Jenin District Research Articles

Shedding light on the geographical distribution, population size and inflorescence coloration variety of Royal Irises (Iris section Oncocyclus) family in West Bank, Palestine

Palestine has rich floristic diversity due to its location, diverse biogeographical zones, and various topographical features. The Royal Irises (Iris section Oncocyclus), are a monophyletic group of herbaceous geophytes, consisting of 33 species, endemic to the Middle East. Within the West Bank of Palestine, three Royal Irises are documented. However, their distribution, population size, and status are not studied comprehensively. This study focused on evaluating the occurrence, distribution range, population size, status, number of flowers, inflorescence coloration variety, and habitats of the vulnerable and endemic Iris haynei, the endangered and sub-endemic Iris lortetii, and the vulnerable and sub-endemic Iris atrofusca. I. lortetii was found in 10 sites within Nablus district, with more than 12625 clones and 25088 flowers flowers recorded. I. haynei were documented in 4 sites within Jenin district, three are new to science, where 10729 clones and 9562 flowers were recorded. I. atrofusca was reported in 13 localities in Tubas and Ramallah districts, where 1853 clones and 8460 flowers were recorded, whereas six locatities are new to science. 12, 12, and 7 unique variations in coloration of inflorescences were observed for I. lortetii, I. atrofusca, and I. haynei, respectively. The results indicate that the population size and the distribution range of the three Royal Irises are larger than previously reported, whereas the documented inflorescences’ coloration variations are unique and considerable. This study sheds light on hotspot occurrence sites of endangered and vulnerable species in Palestine, which can assist in laying adequate conservation actions and management plans in the future.

Breakfast characteristics, perception, and reasons of skipping among 8th and 9th-grade students at governmental schools, Jenin governance, West Bank

BackgroundThere is growing recognition of the important role of breakfast in children’s nutrition, and the potential harms related to skipping breakfast, including its contribution to obesity and non-communicable diseases. The patterns associated with skipping breakfast may be related to the nutrition transition. This study aimed at exploring the composition of breakfast consumed by Palestinian school children and their perceptions toward this meal. It also aimed at exploring skipping breakfast prevalence, reasons, and its association with selected schoolchildren’s sociodemographic variables and behavioral patterns.MethodsA cross-sectional online survey was conducted among 12- to 14-year-old schoolchildren from 4 governmental schools in urban and rural areas of the Jenin district in Palestine. The questionnaire included information about children and parents sociodemographic and behaviours, breakfast patterns and composition, reasons for skipping breakfast, and items on schoolchildren’s perception toward breakfast. Statistical analysis of the relevant factors was undertaken using SPSS software.ResultsIn a sample of 193 schoolchildren, only 32% reported consuming breakfast all year round. The main reasons reported for skipping breakfast were not feeling hungry, not having the time, and lack of appetite. The vast majority (79%) believed breakfast was beneficial for general health. Sleeping before 10 pm, regular exercise (p value < 0.05). and shorter screen time were all significantly associated with a higher level of breakfast consumption (p value < 0.01).ConclusionUnderstanding the reasons for missing or skipping breakfast factors which make skipping it more likely, should inform public health strategies to promote breakfast consumption. For example, our findings suggest that awareness of the importance of breakfast was not a significant contributor to skipping breakfast, compared to other structural and cultural factors.

Medical waste management at three hospitals in Jenin district, Palestine.

Medical wastes are considered hazardous because they may possess infectious agents and can cause unsafe effects on the environment and human health. This study is to analyze and evaluate the current status of medical waste management at Jenin's district in light of medical waste control regulations recommended by the World Health Organization. The results demonstrated that the average hazardous healthcare waste generation rate ranges from 0.54 to 1.82kg/bed/day with a weighted average of 0.78kg/bed/day. There was no established waste segregation of healthcare waste types in all hospitals, and these wastes were finally disposed of in a centralized municipal sanitary landfill, namely Zahrat Al-Finjan. The results suggest that there is a need for activation and enforcement of medical waste laws. This can be achieved through cooperation among key actors: Ministry of Health, Environmental Quality Authority, Ministry of Local Government, and Non-Governmental Organizations working in related fields. Additional remediation measures proposed to tackle the problematic areas of medical waste management in Jenin's district hospitals are addressed. Some recommendations to minimize potential health and environmental risks of medical waste are also introduced.

Diversity, ecology, and seasonality of sand flies (Diptera: Psychodidae) of the Jenin District (Palestinian Territories).

The diversity, ecology, and seasonality for sand flies from two localities in Jenin District, the Palestinian Territories, were studied. A total of 12,579 sand flies (5,420 Phlebotomus and 7,159 Sergentomyia) were collected during the study period. The genera Phlebotomus and Sergentomyia are represented by 13 and nine species and subspecies, respectively. Species account was given for all collected species. CDC light traps yielded 7,649 (60.8%) of the total captured sand flies, while sticky traps and aspirators contributed to 36.4 and 2.8% of the total collected specimens, respectively. Phlebotomus sergenti and P. syriacus showed two peaks, one in July and one in October. Phlebotomus tobbi showed one peak towards the end of the summer in September and August, while P. papatasi showed a bimodal peaks pattern, one in June and one in October. Phlebotomus canaaniticus showed a peak in August. P. perfiliewi transcaucasicus and P. neglectus showed a peak in October. Sergentomyia dentata showed one peak in August and increasing numbers from June to August, declining afterwards. Other species, such as S. theodori, had one peak in June, S. taizi had steady numbers across the summer, and S. christophersi had a peak in August.

Landfill leachates as an abiotic disease factor affecting solanaceous crops and olive trees

Different landfills in Jenin district were selected in this research, and are considered the main garbage destination for the north part of the West bank. Due to their expected drastic effect on agriculture, the experiment was carried out to study the impact of such landfills on nearby olive orchards. The results showed that the landfills since their establishment caused drastic reduction of olive production from an average of 1500 kg/hectare in 2005 to 560 kg/hectare in 2009. Furthermore, olive production in the studied area stopped absolutely in 2011 due to complete olive orchard failure. On the other hand, the effect of landfills was studied on vegetables under lab conditions. Therefore, different dilutions of the landfill leachate were used to irrigate tomato and pepper plants. The results showed that leachate caused plant stunting and reduction in leaf surface area when compared with control regardless of dilution used, but more pronounced in dilution zero. On the other hand, chlorophyll concentration was more in plant treated with zero dilution of leachate when compared with other treatments. Number of dropped leaves was more in plant treated with zero dilution of leachate when compared with other dilutions and control. The plants treated with zero dilution died before others treatments. Conclusion: leachate may have a drastic effect on nearby cultivated plant and could affect plant growth and lead to premature plant death.

Lipid profiles of hemodialysis patients in the jenin district of Palestine

Objectives: We aimed to 1) compare the lipid profiles in hemodialysis patients and healthy controls, 2) find out if there are any differences in lipid profiles between diabetic and non-diabetic patients on hemodialysis and 3) investigate the effects of age, sex, and duration of dialysis on the lipid profiles in hemodialysis patients. Settings: The study was conducted in the hemodialysis unit in Jenin district at The Martyr Dr. Khalil Sulaiman Hospital of Jenin city for one calendar year. Patients and Methods: Seventy one patients who were not receiving any lipid lowering therapy were included; of these 26 had diabetes. Age-matched 98 healthy persons served as controls. Total cholesterol, triglycerides, HDL-cholesterol, and LDL-cholesterol levels were determined and two atherogenic indices (i.e. TC/HDL-C and LDL-C/HDL-C ratios) were calculated for patients and controls. Independent sample T-test, Pearson's correlation factor, one way ANOVA, and LSD multiple comparison test was used to test the significance of the results. P values &lt; 0.05 were considered as significant. Results: The results showed that hemodialysis patients have a significantly higher triglycerides and VLDL-C levels and lower HDL-C levels compared to controls. There were no statistically significant differences in total cholesterol or LDL-C levels, on the other hand, hemodialysis patients have a significantly higher TC/HDL-C and LDL-C/HDL-C ratios compared to controls. The lipid profile of diabetic hemodialysis patients is generally similar to the lipid profile of non-diabetics except that diabetic hemodialysis patients have a significantly lower HDL-C levels and a significantly higher TC/HDL-C and LDL-C/HDL-C ratios compared to non-diabetics reflecting the additional impact of diabetes on lipid profile. The lipid profile of hemodialysis patients seems to be independent of age, sex, or duration of dialysis. Conclusions: Hemodialysis patients, particularly those with diabetes, have an adverse lipid profile. This is likely contributing to the increased mortality rates. Further studies are needed to ascertain the cardiovascular abnormalities and elucidate the causes of death among hemodialysis patients specifically in our population.

Prevalence of occult HBV among hemodialysis patients in two districts in the northern part of the West Bank, Palestine.

Occult hepatitis B infection is the case with undetectable HBsAg, but positive for HBV DNA in liver tissue and/or serum. Occult hepatitis B infection among hemodialysis patients in Palestine has been understudied. In this study, 148 hemodialysis patients from 2 northern districts in Palestine, Jenin (89) and Tulkarem (59), were investigated for occult hepatitis B, HBV, HCV infections with related risk factors. ELISA and PCR were used for the detection of anti-HBc and viral DNA, respectively. The overall prevalence of occult hepatitis B infection among the study group was 12.5% (16/128). Occult hepatitis B infection is more prevalent among males with most cases (15/16) from Jenin District. About one-third (42/132) of the hemodialysis patients were anti-HBc positive. Approximately 27% of the hemodialysis patients were infected with HCV. Around 20% (28/140) were positive for HBV DNA, but only 8.2% (12/146) of the hemodialysis patients were positive for HBsAg. The comparison between hemodialysis patients with occult hepatitis B infection and those without occult hepatitis B infection for selected risk factors and parameters as liver Enzyme, age, sex, HCV infection, blood transfusion, kidney transplant, anti-HBc, and vaccination showed no statistical significance between both categories. Duration of hemodialysis significantly affected the rate of HCV infection. HCV is significantly higher in hemodialysis patients with both Diabetes mellitus and hypertension. The prevalence of occult hepatitis B infection among hemodialysis patients is high; requiring stringent control policies. HBsAg assay is insufficient test for accurate diagnosis of HBV infection among hemodialysis patients.

Characteristics and outcome of primary hyperoxaluria type 1 patients in Jenin district, Palestine

Background: Primary hyperoxaluria (PH) type 1 is a rare inherited metabolic disorder leading to urolithiasis, nephrocalcinosis and most often end-stage renal disease (ESRD). PH type 1 is the most common and the most severe form of primary hyperoxalurias worldwide. In the developing world, patients with PH type 1 usually have a poor prognosis and short survival time. Objectives: We aimed to document the characteristics and outcome of PH type 1 patients in Jenin district, Palestine being the type commonly seen here. Patients and Methods: 18 patients were diagnosed with primary hyperoxaluria type 1 in Jenin District (Palestine) between 2005 and 2012. A review of the patients' charts was performed and the following parameters were recorded: sex, age, age at first symptoms, age at ESRD (onset of dialysis), history of conservative treatment, history of parental consanguinity, family history of the disease, and outcome or current status. Some data were obtained directly from physicians and nurses of the kidney unit and/or from patients' families. Results: Seven patients were males and 11 were females. Mean age at diagnosis was 3.12 years while the median was 0.42 year (range: 3 months - 20 years). All the patients were from one tribe and the rate of parental consanguinity was 100%. Regarding patients' outcome, 7 children died before initiation of hemodialysis (6 of them during infancy and one at 8 years of age), 2 patients died from complications of liver or combined liver-kidney transplantation procedures, 2 patients died while on hemodialysis, 5 patients were still on conservative treatment at last follow-up, and 2 patients remained on hemodialysis. There was an important heterogeneity in symptoms, age at first symptoms, and age at ESRD. Conclusion: The high mortality rate among our patients compared to that found in the literature, may be due to the severity of the disease, shortage of some medical facilities such as absence of pediatric hemodialysis, preemptive liver or combined liver-kidney transplantation operations in Palestine.

Late diagnosis of primary hyperoxaluria type 1 despite recurrent kidney stones and positive family history

Primary hyperoxaluria type 1 (PH1) is the most common form of primary hyperoxalurias. It results in increased synthesis and subsequent urinary excretion of the metabolic end product oxalate and the deposition of insoluble calcium oxalate in the kidney and urinary tract. Individuals with PH1 are at high risk for recurrent nephrolithiasis, nephrocalcinosis, and end-stage renal disease (ESRD). A 13 years-old female presented with fatigue, headache, nausea, vomiting, anorexia, renal colic. Initial clinical and laboratory investigations revealed ESRD and the patient was initiated on hemodialysis. Family history of PH1 and a history of recurrent kidney stones for 4 years was elicited. Subsequently, PH1 was confirmed by, physical examination, medical history, family history, laboratory tests, ultrasound imaging, X- ray, CT scanning and renal biopsy. As this disease is no longer rare in Jenin District of Palestine where this patient was seen, delayed diagnosis can not be justified. In conclusion, early diagnosis and effective treatment of PH1 in areas with high prevalence, such as the Jenin District of Palestine, is warranted as it may delay the progression towards ESRD or systemic oxalosis.

Epidemiology of Tomato Yellow Leaf Curl Virus in the Northern Regions of the West Bank, Palestine

A survey was carried out in 2011 to study the epidemiology of tomato yellow leaf curl virus (TYLCV) in tomato growing sites of the Tobas and the Jenin districts. The survey studied the population of the virus-inoculative whiteflies and the possible virus reservoirs throughout the year. The maximum TYLCV-inoculative whitefly population was recorded in Tobas, compared with the Jenin district in the different growing seasons of tomato. In the Tobas district, the inoculative whiteflies started to appear in March and reached the maximum value of 7% in July and August. In the Jenin district, the maximum inoculative whitefly population of 6% was recorded in August. Such whiteflies started to appear in May, which is two months after their appearance in the Tobas district. Furthermore, populations of inoculative whiteflies occurred when farmers started their tomato growing seasons. The appearance of inoculative whiteflies coincided with availability of the virus natural reservoirs which harbor the virus and support the vector during the crop-free period. Infected cheese weed mallows (up to 12%) and tobacco plants (up to 7%) were the virus sources for whiteflies throughout the year in the Tobas and the Jenin districts respectively. Infected volunteer tomatoes (up to 93%) play a secondary role in the virus epidemiology as they disappear during winter (crop-free period) in both districts.

System dynamics model for hospital waste characterization and generation in developing countries

Waste management policy makers always face the problem of how to predict the future amount and composition of medical solid waste, which, in turn, helps to determine the most appropriate treatment, recycling and disposal strategy. An accurate prediction can assist in both the planning and design of medical solid waste management systems. Insufficient budget and unavailable management capacity are the main reasons for the scarcity of medical solid waste quantities and components historical records, which are so important in long-term system planning and short-term expansion programs. This article presents a new technique, using System Dynamics modeling, to predict generated medical solid waste in a developing urban area, based on a set of limited samples from Jenin District hospitals, Palestine. The findings of the model present the trend of medical solid waste generation together with its different components and indicate that a new forecasting approach may cover a variety of possible causative models and track inevitable uncertainties when traditional statistical least-squared regression methods are unable to handle such issues.

Primary Hyperoxaluria is the Main Cause of Chronic Renal Failure in Children under 15 Years Old in Jenin District (Palestine)

Background: This was the first study which has been conducted on chronic renal failure children under 15 years old in Jenin District to know the underlying etiology of the disease. The study was conducted on all patients who are treated by medications or hemodialysis in the dialysis unit of The Martyr Dr. Khalil Sulaiman Hospital in Jenin city which is the only dialysis unit in Jenin District where all the patients in Jenin District are treated. The study was conducted in the period 1/8/2005 to 1/8/2006. Materials and methods: The subjects were nine patients. The information was taken from files of the patients in the kidney unit. The diagnosis was based on family history, medical history, laboratory tests, X-rays, CT scans, ultrasound and renal biopsies. Results: The results showed that the causes of chronic renal failure were primary hyperoxaluria (66.7%) and congenital abnormalities of the kidney (33.3%). Conclusion: It is obvious from the results that the most common cause of CRF in children under 15 years old in Jenin District was primary hyperoxaluria which is an inherited disorder. These results differ from what is found in many countries around the world including Arab and Islamic countries where the most common causes of chronic renal failure in children are urological abnormalities and malformations (congenital anomalies) and not primary hyperoxaluria. The primary inherited nephropathy in Jenin District was primary hyperoxaluria with a percentage much higher than that found in many countries around the world. This seems to be due to the very high prevalence of parental consanguinity (especially among cousins) in some families in Jenin District, a practice that is repeated through generations.

The Second Case of Death in the Same Family from Chronic Renal Failure and Systemic Oxalosis as a Result of Primary Hyperoxaluria Type1

Background: Primary hyperoxaluria is a rare cause of chronic renal failure in children worldwide, but it is an important cause of chronic renal failure among children under 15 years old in Jenin district (Palestine) contributing about 67% of the causes of chronic renal failure among these children as was found in a previous study. The infantile form of hyperoxaluria manifests early with nephrocalcinosis and leads to end-stage renal failure in early childhood and the most severe form may lead to death during the first year of life. Case presentation: We report the case of a 8-years old boy with a history of primary hyperoxaluria type1 since the age of three months presented with ascites, generalized edema, fever, myopathy, limited movement ability, general malaise, severe malnutrition, and respiratory difficulties. Clinical, laboratory, ultrasound, cardiac investigations revealed end-stage renal failure accompanied by heart failure, liver failure, liver cirrhosis, and systemic oxalosis. The patient was in a bad condition, stayed 4 days in the ICU and died in the fourth day from complications of systemic oxalosis. Conclusion: History revealed that this is the second case of death in the same family from ESRD and complications of primary hyperoxaluria. The first death was for his brother since about 10 years who died at age of three months. It seems that the primary hyperoxaluria type 1 in this family is very severe and leads to end-stage renal disease and systemic oxalosis in early childhood despite conservative treatment. Since, sometimes, there are more than one case of primary hyperoxaluria in the same family, all children in the family with a history of primary hyperoxaluria - even who looks like healthy - must be screened for the disease because early diagnosis is important in treating strategies and delaying complications such as end-stage renal disease and systemic oxalosis.

Epidemiological and clinical features of cutaneous leishmaniases in Jenin District, Palestine, including characterisation of the causative agents in clinical samples

During 2002–2009, 466 cases of cutaneous leishmaniasis (CL) were reported from Jenin District, Palestine, affecting both genders. The average annual incidence was 23 cases per 100000 inhabitants, increasing with age in children. Most cases presented a single lesion, generally on the face. Diagnosis and species identification was done by applying internal transcribed spacer 1 (ITS1) RFLP analysis to 47 isolates, of which 44 (93.6%) were Leishmania tropica and 3 (6.4%) were L. major. RFLP analysis was also performed on 256 skin tissue scrapings spotted onto filter papers, showing that 138 (53.9%) were positive, of which 50.7% were infected with L. tropica, 17.4% with L. major and 2.9% with L. donovani s.l., and 29.0% could not be identified. This is the first report from Palestine on human CL caused by L. infantum. Nine of the strains of L. tropica were subjected to multilocus enzyme electrophoresis, six of which belonged to the zymodeme MON-137 and three to a new zymodeme (MON-307). This separation was corroborated by excreted factor serotyping. This observation modifies the classical epidemiological view of CL in Palestine. Jenin District is an active focus of CL caused by L. tropica, where Phlebotomus sergenti, the putative vector, is abundant. These data suggest that CL is a zoonotic infection, but an animal reservoir has not been found.

Genetic, serological and biochemical characterization of Leishmania tropica from foci in northern Palestine and discovery of zymodeme MON-307

BackgroundMany cases of cutaneous leishmaniasis (CL) have been recorded in the Jenin District based on their clinical appearance. Here, their parasites have been characterized in depth.MethodsLeishmanial parasites isolated from 12 human cases of CL from the Jenin District were cultured as promastigotes, whose DNA was extracted. The ITS1 sequence and the 7SL RNA gene were analysed as was the kinetoplast minicircle DNA (kDNA) sequence. Excreted factor (EF) serotyping and multilocus enzyme electrophoresis (MLEE) were also applied.ResultsThis extensive characterization identified the strains as Leishmania tropica of two very distinct sub-types that parallel the two sub-groups discerned by multilocus microsatellite typing (MLMT) done previously. A high degree of congruity was displayed among the results generated by the different analytical methods that had examined various cellular components and exposed intra-specific heterogeneity among the 12 strains.Three of the ten strains subjected to MLEE constituted a new zymodeme, zymodeme MON-307, and seven belonged to the known zymodeme MON-137. Ten of the 15 enzymes in the profile of zymodeme MON-307 displayed different electrophoretic mobilities compared with the enzyme profile of the zymodeme MON-137. The closest profile to that of zymodeme MON-307 was that of the zymodeme MON-76 known from Syria.Strains of the zymodeme MON-307 were EF sub-serotype A2 and those of the zymodeme MON-137 were either A9 or A9B4. The sub-serotype B4 component appears, so far, to be unique to some strains of L. tropica of zymodeme MON-137. Strains of the zymodeme MON-137 displayed a distinctive fragment of 417 bp that was absent in those of zymodeme MON-307 when their kDNA was digested with the endonuclease RsaI. kDNA-RFLP after digestion with the endonuclease MboI facilitated a further level of differentiation that partially coincided with the geographical distribution of the human cases from which the strains came.ConclusionsThe Palestinian strains that were assigned to different genetic groups differed in their MLEE profiles and their EF types. A new zymodeme, zymodeme MON-307 was discovered that seems to be unique to the northern part of the Palestinian West Bank. What seemed to be a straight forward classical situation of L. tropica causing anthroponotic CL in the Jenin District might be a more complex situation, owing to the presence of two separate sub-types of L. tropica that, possibly, indicates two separate transmission cycles involving two separate types of phlebotomine sand fly vector.

دراسة انتشار وتنوع طفيليات الجهاز الهضمي عند المجترات الصغيره باستخدام نظامين من التربية في محافظة جنين في فلسطين

This study was undertaken to investigate the prevalence of gastrointestinal parasites (GIP) in goats and sheep kept under extensive and intensive management systems in the district of Jenin, Palestine, during the period from January to December 2010. Factors affecting diversity, distribution and intensity of infection by GIP were investigated. Data about farm history and breeding management were collected by means of a questionnaire. A total of 810 faecal samples from small ruminants composed of 285 and 525 samples from intensive and extensive rearing systems, respectively, were collected from eight villages (Yamoun, Bet qad, Merkah, Talfeet, Kfaret, Tarem, Jab`a and Aneen). A total of thirteen genera of the GIPs, included (eleven nematodes, one cestode (Moniezia) and one protozoan (Eimeria) were recovered. The results showed fewer diversity of GIP in intensive rearing system. The prevalence of GIPs in animals reared under extensive system (26.5%) was significantly higher (P هدفت هذه الدراسة الى عزل الطفيليات التي تصيب الجهاز الهضمي في المجترات الصغيرة حسب نوع التربية في المزرعة وهي نوعان (تربية مكثفة، تربية غير مكثفة) في منطقة جنين وذلك خلال الفترة الواقعة بين شهر يناير واكتوبر من العام 2010. تم جمع المعلومات عن طرق التربية المتبعة لكل مزارع واستخدامه للعقاقير المضادة للطفيليات وعدد الحيوانات في المزرعة من خلال استبيان واسئلة مباشرة وغير مباشرة للمزارعين. تم جمع 810 عينة من الروث اخذت من فتحه الشرج من الحيوانات، منها 285 عينة من الحيوانات المرباة باستخدام نظام التربية المكثفة و525 من الحيوانات المرباة باستخدام نظام التربية غير المكثفة في ثمانيـة قرى من محافظه جنين وهي: اليامون، بيت قاد، مركة، تلفيت، كفيرت، الطرم، جبع وعانين. خلال الدراسة تم عزل ثلاثة عشر جنس من الطفيليات التي تصيب المجترات الصغيرة وهي أحد عشر جنس ينتمي للديدان الاسطوانيه وجنس واحد ينتمي للديدان الشريطية Monieziaوجنس واحد ينتمي للاوليات .Emieria بينت الدراسة ان نسبه معدلات الاصابة بالأجناس المختلفة هي 26.5% في الحيوانات الموجودة في النظام التربية الغير مكثف والاجناس هي (Eimeria, Dictyocaulus, Haemonchus, Moniezia, Trichostrongylus Strongylus, Neoscaris, Nematodirus, Strongyloides, Ascaris, Cooperia, Chabertia and Trichuris) بينما كانت نسبه معدلات الإصابة 7.9% عند المجترات الصغيرة باستخدام نظام التربية المكثف وهذه الاجناس هي ( Eimeria, Dictyocaulus, Trichostrongylus, Neoscaris and Ascaris ). ومن هنا نلاحظ أن نسبة الاصابة في الحيوانات في نظام التربية غير المكثف أعلى وعدد اجناس الطفيليات التي تم عزلها اكثر من الحيوانات المربأة في نظام التربية المكثف وكانت الفروق معنويةP

Prevalence of hepatitis C, hepatitis B, and HIV infection among hemodialysis patients in Jenin District (Palestine)

Background and Aims: End-stage renal disease patients treated by hemodialysis (HD) are more susceptible for infection by viral hepatitis and human immunodeficiency virus (HIV) infections. Infection by these viruses is promoted by the characteristic immunological dysfunction that develops in renal failure and interferes with the patient's ability to eliminate these viruses. Prevalence of these viruses among hemodialysis patients in Jenin District (Palestine) was not studied until now, we aimed in this study to determine the prevalence of HCV, HBV and HIV among hemodialysis patients in Jenin District using serological methods, and to define the main risk factors for HCV infection. Materials and Methods: End-stage renal disease (ESRD) patients on maintenance hemodialysis from various demographic areas in Jenin District were included in the study. Data such as age, sex, drug abuse, history of transplantation were examined. Serological markers for HCV, HBV and HIV were determined using a microparticle enzyme immunoassay (MEIA). Pearson’ s correlation factor and independent samples t-test were used to analyze the significance of results. Results: The patients were 77 (42 males, 35 females, mean age 50.73 ± 16.78 years [age range: 14 – 80 years]), the mean duration of dialysis was 26.97 months with a standard deviation of 35.19 days. The prevalence of HCV was 24.68 % while the prevalence of HBsAg and HIV were 0% respectively. HCV seropositivity was associated with longer period of dialysis (P=0.000). There was no statistically significant correlation between age and HCV seropositivity (P=0.630), also there was no statistically significant relationship between sex and infection with HCV (P=0.849). Conclusion: The prevalence of HCV among hemodialysis patients in Jenin District is high compared to many Arab and other countries. None of the patients were a former drug abuser or had a history of tattooing. None of the patients was with a former transplant was HCV positive, so it seemed that the infection was mainly nosocomial during dialysis process. Duration of dialysis was an important risk factor (P=0.000). Dialysis staff, incomplete disinfection of dialysis machines (monitors), non-isolation of HCV positive patients on special dialysis units or special monitors may be important risk factors. So, careful attention of the preventive infection control measures is essential to limit the transmission of HCV in the dialysis unit in Jenin District.

First Report of Squash leaf curl virus in Squash (Cucurbita pepo), Melon (Cucumis melo), and Cucumber (Cucumis sativa) in the Northern West Bank of the Palestinian Authority.

In the summers and falls of 2008 and 2009, cucurbit plants (squash, Cucurbita pepo L.; cucumber, Cucumis sativus L.; and melon, Cucumis melo L.) from 23 of 33 cucurbit fields surveyed at three districts (Jenin, Nablus, and Tulkarm) in the West Bank of the Palestinian Authority exhibited curled, blistered, yellowed, and mottled leaves and small deformed fruits. Disease incidence ranged from 24 to 100% and was associated with whitefly (Bemesia tabaci) infestation. In symptomatic leaves of 94 plants (89 squash, 3 cucumber, and 2 melon) of 208 plants examined, geminiviral DNA was detected by PCR and rolling circle amplification (1). Geminivirus DNA-A and DNA-B component fragments were amplified by PCR using degenerate primers PAL1v1978/pPAR1c496, for DNA-A component and PBL1v2040l/PCRc1 for DNA- B component (4). A fragment from DNA-A was amplified using specific primers for DNA-A: SLCVSTCF1F (ATAATCTAGACCATGGGGTGTCCTCTCAACTTTCTCA) and SLCVSTCF3R (ATATGGATCCATTTAAATTCTTCACAAAGCGTTCCTG) and the generated PCR product was sequenced. A DNA-A fragment (922 bp) from a conserved region of the coat protein (AV1) gene showed 98, 98, 97, and 96% nucleotide identity with sequences of Squash leaf curl virus (SLCV) isolates from Jordan (GenBank Accession No. EF532620), Egypt (DQ285019), California (DQ285016), and Arizona (AF256203), respectively. Nonviruliferous whiteflies were allowed to feed on symptomatic cucurbit plants for 48 h. The whiteflies were then transferred to 30 healthy squash seedlings at the first-leaf stage and given a 48-h inoculation access period. Typical SLCV symptoms developed in these plants 9 to 10 days postinoculation (1). Until recently, SLCV was restricted to North America; however, in 2003, the first record on its occurrence in the Middle East was in Israel where it caused severe epidemics and disease incidence reached 100% (2). In 2006, the virus was reported to cause the severe symptoms observed in squash fields in Egypt (3). More recently, in 2008, it was detected in all surveyed areas in Jordan and disease incidence reached 95% in squash samples collected from the Dir Alla area (1). The new emergent disease in the Palestinian Authority was detected in all surveyed squash fields located in the Jenin District, in an area (Al-Fara') about 25 km to the west of Dir Alla in Jordan. Only a few sporadic cases were found in cucumber fields (three isolates) in Tulkarm and in melon fields (two isolates) in Nablus. This indicates that the virus might have spread from Jordan via viruliferous whiteflies or seedlings. The virus endangers the production of squash in the affected areas to the point of becoming the limiting factor of growing squash in open fields. To our knowledge, this is the first report of a whitefly-transmitted geminivirus infecting cucurbits in the Palestinian Authority.

Population genetics of Leishmania infantum in Israel and the Palestinian Authority through microsatellite analysis

Multilocus microsatellite typing (MLMT) was used to investigate the genetic variation among 44 Israeli and Palestinian strains of L. infantum isolated from infected dogs and human cases to determine their population structure and to compare them with strains isolated from different European countries. Most of the Israeli and Palestinian strains had their own individual MLMT profiles; a few shared the same profile. A Bayesian model-based approach and phylogenetic reconstructions based on genetic distances inferred two main populations that were significantly different from the European strains: population A, containing 16 strains from places in the West Bank and 11 strains from central Israel; and population B, containing 7 strains from northern Israel, 9 from central Israel, and one Palestinian strain from the Jenin District. Geographically distributed sub-populations were detected within population B. These results demonstrate similar disease dynamics in Israel and the Palestinian Authority. The re-emergence of VL in the case of population A is more likely owing to increased dog and human contact with sylvatic cycles of parasitic infection rather than to recent introduction from the older foci of northern Israel. The latter scenario could be true for population B found in few foci of Central Israel.

Occurrence of Tomato Yellow Leaf Curl Virus on Volunteer Tomato, Jimsonweed, and Tobacco in North West Bank: Distribution of Virus Natural Reservoirs in Summer Season

Volunteer tomato (Lycopersicon esculentum), jimsonweed (Datura stramonium) and tobacco (Nicotiana tabacum) plants were found to be natural reservoirs for Tomato Yellow Leaf Curl Virus (TYLCV) in the northern West Bank regions using the Polymerase Chain Reaction (PCR). The virus can be maintained in these plants during the summer period in the studied regions. Volunteer tomato plants proved to be the most significant reservoirs for the virus because they are so abundant in all of the studied regions, and they demonstrated a high rate of infection, ranging from 52-95%. The maximum infection of volunteer tomato plants was recorded in the Jericho district and Al-Far'a region to be 95% and 93%, respectively. Under field conditions, TYLCV was found to infect tobacco in one of two ways; either as crops planted near the tomato fields or as volunteer plants scattered in tomato growing sites in the Jenin districts. The maximum infection rate of volunteer tobacco plants and tobacco crops was recorded in Qabatyya to be 11% and 6%, respectively. The research showed that tobacco seedlings in nurseries can be infected with TYLCV by 3.5% in the Jenin district. Jimsonweed was discovered to be a natural host of TYLCV, however with low proportion and only in the Jericho district (one out of every two samples collected).