Lack Of Baseline Information Research Articles

Psychological Impact of Campus Football Training among Teenagers: Basis for Training Design

Student undergoing football training are exposed to stress. The lack of baseline information on assessing the relationship between profile and psychological impact in terms of sources and symptoms of stress in China led to the conduct of this study. This quantitative research was utilized a descriptive comparative research design to assess the differences between the psychological impact of campus football training to the profile of the student-respondents . Findings of the study revealed that most of the respondents were between the ages of 17-21 and just over half of the respondents were males. Further, most of the respondents were second year students. Almost half of the student had a moderate level of the sources of stress. Overall, the sources of stress had moderate impact to the students. Majority of the students had a high level of physical and mental symptoms of stress. In general , age, sex, and year level have no significant relationship with sources of stress and the mental and physical symptoms of stress. In conclusion, age, sex, and year level does not have psychological impact in terms of sources of stress and symptoms of stress. This comes to show that no matter what the person’s age, whether young or old, whether male or female, or whether first year or second year or third year or fourth year, a person can still experience a high level of psychological impact in football training, be it the source of stress or mental and physical symptoms of stress. To address the findings of the study, a football training design was created.

CHECKLIST OF THE BIRDS OF THE MUNICIPALITY OF SALAMINA (CALDAS), CENTRAL ANDES OF COLOMBIA: NEW RECORDS AND TAXONOMIC UPDATES

Bird assemblages are increasingly threatened by anthropogenic factors, leading to growing concern about their key role in natural ecosystems. This has led to the creation of conservation programs, however, one of the greatest obstacles to this end is the lack of updated information on the species distribution and taxonomic status. In Colombia, which is recognized as the country with the greatest diversity of birds in the world, conservation efforts are often constrained by the lack of baseline information or outdated data in different regions. To contribute to the knowledge of the regional avifauna, we present an updated checklist for birds of the municipality of Salamina (Caldas), based on published information and field records. We also listed resident, threatened, and endemic species. The checklist includes 279 bird species, 23 of which are migratory, three endemics to Colombia, six are categorized as Near Threatened, and two as Vulnerable (following the IUCN criteria). We propose this updated checklist as baseline information, which can be used in future ecological and management studies of species under conservation priority.

Human factors in the hospital: Education, skills, and job details

ObjectiveTo present the job requirements and background Human Factors professionals may need to be prepared and succeed in health care facilities. BackgroundBoth hospitals and Human Factors professionals must be prepared for the predicted growth of Human Factors job openings in health care. Professionals transitioning from another industry or graduating from a Human Factors and Ergonomics (HFE) program may benefit from understanding what hospitals need, education requirements, and the compensatory landscape. To date, there is a lack of baseline information about Human Factors professional job details in health care. MethodWe surveyed hospital-embedded Human Factors professionals. We grouped respondents based on the amount of time dedicated to operations vs. research work. ResultsOf 32 respondents, 75% were women. Hospital-embedded professionals reported an average salary of $153,917 and a median salary of $149,481. Although more institutions required a master's degree, 25% of practitioners had a doctorate degree. Technical and interpersonal skills were similar between researchers and practitioners including data collection and teamwork. ConclusionUniversities can use this information to tailor educational programs for HFE students interested in a health care track. Hospitals seeking HFE professionals can create targeted job descriptions. HFE professionals can assess their ability to transition into the health care setting. ApplicationThis information can be used by HFE professionals to assess their readiness to enter the hospital setting and negotiate compensation based on the current market. Hospitals can also use this to determine what skills HFE professionals bring.

Prevalence of dental caries and associated risk factors among People Living with HIV/AIDS and HIV uninfected adults at an HIV clinic in Kigali, Rwanda.

Dental caries is among the most frequent oral conditions in People Living with HIV/AIDS (PLWHA). There is a lack of baseline information on dental caries prevalence and associated risk factors among PLWHA in comparison to HIV uninfected people in Rwanda. This study was conducted to determine the prevalence of dental caries and associated risk factors among PLWHA and HIV uninfected adults at an HIV clinic of Kigali Teaching Hospital (CHUK) in Kigali, Rwanda. A comparative cross-sectional study was conducted among 200 PLWHA and 200 HIV uninfected adults aged 18 years and above attending an HIV clinic of CHUK. An oral examination was performed by a calibrated examiner. Dental caries were assessed using the WHO Decayed (D), Missing (M), and Filled Teeth (F) index (DMFT). Descriptive statistics, Chi-square, t-tests, and multiple binary logistic regression were used to analyze data. Overall, a higher prevalence (50.5%) of PLWHA had experienced dental caries (DMFT>0) compared to HIV uninfected counterparts (40.5%) (p = 0.045). The prevalence of Decayed teeth (D) was also higher (23.5%) among PLWHA compared to HIV uninfected persons (13.6%) (p = 0.011). The Mean(SD) DMFT scores among PLWHA and HIV uninfected participants were 2.28 (3.68) and 1.29 (2.21) respectively (p = 0.001). After performing multiple binary logistic regression analysis, the predictors of dental caries in PLWHA were being female (OR = 2.33; 95%CI = 1.14-4.75), frequent dental visits (OR = 4.50; 95% CI = 1.46-13.86) and detectable RNA viral load (OR = 4.50; 95% CI = 1.46-13.86). In HIV uninfected participants, the middle age range (36-45 years), and frequent dental visits were significantly associated with dental caries (OR = 6.61; 95%CI = 2.14-20.37) and (OR = 3.42; 95%CI: 1.337-8.760) respectively. The prevalence of dental caries was higher in PLWHA than in HIV uninfected counterparts. The reported higher prevalence of caries in PLWHA was associated with being female, detectable viral load, and frequent dental visits. Therefore, there is a need for effective oral health interventions specific to PLWHA in Rwanda to raise awareness of the risk of dental caries and provide preventive oral health services among this population. To ensure timely oral health care amongPLWHA, there is a need for an effort from policymakers and other stakeholders to integrate oral health care services within the HIV treatment program in Rwanda.

Progress in understanding the vulnerability of freshwater ecosystems.

The ability to collect and synthesize long-term environmental monitoring data is essential for the effective management of freshwater ecosystems. Progress has been made in assessment and monitoring approaches that have integrated routine monitoring programs into more holistic watershed-scale vulnerability assessments. While the concept of vulnerability assessment is well-defined for ecosystems, complementary and sometimes competing concepts of adaptive management, ecological integrity, and ecological condition complicate the communication of results to a broader audience. Here, we identify progress in freshwater assessments that can contribute to the identification and communication of freshwater vulnerability. We review novel methods that address common challenges associated with: 1) a lack of baseline information, 2) variability associated with a spatial context, and 3) the taxonomic sufficiency of biological indicators used to make inferences about ecological conditions. Innovation in methods and communication are discussed as a means to highlight meaningful cost-effective results that target policy towards heuristic ecosystem-management.

First report of marine debris in Car Nicobar, a remote oceanic Island in the Nicobar archipelago, Bay of Bengal

This study forms the first record to systematically quantify and classify the marine debris from Car Nicobar Island. Car Nicobar is a small remotely located Island in the Nicobar archipelago that is largely inhabited by Nicobarese indigenous people for ages. Considering their remote location and lack of baseline information on marine debris, we surveyed ten beaches in Car Nicobar to study the prevalence of marine debris. A total of 1438 debris items were recorded from the surveys of which plastic debris was found dominant (83.72%). Among the plastics, nets/ropes (38.87%) were found to be dominant followed by plastic bags, plastic bottles, polypropylene woven bags, plastic cans, floaters, and plastic cups. The number of debris was found to be highest in Malacca Jetty (7.2 nos/m2) and least in Mus Jetty (1.28 nos/m2). Land-based debris items from recreational and shoreline activities constituted majorly (54.52%) followed by sea-based sources such as shipping, fishing, and dumping activities (45.48%). Hierarchical Cluster Analysis (HCA) revealed that Malacca Jetty exhibited a distinct pattern of debris accumulation. Kriging interpolation was applied to understand the possible prevalence of marine debris around the coast of Car Nicobar Island. Plastic debris belonging to nearby countries such as Indonesia, Thailand, Malaysia, Myanmar, etc. was also recorded in our surveys. Shipping-based debris could be a probable source of foreign debris due to the proximity of the Nicobar archipelago to the Strait of Malacca, being one of the busiest shipping routes in the world. The baseline information generated from this study could assist the decision-makers to initiate proactive measures toward effective management of marine debris on Car Nicobar Island.

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/µl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/µl) and healthy controls (mean: 247±72 copies/µl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).

Ethnomedicinal documentation of polyherbal formulations and other folk medicines in Aurora, Zamboanga del Sur, Philippines

Abstract. Pucot JR, Demayo CG. 2021. Ethnomedicinal documentation of polyherbal formulations and other folk medicines in Aurora, Zamboanga del Sur, Philippines. Biodiversitas 22: 5331-5343. In Aurora-a rural municipality in western Mindanao, Philippines, wide patronization of folk medicines has been observed, and polyherbal formulations are one of the treatments used. However, knowledge of these formulations has not been documented, imposing a threat that might lead to its eventual loss. The lack of baseline information on these formulations also stagnates its development, and the danger of possible herb-herb interactions might remain high. Therefore, this study aims to compile polyherbal formulations and other folk medicine used by the healers and locals of Aurora and assess the utilization and knowledge of these indigenous practices with implications for its conservation and strengthening localized folk medicine pharmacovigilance. Through purposive and snowball sampling, a total of 23 key informants volunteered and were interviewed using semi-structured questionnaires. Knowledge and practices about medicinal plants were analyzed using descriptive statistics. A total of 34 polyherbal formulations and ten other folk medicines were recorded. Most of the plant species used belonged to the Poaceae family (14 species), Arecaceae, and Musaceae families (10 species each) and were mainly utilized for bughat, pasmo, and kabuhi-illnesses linked with cultural beliefs. The concept of synergism was also observed when it comes to folk medicine usage. It is recommended that more surveys of polyherbal medicines be conducted along with chemical profiling and pharmacological investigations, especially in the rural areas where these folk medicines are still widely utilized.

Geographical and temporal distribution of hawkmoth (Lepidoptera: Sphingidae) species in Africa.

BackgroundHawkmoths consist of species where most adults are nocturnal, but there are some day-flying genera. Hawkmoth species have a wide variety of life-history traits, comprising species with adults (mostly nectarivorous though with some exceptions, honey-feeding), but there are also species that do not feed at all. The nectarivorous species are an important component of tropical ecosystems, with significant roles as major pollinators of both crops and wild flora with the pollination done by the adult stage. Pollinators are in decline world-wide and there is need for baseline data to provide information about their conservation strategies. Species occurrence data from Museum collections have been shown to be of great value as a tool for prioritising conservation actions in Africa. The National Museums of Kenya (NMK) have a large and active entomology collection that is in continuous growth. The NMK’s collection of hawkmoths had not been digitised prior to 2017. This moth family Sphingidae includes about 1,602 species and 205 genera worldwide (Kitching et al. 2018) with the majority of these species occurring in Africa. These moth species can also be used as indicators in biodiversity assessments as they can be easily sampled and identified. However, hawkmoths have rarely been surveyed over the long term for this purpose. Long-term datasets are of unquestionable significance for understanding and monitoring temporal changes in biodiversity. These hawkmoth data have addressed one of the most significant challenges to insect conservation, the lack of baseline information concerning species diversity and distribution and have provided key historic hawkmoth species diversity and distribution data that can be used to monitor their populations in the face of climate change and other environmental degradation issues that are facing the world today. The publication of the hawkmoth species occurrence data records in GBIF has enhanced data visibility to a wider audience promoting availability for use.New informationThe hawkmoth (Lepidoptera: Sphingidae) collection at the National Museums of Kenya was digitised from 2017 – 2020 and this paper presents details of species occurrence records as in the insect collection at the NMK, Nairobi, Kenya.The collection holds 5,095 voucher specimens consisting of 88 genera and 208 species. The collection covers the period between 1904 and 2020.The geographical distribution of the hawkmoths housed at the NMK covers East Africa at 81.41%, West Africa at 7.20%, Southern Africa at 6.89%, Central Africa at 4.02% and North Africa at 0.2%.

Capitoline Dolphins: Residency Patterns and Abundance Estimate of Tursiops truncatus at the Tiber River Estuary (Mediterranean Sea).

Simple SummaryPhoto-identification is a non-invasive method of identifying individual animals from natural markings present on one or more parts of the body. The dorsal fin of a dolphin is the portion that contains individually distinctive marks and the most commonly visible when an animal surfaces to breathe. The camera captures an image of the dorsal fin whenever it is sighted and based on the number of times an image is captured, a statistical method called capture–recapture is used to estimate the site fidelity and the size of the population in a defined area. Here, we applied these methods to study the bottlenose dolphins (Tursiops truncatus) between 2017 and 2020 at the Tiber estuary (Mediterranean Sea, Rome, Italy), a polluted major river supplying organic material to the Capitoline (Roman) coastal area and nearby regions. We identified 347 unique individuals, with different patterns of residency (i.e., the tendency of dolphins to remain in, or return to, the study area): 42 were labeled resident, 73 part-time, and 232 transient. Estimating a total population size of 529 individuals and highlighting the presence of animals with a strong site-fidelity, this study suggests developing conservation plans for this vulnerable top-predator species not only focused on areas close to the Tiber River mouths but also extended to cover a broader scale of area.Periodic assessments of population status and trends to detect natural influences and human effects on coastal dolphin are often limited by lack of baseline information. Here, we investigated for the first time the site-fidelity patterns and estimated the population size of bottlenose dolphins (Tursiops truncatus) at the Tiber River estuary (central Mediterranean, Tyrrhenian Sea, Rome, Italy) between 2017 and 2020. We used photo-identification data and site-fidelity metrics to study the tendency of dolphins to remain in, or return to, the study area, and capture–recapture models to estimate the population abundance. In all, 347 unique individuals were identified. The hierarchical cluster analysis highlighted 3 clusters, labeled resident (individuals encountered at least five times, in three different months, over three distinct years; n = 42), part-time (individuals encountered at least on two occasions in a month, in at least two different years; n = 73), and transient (individuals encountered on more than one occasion, in more than 1 month, none of them in more than 1 year; n = 232), each characterized by site-fidelity metrics. Open POPAN modeling estimated a population size of 529 individuals (95% CI: 456–614), showing that the Capitoline (Roman) coastal area and nearby regions surrounding the Tiber River estuary represent an important, suitable habitat for bottlenose dolphins, despite their proximity to one of the major urban centers in the world (the city of Rome). Given the high number of individuals in the area and the presence of resident individuals with strong site fidelity, we suggest that conservation plans should not be focused only close to the Tiber River mouths but extended to cover a broader scale of area.

Assessment of Group a Streptococcus and Antimicrobial Resistance Pattern in School Going Children in Morang District, Nepal

Introduction: Group A hemolytic Streptococcal infections has worldwide distribution among children and it poses an important problem globally. There is lack of baseline information regarding Group A hemolytic streptococci in school going children in the eastern part of Nepal.
 Objective: The study was conducted for assessing the carrier rate of Group A hemolytic streptococci in school going children in eastern part of Nepal.
 Methodology: This study was community based cross-sectional study. During the study of 9 months, a total of 518 patients (school-going children) from different school who were symptomatic as well as asymptomatic were enrolled. All samples were collected by rubbing quickly and thoroughly over either tonsils (or tonsillar fossa) and over the posterior wall of the pharynx using light pressure and were subjected to microbial analysis in the clinical Microbiology Laboratory. The specimens were inoculated immediately into Blood agar (BA) and MacConkey agar (MA) and were incubated at 37°C aerobically and were checked for growth after overnight incubation. The identification of bacterial isolates was carried out by Clinical and Laboratory Standards Institute (CLSI) guidelines with colonial morphology and staining reactions. Biochemical tests such as catalase, bacitracin sensitivity test (0.004 units) and Lancefield grouping (PastorexTM Strep) were performed. All the identified S. pyogenes isolates thus obtained were subjected to in vitro antibiotics sensitivity testing by using Kirby-Bauer disc- diffusion method as recommended by CLSI (2014).
 Results: During 9 months period total 518 throat swabs (303 male and 215 female)from school going children attending government and private school were collected after taking verbal consent and were cultured on blood agar and MacConkey agar.Streptococcus pyogenes was identified by using standard microbiological procedures. Antimicrobial susceptibility testing of the isolates was performed by Kirby Bauer disc diffusion method. Group A streptococci (GAS) was isolated from 28 (5.4%) school going children, of which 15 (5%) were male and 13 (7%) were female. There was no significant sex difference in colonization of GAS (p>0.05). Majority of cases were asymptomatic. In this study it was observed that the sensitive drugs for GAS were Penicillin and their deravatives (100%), Ciproflocaxin (100%) and Azithromycin (100%) followed by Erythromycin (75%) and Cotrimoxazole (71.4%) (Table 9,10).
 Conclusion: The present preliminary study provides the base-line information on the GAS carriage rate and resistance trend among healthy school children. The present study showed that Penicillin and its derivatives should be used to treat a case of GAS pharyngitis and Azithromycin for those who are allergic to Penicillin. The present study also showed that Staphylococcus aureus as an equally important agent of pharyngitis and hence throat swab culture should be requested for appropriate therapy.

Potentials for Ecotourism Development at the Tikub Lake: The Obscure Small Lake of Tiaong, Quezon, Philippines

In Philippines the small lakes are hardly prioritised for ecotourism development, as many are undeveloped, arbitrarily governed and ecologically threatened. This situation is exacerbated by the lack of baseline information, the absence of basic management/development plan, and scarcity of scholarly works—little is known or written about small lakes. The study explores the potentials for ecotourism development of Tikub Lake located at the Tiaong Municipality in Quezon Province. It is locally accessible and easily reachable from the major urban population centres. As compared to other small lakes, Tikub Lake has a relatively superior water condition with impressive physical features and biodiversity. It has a promising market demand following the trajectory of nature-based tourism locally and nationally. It has rudimentary arrangements and ordinances to get set ecotourism and a committed local government, therefore, it is expected to contribute to the municipality’s tourism industry and economy. Ecotourism development is a feasible alternative for encouraging countryside economic expansion and for sustainably managing a small lake.

Swallowtail butterflies (Lepidoptera: Papilionidae) species diversity and distribution in Africa: The Papilionidae collection at the National Museums of Kenya, Nairobi, Kenya.

BackgroundSpecies data from the Museum collections have been shown to be of great value as a tool for prioritising conservation actions in Africa (Fjeldsa and Tushabe 2005). The National Museums of Kenya (NMK) have an entomology collection, housed in 4,000 drawers in cabinets that contain over 1.5 million specimens, including the largest butterfly collection in Africa (Arnett et al. 1997). Lampe and Striebing (2005) demonstrated how to digitise large insect collections in order to make their associated label data into databases that can be used for functions, such as creating distribution maps. The NMK’s swallowtail butterflies' collection had not been digitised and thus there was a need to capture the label data to create a database that can be used for mapping the distribution of the species in Kenya and elsewhere. These data have addressed one of the most significant challenges to insect conservation i.e. the lack of baseline information concerning species diversity and distribution (Summerville and Crist 2003). These data have provided key historic papilionid species diversity and distribution data that can be used to monitor their populations, as butterflies are declining due to changes in land use, intensive agriculture and pestcide use, diseases and pest and climate change (Potts et al. 2016; Bongaarts 2019). The publication of the occurrence data records in GBIF has been undertaken, thus making the data available to a wider audience and promoting availability for use.New informationThe swallowtail butterflies collection at the National Museums of Kenya was digitised from 2017–2019 and this paper presents details of the Papilionid collection at the Zoology Department, NMK, Nairobi, Kenya.The collection holds 7,345 voucher specimens, consisting of three genera and 133 species. The collection covers the period between 1850 to 2019.The distribution of the swallowtail butterflies, housed at the NMK, covers East Africa with 88%, Central Africa (6%), Western Africa (4%) and Southern Africa (2%).

Erratum to "Spatial and Climatic Factors Influence Ambrosia Beetle (Coleoptera: Curculionidae) Abundance in Intensively Managed Plantations of Eastern Black Walnut".

Invasive ambrosia beetles are among the most economically important pests of forest and plantation trees worldwide.The development of effective management guidelines for these pests in plantations of high-value hardwood species is hindered by a lack of baseline information regarding their seasonal abundance and dispersal behavior. By analyzing long-term monitoring data from intensively-managed plantations of eastern black walnut (Juglans nigra L.) in north-central Indiana, we identified key spatial and climatic variables that could improve the timing and precision of management actions to reduce ambrosia beetle populations. We also used geospatial analyses to compare species-specific spatial patterns of population density and evaluate the sensitivity of the trap density deployed in our long-term monitoring efforts. Xyleborinus saxesenii Ratzeburg and Xylosandrus crassiusculus Matschulsky (Coleoptera: Curculionidae) were more abundant during the spring in years preceded by a hot, dry growing season, and cold winter. Both species were positively associated with plantation edges during the fall flight period. However, X. saxesenii was less abundant in plantations close to forest corridors, whereas X. crassiusculus was more abundant in plantations closer to woodlots and other walnut plantations. Geospatial analysis revealed X. crassiusculus is active in larger, more spatially continuous patches than X. saxesenii, and that 200-m trap spacing is likely to be sufficient to detect both species in the spring flight period but may be insufficient to detect X. saxesenii during the fall flight period. Our findings underscore the power and utility of long-term monitoring to improve management strategies.

Spatial and Climatic Factors Influence Ambrosia Beetle (Coleoptera: Curculionidae) Abundance in Intensively Managed Plantations of Eastern Black Walnut.

Invasive ambrosia beetles are among the most economically important pests of forest and plantation trees world-wide. The development of effective management guidelines for these pests in plantations of high-value hardwood species is hindered by a lack of baseline information regarding their seasonal abundance and dispersal behavior. By analyzing long-term monitoring data from intensively-managed plantations of eastern black walnut (Juglans nigra L.) in north-central Indiana, we identified key spatial and climatic variables that could improve the timing and precision of management actions to reduce ambrosia beetle populations. We also used geospatial analyses to compare species-specific spatial patterns of population density and evaluate the sensitivity of the trap density deployed in our long-term monitoring efforts. Xyleborinus saxesenii Ratzeburg and Xylosandrus crassiusculus Matschulsky (Coleoptera: Curculionidae) were more abundant during the spring in years preceded by a hot, dry growing season, and cold winter. Both species were positively associated with plantation edges during the fall flight period. However, X. saxesenii was less abundant in plantations close to forest corridors, whereas X. crassiusculus was more abundant in plantations closer to woodlots and other walnut plantations. Geospatial analysis revealed X. crassiusculus is active in larger, more spatially continuous patches than X. saxesenii, and that 200-m trap spacing is likely to be sufficient to detect both species in the spring flight period but may be insufficient to detect X. saxesenii during the fall flight period. Our findings underscore the power and utility of long-term monitoring to improve management strategies.

Particularly neglected in countries with other challenges: High Toxoplasma gondii seroprevalence in pregnant women in Kabul, Afghanistan, while a low proportion know about the parasite.

Toxoplasmosis is a zoonotic parasitic disease of global importance. It is widespread and endemic practically all over the world, with infection prevalence varying by geographic location. The parasite and the disease are neglected, which is illustrated by the lack of baseline information on the prevalence from many regions. Developed, peaceful regions are in better situation to address toxoplasmosis, while the neglected status is particularly pronounced in regions with other challenges. Due to the lack of baseline data, these regions are rarely mentioned in discussions about the neglected status of the disease. A dramatic manifestation of toxoplasmosis, congenital toxoplasmosis, is the dreaded outcome of vertical transmission of the infection from the mother to the unborn child. For this reason, pregnant women are a key target group for primary prevention of T. gondii infections, and baseline data on the prevalence in pregnant women is important. In this cross-sectional seroepidemiological study, we estimated Toxoplasma gondii seroprevalence and evaluated possible risk factors for seropositivity in pregnant women in Kabul, Afghanistan. Altogether 207 of the 431 women included in the study tested positive for immunoglobulin G antibodies against T. gondii, yielding an apparent seroprevalence estimate of 48.03% (95% CI 43.33–52.75). Based on the final multivariable model for T. gondii seropositivity, non-concrete floor in the house and well or river as water source were identified as risk factors for seropositivity, while residence in rural area was a protective factor. The majority of the participants (72.9%) reported that they did not know about T. gondii. Our study is the first to report an estimate of T. gondii seroprevalence in pregnant women in Afghanistan. The high seroprevalence indicates substantial infection pressure, and the results of the risk factor analysis suggest that the environmental route, infection from oocysts, might be the most relevant to address to prevent the infections in the region. Our results contribute to the global discussion on neglected status of toxoplasmosis.

Avifauna Survey within a University Campus and Adjacent Forest Fragment in Bicol, Eastern Philippines

With the lack of baseline information on avifauna within Bicol University and the adjacent forest fragment, this research aimed to identify bird species and compare their presence between an urbanized and forest areas. Avian diversity was documented within the Kalikasan Park and Bicol University Main Campus adjacent ecosystems, representing a forest fragment and semi-urbanized ecosystems, respectively. Bird survey was carried out through point count method. Identification was aided by existing taxonomic keys. A total of 44 species were recorded with eleven as Philippine endemics. Lonchura malacca(Chestnut Munia) and Aplonis panayensis (Asian Glossy Starling) were among the most frequently sighted. Bird species sighted was higher in the forest fragment as compared with the main campus area. The study recommends that Bicol University Main campus be transformed into an avian buffer and safe zone for the protection and conservation of these species and to provide policies to maintain high bird diversity.

Effects of high temperature on existing allergic symptoms and the effect modification of allergic history on health outcomes during hot days among adults: An exploratory cross-sectional telephone survey study

ObjectiveThe effects of high temperature on existing allergic conditions are unclear. This study explored the prevalence of allergic symptoms and the effects of high temperature on existing allergic symptoms among an adult population. The effects of high temperature on other non-allergic health outcomes were compared between adults with and without a history of allergic symptoms. MethodA cross-sectional telephone survey study was conducted in Hong Kong two weeks after a heat wave in 2017. Socio-demographic information, history of allergic symptoms, non-allergic health symptoms and self-reported changes of allergic symptoms during the study hot period were collected using multiple-choice questions. ResultsOf the 436 respondents, 24% had reported an allergic history. During the study hot period, 22.4% and 15.7% of those who had skin and nasal allergies had reported worsen symptoms comparing to normal days. Comparing to people without an allergic history, those ever having allergic symptoms reported a higher rate of mucus secretions, mouth ulcers, poorer sleeping quality and worsen mood during the study hot period. The main limitation of this study is the lack of baseline information and the changes in symptoms were based on self-report basis. ConclusionA noticeable proportion of the study adult population reported an allergic history. Some of these symptoms got worse during period of high temperature. Pre-existing allergic symptoms were found associated with more adverse health effects and worse quality of life during hot days. Strategic health promotion policy should be planned to increase the awareness of the potential impacts of high temperature on allergy and the related health issues.

Pelvic Floor Muscle Exercise Education and Factors Associated with Implementation among Antenatal Women in Hospital Universiti Sains Malaysia.

BackgroundPelvic floor muscle exercise is effective for pelvic floor muscle dysfunction. Despite the high prevalence of pelvic floor muscle dysfunction in women in the community, pelvic floor muscle exercise recognition is low in Malaysian society; thus, this intervention is not frequently used . This study assessed the knowledge of, attitudes towards, and use of pelvic floor muscle exercise among antenatal women before and after educational classes. The study also determined factors associated with exercise practice.MethodsAn interventional study was conducted in 121 antenatal women selected through systematic random sampling between June and December 2010. Baseline knowledge of, attitude towards, and practice of pelvic floor muscle exercise were assessed using self-administered validated questionnaires at first visit and at 2 months post-partum. All participants attended two exercise education classes on their next two visits before delivery. A paired t-test and multivariate analysis were used for data evaluation.ResultsThe mean pre-intervention scores for knowledge, attitudes, and practice were 24.98, 24.25, and 3.51, respectively, with statistically significant mean score increments after intervention (P<0.001). The mean differences were 4.67 (95% confidence interval [CI], 3.86–5.49), 3.77 (95% CI, 3.05–4.50) and 3.45 (95% CI, 2.90–4.00) for knowledge, attitudes, and practice, respectively. Lack of baseline information on pelvic floor muscle exercise was significantly associated with practice change following an educational class.ConclusionEducation is effective in improving knowledge of, attitude towards, and practice of pelvic floor muscle exercise. There is a need for greater effort to increase exercise awareness in our community, especially during antenatal class.

Baseline measurements of physiological and behavioural stress markers in the commercially important decapod Cancer pagurus (L.)

Increasing human activities in marine environments pose possibilities of new stressors affecting marine invertebrates important for fisheries. However, assessment of such stressors is hampered by lack of baseline information on stress markers in relevant species, particularly relating to potential diel rhythms. Cancer pagurus is the second most important crustacean for UK fisheries and, owing to its migratory habits, is likely to encounter anthropogenic stressors both inshore and offshore. However, there are no baseline measurements of commonly used stress markers in this species, particularly on juveniles, nor data on diel variations. This study aimed to establish baseline data for several stress components in C. pagurus: haemolymph l-Lactate, d-Glucose, Haemocyanin, haemolymph density and respiration rate, as well as behavioural indicators (activity level, antennular flicking rate) during day and night. l-Lactate and d-Glucose concentrations were positively related to crab size, larger crabs having higher concentrations. l-Lactate and d-Glucose levels followed similar circadian rhythms increasing towards dusk, coinciding with higher locomotor activities. l-Lactate levels in juvenile crabs showed a significantly different pattern compared to larger crabs, with lower concentrations maintained throughout the day without any significant increase at dusk. Haemocyanin concentration and haemolymph density were not affected by crab size, sex or time. However, females (0.06 ± 0.01 mg/g/h) consumed significantly more oxygen than males (0.04 ± 0.01 mg/g/h). Activity levels increased significantly at night when foraging mainly occurs. Small crabs were more active, but had lower antennular flicking rates compared to medium and large crabs during both day and night. The present work shows that crab size and sampling time influence the value of commonly used crustacean stress markers, suggesting that these factors should be incorporated into any studies monitoring stress responses of Cancer pagurus.