MRS agar medium, were gram-positive, were able to grow in anaerobic conditions, and were also rod-shaped and catalase-negative. Based on biochemical tests, four types of lactic acid bacteria (Lactobacillus plantarum, Lactobacillus helveticus, Lactobacillus salivarius, and Lactobacillus acidophilus) were identified. The findings of this study indicated the presence and diversity of lactic acid bacteria in beet juice, which can be a potential platform for the production of probiotic beetroot juice as a non-dairy product.

Saccharina latissima, candy-factory waste, and digestate from full-scale biogas plant as alternative carbohydrate and nutrient sources for lactic acid production

To substitute petroleum-based materials with bio-based alternatives, microbial fermentation combined with inexpensive biomass is suggested. In this study Saccharina latissima hydrolysate, candy-factory waste, and digestate from full-scale biogas plant were explored as substrates for lactic acid production. The lactic acid bacteria Enterococcus faecium, Lactobacillus plantarum, and Pediococcus pentosaceus were tested as starter cultures. Sugars released from seaweed hydrolysate and candy-waste were successfully utilized by the studied bacterial strains. Additionally, seaweed hydrolysate and digestate served as nutrient supplements supporting microbial fermentation. According to the highest achieved relative lactic acid production, a scaled-up co-fermentation of candy-waste and digestate was performed. Lactic acid reached a concentration of 65.65 g/L, with 61.69% relative lactic acid production, and 1.37 g/L/hour productivity. The findings indicate that lactic acid can be successfully produced from low-cost industrial residues.

CHARACTERIZATION OF FUNCTIONAL AND MICROBIAL PROFILE OF WHEY RECOVERED FROM COTTAGE CHEESE AND CHEESE MANUFACTURING

The main reason for selecting whey as a substrate of research and raw material for alcohol production is to reduce industrial waste that adversely impacts the environment, as well as to make a profit on it. The environmental impact of whey is related to its biological oxygen demand (BOD = 230 mg/ml) and chemical oxygen demand (COD = 70 mg / ml). Whey is mainly composed of disaccharide lactose, and the activity of yeast strains plays an important role in its conversion to bioethanol. Lactic acid bacteria, whey composition, and fermentation conditions also play an important role. In this work, the physicochemical properties of milk and cheese whey were studied, and microbiological analysis was carried out. The results show the high quality of the whey of the two selected producers of cottage cheese and cheese. The uniformity of consistency and normal appearance, taste, and smell, corresponding to the whey, testify to the observance of all sanitary norms and rules at the stage of whey collection. No significant differences were found between the characteristics of two different whey samples. The cells of yeast strains isolated from whey had different natures. 4 strains of alcohol-resistant yeasts and 2 strain of lactic acid bacteria Lactobacillus plantarum W1 and Leuconostocmesenteroides W1 were isolated, which could be promising biocatalysts for bioethanol production.

Soil properties and silage quality in response to oat and pea seeding ratios and harvest stage on the Qinghai-Tibetan Plateau

Livestock intensification improves production efficiency and enhances the demand for quality forage to feed ruminants. Novel combinations of forage plants, especially including Gramineae and Leguminous plants, benefit both ruminant animals and contribute to a sustainable environment. This study explored an oat-pea mixed seeding strategy as an approach to improving silage quality. Before ensialing, lactic acid bacteria (Lactobacillus plantarum and Lactobacillus brucelli) were added to forage from five different mixed seeding proportions of oats (O) and peas (P) (10:0, 8:2, 7:3, 5:5, and 0:10 oat to pea ratio) at two harvesting periods (the early flowering stage and the milk ripening stage for the oats). The results showed that mixed seeding changed the soil quality parameters. Moreover, the silage from the O5P5 (5:5 oat to pea ratio) group showed the lowest pH values (4.16) and highest LA contents (7.74% DM) after ensiling for 7d (p < 0.05) in early flowering stage. Also, the O5P5 group increased the number of tillers/branches and produced silage with the highest CP content (13.14–14.06) after ensiling for 7d in early flowering stage and both 7d and 30d in early flowering stage and milk ripening stage (p < 0.05). In conclusion, this study found that the selection of oat-pea mixed seeding as O5P5 and harvesting at the milk ripening stage of oat is recommended as a desirable oat-pea mixed seeding strategy for producing high quality silage.

Antioxidant, Anti-Oral Cancer, and Antimicrobial Activity of Medicinal Plant Extracts: Development of Mouthrinse Formulations

Nowadays, there is growing interest in using medicinal plants as antimicrobial agents to treat microbial infections in the oral cavity. This study was aimed to evaluate phytochemical properties, anti-oral cancer and antimicrobial activity against C. albicans and some potential oral lactic acid bacteria (Lactobacillus casei and Lactobacillus plantarum). Plant extracts including Cinnamomum verum (cinnamon), Acorus calamus (sweet flag), Hibiscus sabdariffa (roselle), Zingiber officinale (ginger) and Alpinia officinarum (lesser galangal) were tested and used to formulate mouthrinses for oral health care. Cinnamon extract possessed the highest phenolic, flavonoid and tannin content, and antioxidant activity (1,152.58 mg ascorbic acid equivalent/g by phosphomolybdenum assay and 39.64 % nitric oxide radical scavenging activity), while roselle extract had the highest total alkaloids. Only lesser galangal extract displayed anti-oral cancer activity with 97.83 % cytotoxicity. High performance liquid chromatography (HPLC) analysis revealed the presence of galangin and kaempferide in the lesser galangal rhizome extract. The cinnamon extract showed the strongest inhibitory activity against Candida albicans (4 mg/mL MIC). Cinnamon extract (24 mg/mL) and cinnamaldehyde (0.08 mol/L) exhibited the best killing effect and the highest cellular protein leakage in C. albicans. In addition, these plant extracts were used to develop mouthrinse formulations. The extracts of cinnamon and ginger at 10 % in mouthrinse formulations could strongly inhibit the growth of C. albicans. In comparison, 8 and 10 % roselle extracts showed the best inhibitory effect against Lactobacillus casei. In summary, cinnamon and lesser galangal were potential plants with antimicrobial, antioxidant, anti-biofilm and anti-oral cancer activities, and thus can be utilized to formulate oral care products. HIGHLIGHTS Lesser galangal was found to be a prominent anti-oral cancer plant Cinnamon was shown to be an interesting anti-Candida albicans plant Cinnamon, ginger and roselle extracts at 10 % in mouthrinse formulations exhibited strong antimicrobial activity. These plants can be used to incorporate into oral care products for treatment and prevention of oral diseases GRAPHICAL ABSTRACT

Evaluation of Antibacterial Activity of Lactic Acid Bacteria Isolated from Kunun Zaki against Selected Bread Rope Spoilage Bacteria

In line with increasing demand by consumers for safe and minimally processed food products, biopreservation has been advocated over the traditional use of chemical additives in combating food spoilage. This study evaluated the antibacterial activity of four lactic acid bacteria (LAB) (Lactobacillus fermentum, Lactococcus lactis, Lactobacillus brevis and Lactobacillus plantarum) isolated from kunun-zaki against the bread rope spoilage bacteria, Bacillus subtilis and Bacillus cereus. Antibacterial activity was determined using the dual agar overlay method with subsequent measurement of zones of inhibition. Titrimetric methods were used to determine the abilities of the isolated LAB to produce antimicrobials including lactic acid, hydrogen peroxide and diacetyl. Lactobacillus fermentum brought about the highest inhibition zone (20 mm) against Bacillus cereus. The smallest zone of inhibition (6 mm) was recorded for L. plantarum against B. cereus. Whereas L. plantarum produced the highest amount of lactic acid (0.540 g/L), L. brevis produced the lowest lactic acid amount of 0.348 g/L. L. fermentum produced the highest amount of hydrogen peroxide (0.020 g/L) whereas L.brevis recorded the lowest hydrogen peroxide production of 0.010 g/L. L. lactis and L. fermentum had the highest and lowest values of 0.649 g/L and 0.219 g/L respectively for diacetyl production. Differences in the antibacterial activities and antimicrobials production by the LAB were statistically significant (P < .05). The findings show that the LAB isolates possessed antibacterial activity against the selected spoilage bacteria and as such could be exploited as potential biocontrol agents against the selected bread rope spoilage bacteria.

The Potential of Indigenous Lactic Acid Bacteria Lactobacillus Plantarum Dad 13 in Ice Cream as Probiotic Food

Worldwide demand for functional food will continue to increase rapidly due to increasing public awareness about the impact of food on health. One example of functional food is milk-based food which contains probiotic bacteria such as yogurt, cheese, and ice cream. Among probiotic dairy products, ice cream is the ideal matrix delivery of probiotic ingredients to the human body. This study aimed to find the potential of L. plantarum dad 13 in ice cream as a probiotic food through the growth pattern of the resulting lactic acid bacteria and to obtain the best incubation time and aging time for the physicochemical properties of the ice cream produced. The experimental design in this study used a Randomized Block Design (RBD), which was arranged in a factorial manner with 2 factors. The first factor is the length of incubation time which consists of 3 levels, namely 0, 5, and 10 hours; and the second factor is the length of aging which consists of 3 levels, namely 24, 48, and 72 hours. The results showed that the viability of lactic acid bacteria in ice cream with the addition of lactic acid bacteria L. plantarum dad 13 was more influenced by the pH value during the aging process, and there was an interaction between the incubation time and the aging time on the viability of the lactic acid bacteria L. plantarum dad 13 in ice cream, as well as the antioxidant activities, produced.

Effect of Addition Fermented Cabbage Extract on Antioxidant Activity and Antinutritional Compounds of Foxtail Millet Flour

Fermented cabbage extract contains lactic acid bacteria Lactobacillus plantarum which produces tannase enzymes and Lactobacillus casei which produces phytase enzymes, which are very effective in reducing antinutrient compounds and increasing the antioxidant compound foxtail millet flour. This study aimed to determine the optimal fermentation time (0, 12, 24, 36, and 48 hours) to decrease antinutrient compounds and increase antioxidant compounds of foxtail millet flour using fermented cabbage extract. The results showed that an increase in fermentation time from 0 to 48 hours reduced levels of tannins and phytic acid in foxtail millet flour by 68.64 % (2.71 - 0.85 mg/g) and 66.60 % (5.33 - 1.78 mg/g) respectively. Afterwards there is an increase in antioxidant activity by 83.10 % (42.25 - 77.26 %) and a decrease in total phenolic content by 18.22 % (7.41 - 6, 06 mg GAE/g). In conclusion, the optimal fermentation time to produce FMF with the best characteristics (low antinutrients and high antioxidant activity) is 48 hours. Keywords: phytic acid, tannin, antioxidant activity, foxtail millet flour, fermented cabbage extract

Effects of Different Additives on the Chemical Composition, Fermentation Profile, In Vitro and In Situ Digestibility of Paper mulberry Silage

Paper mulberry (Broussonetia papyrifera) plants are served as a local roughage in China, and they are mostly processed as silage for ruminants. This study aimed to explore the effects of different silage additives on the chemical composition, fermentation profile, as well as the in vitro and in situ digestibility of paper mulberry (PM) silage. Four groups consisting of PM silage, three with additives and one without any additives as the control group (CON), were established. The three experimental groups with additives were set up as follows: CON with 5 × 106 CFU per gram of fresh PM weight of lactic acid bacteria (Lactobacillus plantarum) (LAB); CON with 3% fresh PM weight of molasses (MOL) added to the PM silage; and CON with both LAB and MOL added (LM). After 45 days of ensiling at 20 °C, all of the PM treatment groups increased their ash content and decreased their water-soluble carbohydrate content (p < 0.05). Meanwhile, the pH and NH3-N content of the PM silage were lower in the additive treatment groups than in the CON group (p < 0.05). Lactic acid in the LM group was the highest (p < 0.05) among the four groups, and trace amounts of butyric acid was detected only in the CON group. In vitro dry matter digestibility was similar among all groups. Results of the in situ experiment found that the effective digestibility of the PM silage dry matter, as well as the acid detergent fiber digestibility was higher in the LM group than in the CON group (p < 0.05). In conclusion, the addition of LAB, MOL, and their combination can improve PM silage fermentation and improve the in situ digestibility of dry matter and acid detergent fiber; however they do not affect in the vitro digestibility of PM silage.

Production and optimization of lactic acid using Chlorella vulgaris as a source of fermentable sugar

The use of plant waste product for maximum sustainability has led to the search for bio based raw material such as Chlorella vulgaris which can make a tremendous contribution on the ecological and economical production of different organic acids like lactic acid. This study aimed to evaluate the enzymatic and or acidic hydrolysis of Chlorella vulgaris cell wall Intercellular starch as a source of fermentable sugar for lactic acid production. Lactic acid was produced through acid hydrolysis, enzyme hydrolysis and a combination of acid and enzyme hydrolysis of four different substrates. Each of the substrate was inoculated with a lactic acid bacterium (Lactobacillus plantarum) and a fungus (Rhizopus oryzae) while acid/enzyme hydrolysis was inoculated with mixed culture of the organism within a retention period of tendays. Results showed that the physico-chemical properties of C. vulgaris had a total carbohydrate of 17.4% and a reducing sugar of 24.0µg/ml. According to treatment, C. vulgaris had the highest reducing sugars (6.4 ± 0.2) and (4.4 ± 0.3) with Lactobacillus Enzyme Hydrolysis (LEH) and Rhizopus Enzyme Hydrolysis (REH) treatments, respectively indicating that C. vulgaris was the most hydrolyzed sample. Results of the optimization of various responses showed that using Corn Steep Liquor (CSL), REH day 2 treatment for fermentation at 370C for 48h were best combinations that yielded the optimal of Y1=0.249, Y2= 5.461 and Y3=33.704, respectively with a desirability of 0.619. The results indicated Chlorella vulgaris produced the highest lactic acid of about 20% signifying that its biomass contains high source of carbohydrate accessible for lactic acid production.

Timing of inoculation of Oenococcus oeni and Lactobacillus plantarum in mixed malo-lactic culture along with compatible native yeast influences the polyphenolic, volatile and sensory profile of the Shiraz wines

Malolactic fermentation (MLF) is a secondary wine fermentation resulting from lactic acid bacteria (Oenococcus oeni or Lactobacillus plantarum), especially in cool climates. MLF reduces acidity, improves body, mouthfeel, aroma complexity, and stabilizes the wine. Nevertheless, the traditional MLF using single culture is often associated with stuck fermentation, increased volatile acidity and color loss in wine. Thus, studies on mixed blend of L. plantarum and O. oeni to improve chemical and sensory profiles are gaining importance. The first study on different timing of inoculation of dual malo-lactic culture for the vinification of Shiraz wine aims to understand interactions between the wine cultures (Saccharomyces cerevisiae AAV2, L. plantarum Lp 1 and O. oeni Oo 1). The wines were compared based on chemical properties, phenolic and volatile profiles, and sensory analysis. The study highlighted that early or mid-inoculated MLF wines have higher anthocyanins, flavonoids, syringol, esters, vanillate derivatives, benzaldehyde, and free terpenes compared to traditional MLF wines. The wines were rated high for purple red colour, tannin, body, and overall acceptability. Hence, it was concluded that the inoculation of Lp 1 and Oo 1, either after 7 or 14 days of alcoholic fermentation by yeast AAV2, yield the desired quality Shiraz wine.

Survivability and Population Dynamics of Lactic Acid Bacteria (LAB) in Probioticated Sapota Juice (Achras sapota L.) and their Influence on Physicochemical Properties

Background: Sapota (Achras sapota L. or Manilkara zapota L.) is one of the major fruit crops grown in subtropical countries and it contains sugars, acids, protein, phenolics carotenoids, ascorbic acid, minerals and vitamins. Growing of lactic acid bacteria in fruit juices for health benefits and improving the nutritional and sensory attributes of the fruit juice is becoming more prominent in the present days. In recent years, consumer preference for non dairy food products has increased especially for lactose intolerance people. The present study is aimed to develop probioticated sapota fruit juice using probiotic bacteria like Lactobacillus plantarum, Lactobacillus bulgaricus, Lactobacillus acidophilus, Lactobacillus casei. Methods: Sapota fruit juice was prepared and inoculated with four different species of proven probiotic lactic acid bacteria (Lactobacillus plantarum, Lactobacillus bulgaricus, Lactobacillus acidophilus and Lactobacillus casei) and incubated at 30oC and 37oC for 72 hours. Population dynamics of lactic acid bacteria and their impact on physicochemical properties of probiotic sapota juice during fermentation at two different temperatures were studied. Sensory evaluation was also studied to know the overall acceptability of the probiotic fruit juice. Result: The pH decreased and titratable acidity (TA) increased in all probiotic sapota juice samples incubated at 30oC and 37oC for 72 hours and the maximum titratable acidity was recorded by T4 (Lactobacillus plantarum) followed by T1 (L. acidophilus). All the three carbohydrates like glucose, fructose and sucrose present in sapota juice samples were utilized by the lactic acid bacteria during fermentation. Total phenolic concentration in the samples increased during fermentation. Viable cell counts in both samples kept at 30oC and 37oC gradually increased from 0 to 48 hours and then decreased. Sensory evaluation was conducted randomly for all the samples and no significant difference was recorded.

Effect of Fermentation Time on The Dynamics of Lactobacillus plantarum Bacteria using Collagen Extract from Broiler Claw Skin as a Substrate

Research has been carried out to evaluate the growth dynamics of lactic acid bacteria (LAB) Lactobacillus plantarum (L.plantarum) using collagen extract (CE) from the broiler claw skin (BCS) as a substrate. The bacterial dynamics studied were related to total lactic acid (TLA) production, pH, dissolved protein (DP) and bacterial growth (BG) during the fermentation process. A total of 50 g of BCS was used with fermentation time (24; 48 and 72 hours). The results was showed that fermentation time using L.plantarum as a culture with CE from BCS as a substrate did not affect on bacterial dynamics (TLA, pH, dissolved protein and BG) during the fermentation process. Using L.plantarum with EC from BCS as substrate can be applied with 24 hours fermentation time. The bacterial dynamics produced by the fermentation time were 2.35±0.50%; 5.88±0.10; 45.60±2.21 mg/mL and 15.591±0.92 Log10 CFU/mL respectively.

Pengaruh Probiotik Bakteri Asam Laktat dalam Air Minum Terhadap Konversi Pakan Ayam Broiler

This study aimed to determine the effect of probiotics of lactic acid bacteria in drinking water on feed consumption, weight gain and feed conversion ratio of broiler chickens. This research is an experimental research. The experimental animals used in this study were 28 male broiler chickens strain Cobb 700 aged 20 days. P0 was not given the addition of probiotic lactic acid bacteria, P1 was given the addition of probiotic lactic acid bacteria Lactobacillus acidophilus in 1ml/liter drinking water, P2 was given the addition of probiotic lactic acid bacteria Lactobacillus casei in drinking water 1ml/liter, P3 was given the addition of probiotic lactic acid bacteria Lactobacillus fermentum in drinking water 1ml/liter, P4 was given the addition of probiotic lactic acid bacteria Lactobacillus plantarum in drinking water 1ml/liter, P5 was given the addition of probiotic lactic acid bacteria Pediococcus in drinking water 1ml/liter, P6 was given the addition of probiotic mix lactic acid bacteria in drinking water 1ml /liter. Collecting data for the last 1 week by weighing the remaining consumption of feed given and weight gain of broiler chickens. The data obtained were analyzed using the Analysis of Variant (ANOVA) statistical method and continued with Duncan. Based on the results of the calculation of the amount of feed consumption and weight gain in broiler chickens, it showed that the administration of probiotic lactic acid bacteria 1ml/liter of water in broiler chickens could increase body weight gain, reduce feed conversion rates but did not reduce broiler feed consumption (p<0.05).

KARAKTERISTIK JAMBAL ROTI IKAN MANYUNG (Arius thalassinus) DENGAN SUPLEMENTASI BAKTERI ASAM LAKTAT INDIGENOUS

Jambal roti is a fermented product of sea catfish (Arius thalassinus) with the manufacturing process uses a high salt concentration (30%), and is still done traditionally. High salt in fish processing causes consumers to hesitate in consuming the product. The fish fermentation process involves several bacteria, including lactic acid bacteria, which will break down fish protein into other compounds that affect the chemical and microbiological characteristics of the product. This study aims to analyze the effect of supplementation of the variation of salt content (20%, 25% and 30%) and the indegenous lactic acid bacteria (control, Lactobacillus plantarum, Pediococcus acidilactici and Pediococcus pentosaceus) on the chemical and microbiological characteristics of the jambal roti. The results showed that the 25% salt content with Lactobacillus plantarum supplementation had the best characteristics among the other treatments, namely the number of coliform bacteria (2,11 log cfu / gram) and Salmonella-Shigella (2,18 log cfu / gram) the least among others treatments, total bacteria (7,26 log cfu/gram) and total lactic acid bacteria (4,58 log cfu/gram). Chemical characteristics includes moisture content 32,53%, ash content 23,08% wb, Aw 0,67, fat content 1,74% (w / b), NaCl content 18,10% and total protein 35,11%..

KARAKTERISTIK JAMBAL ROTI IKAN MANYUNG (Arius thalassinus) DENGAN SUPLEMENTASI BAKTERI ASAM LAKTAT INDIGENOUS

Jambal roti is a fermented product of sea catfish (Arius thalassinus) with the manufacturing process uses a high salt concentration (30%), and is still done traditionally. High salt in fish processing causes consumers to hesitate in consuming the product. The fish fermentation process involves several bacteria, including lactic acid bacteria, which will break down fish protein into other compounds that affect the chemical and microbiological characteristics of the product. This study aims to analyze the effect of supplementation of the variation of salt content (20%, 25% and 30%) and the indegenous lactic acid bacteria (control, Lactobacillus plantarum, Pediococcus acidilactici and Pediococcus pentosaceus) on the chemical and microbiological characteristics of the jambal roti. The results showed that the 25% salt content with Lactobacillus plantarum supplementation had the best characteristics among the other treatments, namely the number of coliform bacteria (2,11 log cfu / gram) and Salmonella-Shigella (2,18 log cfu / gram) the least among others treatments, total bacteria (7,26 log cfu/gram) and total lactic acid bacteria (4,58 log cfu/gram). Chemical characteristics includes moisture content 32,53%, ash content 23,08% wb, Aw 0,67, fat content 1,74% (w / b), NaCl content 18,10% and total protein 35,11%..

Use of Lactobacillus plantarum (strains 22F and 25F) and Pediococcus acidilactici (strain 72N) as replacements for antibiotic-growth promotants in pigs

The lactic acid bacteria (LAB) Lactobacillus plantarum (strains 22F and 25F) and Pediococcus acidilactici (strain 72N) have appeared promising as replacements for antibiotics in in vitro studies. Microencapsulation, especially by the spray-drying method, has been used to preserve their numbers and characteristics during storage and digestion. This study compared the efficacy of these strains and their microencapsulated form with antibiotic usage on growth performance, faecal microbial counts, and intestinal morphology in nursing-finishing pigs. A total of 240 healthy neonatal pigs were treated on days 0, 3, 6, 9, and 12 after cross-fostering. Sterile peptone water was delivered orally to the control and antibiotic groups. Spray-dried Lactobacillus plantarum strain 22F stored for 6-months was administered to piglets in the spraydry group. Three ml of each the three fresh strains (109 CFU/mL) were orally administered to piglets in each group. All pigs received the basal diets, but these were supplemented with routine antibiotic for the antibiotic group. Pigs in all the probiotic supplemented groups exhibited a better average daily gain and feed conversion ratio than those of the controls in the nursery and grower phases. Probiotic supplementation increased viable lactobacilli and decreased enterobacterial counts. Antibiotic additives reduced both enterobacterial and lactobacilli counts. Villous height and villous height:crypt depth ratio were greater in probiotic and antibiotic supplemented pigs comparing to the controls, especially in the jejunum. The results demonstrated the feasibility of using these strains as a substitute for antibiotics and the practicality of the microencapsulation protocol for use in swine farms.

Effect of Lactic Acid produced by Lactic acid bacteria on Prodigiosin production from Streptomyces coelicolor

Often isolated from soil-dwelling microbes such as Serratia marcescens and Streptomyces coelicolor, red-pigmented prodigiosin and its derivatives have been characterized as natural bioactive compounds which possess a broad range of cytotoxic activity against various cancer cell lines as well as other biology activities. The raising need to enhance the production of this secondary metabolite due to its wide applications in both industrial and therapeutic field has gained attention from researchers over decades. Several approaches were carried out ranging from improving nutrient sources to metabolic engineering of S.coelicolor or co-cultivation with other bacteria. Recently, studies reported cell-free supernatant from lactic acid bacteria (LAB) intensively stimulated the pigment production from Streptomyces colelicor, however the reason for this enhancement was still unknown. In this study, we further investigated on the effect of lactic acid, a bioactive compound extracted from cell-free supernatants of LAB on prodigiosin production from Streptomyces coelicolor. The resulted data with 2 different strains of lactic acid bacteria (Leuconostoc mesenteroides and Lactobacillus plantarum) revealed treatment with lactic acid isolated from LAB exhibited an inhibition effect on prodigiosin yield in both intracellular and extracellular extraction.

Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera

Traditional Indonesian fermented foods have been studied as potential probiotics, for example dadiah from West Sumatera are made by fermenting buffalo milk in bamboo tubes. But the potential of halal probiotics isolated from Air Dingin District, West Sumatra (Indonesia) has not been studied. The purpose of this study was to determine the potential of halal probiotic lactic acid bacteria (LAB) Lactobacillus plantarum strain 8m-21 isolation from dadiah in Air Dingin Alahan Panjang District, Solok Regency West Sumatera (Indonesia) against to pathogenic bacteria and antimicrobial activity. Previously lactic acid bacteria Lactobacillus plantarum had been isolationand molecular identification used I6S rRNA with Forward (27F AGAGTTTGATCCTGGCTGAG) and Reverse primer (1492R; GTTTACCTTACGACTT). In this study we analyzed the probiotics have antimicrobial activity against pathogenic bacteria Escherichia coli O157. The results showed that Lactobacillus plantarum strain 8m-21 from Air Dingin dadiah isolates have probiotic properties because they have antimicrobial properties which able to inhibit Escherichia coli, aerob (pathogenic) bacteria and have highest antimicrobial with 20.25 mm inhibition than other sintetic antibiotics.