ITS Region Research Articles

Morphological and molecular characterization of Purpureocillium lilacinum along with its biopesticidal effect against fall armyworm (Spodoptera frugiperda) in Southern Taiwan

Abstract Background Fall armyworm (FAW), Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae), a key agricultural pest, impacts a broad spectrum of crop species, such as cotton, maize, rice, sorghum, and a range of vegetables. Chemical pesticides and transgenic maize are commonly used to protect crops against this major pest. However, biological control offers a safer and more sustainable solution for long-term FAW management. Entomopathogenic fungi (EPF), a substitute for synthetic insecticides, have been proven to be an effective biocontrol agent for managing pest populations. The present study objective is to isolate and identify the EPF, Purpureocillium lilacinum from soil using morphological and molecular techniques and evaluate its pathogenicity against FAW eggs and various larval stages under different spore concentrations. Results The micro-morphological characteristics fluctuated in growth behavior, appearance, and color under diverse growth media and temperatures. Molecular analysis, which involved constructing a phylogenetic tree from ITS and TEF gene regions, confirmed that PT-02 was P. lilacinum. The pathogenicity of the fungus was tested on FAW eggs, neonates, and larvae at multiple concentrations (1 × 108, 1 × 107, and 1 × 106 spores/ml), resulting in variation mortality. The egg mortality rate at 1 × 108, 1 × 107, and 1 × 106 spores/ml was 98, 98 and 96%, respectively. The neonate mortality rate was 100%, while first and second instars larvae mortality ranged from 10–36% across three concentrations, seven days after treatment (DAT). The median lethal concentration (LC50) values of P. lilacinum PT-02 against FAW eggs, first and second instars, were 3.02 × 107, 1.38 × 108, and 2.56 × 108 spore/ml, respectively. Conclusions The findings revealed that the native strain of P. lilacinum exhibited strong virulence against FAW, suggesting its potential use as an effective biocontrol agent for managing field pest populations.

Effect of Integrated Crop–Livestock Systems on Soil Properties and Microbial Diversity in Soybean Production

Integrated crop and livestock systems (ICLSs) have been considered an important management-based decision to improve soil health by carbon sequestration. A two-year study (2019–2021) at CPBES in Newton, MS, was conducted to evaluate the effect of an ICLS on soil microbial diversity in the southeastern region of the USA, representing agroclimatic conditions that are warm and humid. Amplicons targeting bacterial 16S rRNA genes and fungal ITS2 regions were sequenced. Taxonomic assignment and characterization of microbial diversity were performed using QIIME2®. Soil fungal diversity pattern showed significant difference (alpha diversity, p = 0.031 in 2020 and beta diversity, p = 0.037 in 2021). In contrast, no significant differences were observed in bacterial diversity. However, there were several beneficial bacterial phyla, such as Proteobacteria and Actinobacteria, and fungal phyla such as Ascomycota, which were dominant in both years and did not show significant differences due to cover crop treatments. Canonical Correspondence Analysis (CCA) and Mantel test showed significant influence on fungal diversity due to carbon (rm = 0.2581, p = 0.022), nitrogen (rm = 0.2921, p = 0.0165), and electrical conductivity (rm = 0.1836, p = 0.0583) in 2021, and on bacterial diversity due to EE-GRSP (rm = 0.22, p = 0.02) in 2020. However, the results showed that there were no significant differences between the cover crop treatments that were consistent over a two-year study period. However, the mix of different cover crops such as oats (Avena sativa L.), crimson clover (Trifolium incarnatum L.), and tillage radish (Raphanus sativus L.) demonstrated higher positive correlation and lower negative correlation with different bacterial and fungal phyla. Long term study of ICLS is suggested to understand the shift in microbiome that would help in understanding the role of cover crops and grazing in improving crop production sustainably.

First Report of Almond Decline Syndrome Caused by Neofusicoccum parvum in Italy

Almond (Prunus dulcis Mill. D. A. Webb) is considered a major crop in the Mediterranean countries. In Italy, almond orchards cover an area of 54,939 ha, with a yield of 82,146 t, with the cultivation widely distributed across several areas, such as southern regions. During the summer of 2023, 3-year-old almond plants cultivated in a commercial orchard in southern Piedmont (44°32’41.92’’ N; 7°57’25.7’’ E) showed wilting and sudden decline of the whole plant with an incidence of 15%. Main symptoms were cankers on the trunk characterized by a chocolate-brown discoloration of wood, cambium and even bark and occasional presence of gummy exudate. Symptomatic bark samples were rinsed with water, then blotted dry, and briefly soaked in ethanol for 15 s. Small pieces (5 × 5 mm) from the margin of necrotic areas were cut and placed on potato dextrose agar (PDA) plates amended with streptomycin sulphate (150 μg/ml). After incubation in the dark at 25 °C for 4 days fungal colonies emerging from the plated fragments were subcultured as monohyphal fungal cultures. They were fast-growing, turning from withish to smoky grey or grey-olivaceous after a week. Stromatic conidiomata were produced in pine needle agar, with pycnidia forming hyaline, globose to ellipsoidal, unicellular conidia, ranging in size from 16.9–17.3 μm × 5.4–5.6 μm. The causal agent was preliminary identified as Neofusicoccum sp. based on morphology. Two representative isolates (MTB3, MTC4) were identified by sequencing the ITS region and translation elongation factor 1-alpha (TEF1-α) gene with the primer pairs ITS1/ITS4 (White et al. 1990) and EF1-728F/EF1-986R (Carbone and Kohn 1999). The sequences of the two isolates were deposited in NCBI GenBank with accession numbers PP930646 / PP930647 (ITS), and PP933185 / PP933186 (TEF-1α). BLAST analysis revealed 99% similarity with reference sequences of Neofusicoccum parvum isolate CMW9081. A maximum-likelihood phylogenetic tree was constructed using MEGA7 software based on the combined ITS and TEF1-α dataset. The phylogenetic tree demonstrated that the two isolates grouped with N. parvum in a clade with the ex-type CMW9081. The pathogenicity of both isolates was evaluated on 1-year-old ‘Vairo’ almond potted plants grafted on GF677 rootstock, to assess Koch’s postulate. For the inoculation, 5 mm in diameter mycelium plugs taken from a 7-days-old PDA culture were placed on the surface of fresh wounds made with a sterile cork-borer (5 mm-diameter) on the stem. Control plants were inoculated with sterile PDA plugs. The test was conducted twice. Three blocks of three plants per isolate and control were arranged in a randomized block design. All inoculated plants showed symptoms of shoot blight and cankers 2-weeks after inoculation. Additionally, gumming, pycnidia production and internal wood discoloration developed on the inoculation sites, with lesion length spreading for 16.8 ± 1.6 and 15.4 ± 3.0 cm for MTB3 and MTC4, respectively. Most of the plants died one month after inoculation. Control plants showed no symptoms. The pathogen was consistently reisolated from inoculated plants and the identity was confirmed through TEF-1α sequencing. Thus, results of Koch postulate clearly identify N. parvum as the etiological agent of the observed disease of almond in Piedmont. N. parvum was recently reported in the same area on hazelnut (Waqas et al. 2021) and blueberry (Guarnaccia et al. 2021), and as causal agent of band canker and branch dieback in almond trees in US and Spain (Moral et al. 2019). To our knowledge, this is the first report of N. parvum as the causal agent of almond decline syndrome in Italy. Considering the increasing of almond cultivation in Italy, this disease represents a threat for the future production.

First Report of Root-knot Nematode, Meloidogyne enterolobii, on Luffa cylindrica (L.) in Guangxi, China.

Luffa cylindrica (L.), an annual climbing herb of the Cucurbitaceae family, has a long planting history in China and is deeply loved by people due to its nutritional and medicinal value (Partap S, Kumar A et al., 2012). April 2023, symptoms such as plant dwarfism, decreased yield and serious root-knots appeared on L. cylindrica sampled from a commercial production base in Beihai, Guangxi, China (GPS 21°55'79″ N;109°49'61″ E). The investigated area of L. cylindrica was about 1.3 ha, the incidence of root-knot nematode disease was almost 90%. The roots of 20 L. cylindrica were dug up and many root-knots and egg masses were found. Nematodes in samples at different stages were collected by shallow dish method, and morphological identification was caried out. Males were worm-like, annulated, with the anterior part slightly conical. Females were globular to pyriform. The perineal pattern was oval, with the dorsal arch being moderately high to tall. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. The transparent tail end was clearly visible. Morphological measurements of females (n = 20): body length = 677.2 ± 34.4 μm, body width = 512.8 ± 45.4 μm, stylet = 13.7 ± 0.5 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.7 ± 0.8 μm. The measurements of J2s (n = 20): body length = 412.5 ± 19.4 μm, body wide = 16.2 ± 1.3 μm, stylet lengths = 12.6 ± 0.92 μm, DGO length = 3.1 ± 0.3 μm. Average tail length = 45.44 ± 4.1μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and EPPO (2016). J2s hatched by single egg mass were used for DNA extraction and identification of molecular biology. Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), the specific primers of M. enterolobii, was used to validate this pathogen (Long et al., 2006). Consistent with that described before, the target amplification product was about 236 bp, and no product was obtained from the negative control, M. incognita and M. javanica (Chen et al., 2023). Using V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), the rDNA ITS region was obtained and sequenced (Vrain et al., 1992). The target product was 765 bp (GenBank accession no. PQ205316), which was 100% homologous to those M. enterolobii ITS sequence available in the GenBank (KX823372, KJ146863). Koch's postulates were used to verify the pathogenicity of M. enterolobii on L. cylindrica, twelve 2-week-old L. cylindrica were planted in sterilized soil and inoculated with M. enterolobii J2s at a rate of 3,000 individuals per plant. The plants were grown at 26°C in a greenhouse, with non-inoculated controls set up. After 8 weeks, the roots of the non-inoculated plants (n = 12) showed no root-knot and grew well, while all inoculated plants developed root-knots and exhibited stunted growth. The average reproduction factor of the inoculated plants was 19.5, and the average root-knot rating was 7.2 (on a scale of 0 to 10) (Bridge and Page 1980), confirming the pathogenicity of M. enterolobii on L. cylindrica. We found that this is consistent with the description of M. enterolobii infecting Coriandrum sativum in Shanxi, China (Pan et al., 2024) and the infection of Selenicereus costaricensis in Guangxi, China by M. enterolobii (Wu et al., 2023). To our knowledge, this is the first report of M. enterolobii parasitizing L. cylindrica in Guangxi, China. With the increase of vegetable planting area, root-knot nematodes are becoming more and more serious and have become a limiting factor on vegetable production. This finding is of significant importance for vegetable growers to control M. enterolobii in this region, based on which suitable management measures will be taken.

First Report of Southern Blight of Epimedium sagittatum Caused by Agroathelia rolfsii in Henan, China.

Epimedium [Epimedium sagittatum (Sieb. et Zucc.) Maxim., E. brevicornu Maxim., E. pubescens Maxim., E. koreanum Nakai] plants are perennial herbs and the dry leaves were used in traditional Chinese medicine with different medicinal effects (Chinese Pharmacopoeia, 2020 edition). In early August 2022 (the high temperature was 33 ℃ and the low temperature was 25 ℃ on average with above 70% relative humidity), large necrotized leaf spots were initially observed in one-year and two-year old E. sagittatum plants in Dengzhou (32°35'26.84" N, 112°11'8.37" E), Henan province, China. White mycelia, yellow and brown sclerotia were observed along the petioles and colonized to the back of leaves and also on soil-petioles interface around the diseased Epimedium plants. White mycelia spread rapidly from the disease plants as a center to neighboring plants and the infected plants eventually wilted. The disease incidence was 16.0% and 28.0% in the surveyed cultivation fields in Dengzhou (Henan) and Danjiangkou (Hubei), respectively, which resulted in above 20% of yield loss. The symptomatic tissues (petioles, n≥10) were cut into 0.5 cm sections with autoclaved scissors and surface sterilized with 75% ethanol for 30 s, followed by 3 min in 1% NaClO, rinsed three times with distilled sterile water, plated on autoclaved filter paper to remove excess moisture in a biological laminar hood, transferred onto potato dextrose agar (PDA) plates and incubated at 28℃ in incubator in the dark for 3-5 days. Twelve fungal isolates with white radial colony morphology were obtained and purified by hyphal-tip method. The isolates formed radial colonies showing abundant aerial mycelia with a growth rate of 19.25 to 22.25 mm/day (mean = 21.67 ± 0.77 mm; n = 36) and white abundant sclerotia were observed after 5-7 days post inoculation at 28℃. The hyphae of the isolates were hyaline, branched with clamp connections at septa. The isolates formed dark brown sclerotia on PDA plate post 10-14 days incubation. The diameter of mature brown sclerotia ranged from 1.31 to 3.07 mm (mean = 1.91 ± 0.39 mm; n = 40) and 13 to 45 sclerotia (mean = 28; n = 24) were observed on each Petri dish. The isolates were tentatively identified as Agroathelia rolfsii based on morphological characteristics (Yi Y., et al. 2024) and isolate YYHBJ1 was selected as representative isolate for molecular identification and pathogenicity test. The genomic DNA was extracted using CTAB method. For molecular identification, ITS region, translation elongation factor-1alpha (TEF-1α) and nuclear large-subunit ribosomal DNA (nLSU-rDNA) were amplified (White et al. 1990, Wendland and Kothe, 1997). The sequences 684-bp ITS (OR428367), 534-bp TEF1α (OR485567), and 965-bp nLSU-rDNA (OR426612) of isolate YYHBJ1 were deposited in GenBank. Sequence analysis revealed that ITS, TEF1α and nLSU-rDNA sequences of YYHBJ001 showed 100%, 99.63%, and 100% identity to ITS (MN380242 and JF819727), EF1α (MN262527) and nLSU-rDNA (MT225781 and AY635773) sequences of Agroathelia rolfsii (Sacc.) Redhead & Mullineux (Redhead and Mullineux 2023). Pathogenicity tests was confirmed by inoculating 1 year-old E. sagittatum plants grown in pots with sterile soil. PDA plug (5 mm diameter) colonized with 3 brown sclerotia and the fungal culture which was cultivated for 12 days was deposited beside the petiole on the surface of the soil. The control plants were inoculated with PDA plugs without the pathogen. Five plants were used in each treatment. The plants were cultivated in incubator at 28℃ with 80% relative humidity. Fourteen days later, white mycelia growing out from the sclerotia and spread along the petioles to the leave and the infected leaves were yellow. After 21 to 24 days, all inoculated plants displayed symptoms like those observed in field, while no symptoms were observed on the controls. The fungus was re-isolated from the inoculated plants as described above, fulfilling Koch's postulates. The pathogenicity tests were repeated three times. Based on morphological feature and DNA sequences, the pathogen of southern blight on Epimedium plants was identified as A. rolfsii (anamorph S. rolfsii). The pathogen A. rolfsii usually infect kinds of crops and cause southern blight, such as peanuts, chili peppers, green onion and so on (Daunde et al. 2018). To our knowledge, this is the first report of A. rolfsii causing southern blight on E. sagittatum plants in Henan in China.

Tick Infestation and Molecular Detection of Tick-Borne Pathogens from Indian Long-Eared Hedgehogs (Hemiechinus collaris) in Pakistan

Hedgehogs can act as reservoirs for the transmission of tick-borne pathogens (TBPs) to domestic livestock, wild animals, and humans. Understanding host–tick dynamics is essential to evaluate the impact of TBPs. This study was conducted in Pakistan and aimed to determine the prevalence and species of TBPs in the blood and ticks of Indian long-eared hedgehogs captured from various environments. A total of 64 hedgehogs were captured to check for tick infestation. Tick species were identified morphologically and molecularly including ITS-2 region amplification by PCR and subsequent Sanger sequencing. Moreover, TBPs were identified in both ticks and the blood of hedgehogs through conventional PCR and sequencing, targeting the regions msp1b, 18S rRNA, and cytb for Anaplasma spp., Babesia spp., and Theileria spp., respectively. Out of 64 hedgehogs, 16 (25%) were found to be infested with ticks. Morphological and molecular analysis identified all 109 collected ticks as Rhipicephalus turanicus. Only one hedgehog (6.2%) was infected with A. marginale. From the tick samples, 3.7% tested positive for Theileria lestoquardi, 2.8% for Anaplasma marginale, and another 2.8% for Babesia bigemina. This study provides critical insights into circulating TBPs in this region and what possible role hedgehogs might play in disease maintenance for Anaplasma marginale while identifying multiple pathogens that are of concern to human and animal health.

Phylogenetics and reticulation among koelerioid clades, part I: Contraction of Trisetum, expansion of Acrospelion, Graphephorum, and Tzveleviochloa; Graciliotrisetum gen. nov. and resurrection of Aegialina (Poaceae, Pooideae, Poeae, Aveninae)

AbstractKoelerioid grasses (subtribe Aveninae, tribe Poeae; Pooideae) resolve into two major clades, here called Koelerioid Clades A and B. Phylogenetic relationships among koelerioid grasses are investigated using plastid DNA sequences of rpl32‐trnL, rps16‐trnK, rps16 intron, and ITS regions, focusing on Trisetum, Acrospelion, and some annual species (Rostraria p.p. and Trisetaria p.p.) closely related to Trisetum flavescens in Koelerioid Clade A. Phylogenetic analyses of several selected data sets performed for 80 taxa and using maximum likelihood and Bayesian methods, revealed mostly congruent topologies in the nuclear and plastid trees, but also reticulation affecting several lineages. Trisetum is restricted to one species, T. flavescens, which is a sister to the clade formed by Trisetum gracile and Trisetaria aurea. The latter two species are classified here in the genus Graciliotrisetum gen. nov. The sister clade includes three species of Rostraria and Trisetaria lapalmae, all of which are classified here in a resurrected genus, Aegialina, which includes four species. Acrospelion is enlarged to include 13 species after the addition of other species formerly classified in Trisetum sect. Trisetum and T. sect. Acrospelion. We also transfer Trisetum ambiguum, Trisetum longiglume, and Koeleria mendocinensis to Graphephorum; and Helictotrichon delavayi to Tzveleviochloa, expanding these genera to eight and six species, respectively. We evaluate cases of reticulate evolution between Koelerioid Clades A and B and within Koelerioid Clade A, which probably gave rise to Graphephorum, Rostraria cristata, and Rostraria obtusiflora. Finally, we comment on polyploidy and biogeographic patterns in koelerioid grasses. We propose the following 26 new combinations: Acrospelion alpestre, Acrospelion altaicum, Acrospelion argenteum, Acrospelion bertolonii, Acrospelion buschianum, Acrospelion buschianum subsp. transcaucasicum, Acrospelion fuscum, Acrospelion laconicum, Acrospelion macrotrichum, Acrospelion rigidum, Acrospelion rigidum subsp. teberdense, Acrospelion tamonanteae, Acrospelion velutinum, Aegialina lapalmae, Aegialina pubescens, Aegialina pumila, Aegialina pumila subsp. fuscescens, Aegialina salzmannii, Aegialina salzmannii subsp. cossoniana, Graciliotrisetum aureum, Graciliotrisetum gracile, Graphephorum ambiguum, Graphephorum longiglume, Graphephorum mendocinense, Graphephorum orthochaetum, and Tzveleviochloa delavayi. Lectotypes are designated for the names Aegialitis tenuis, Aira melicoides, Avena aspera var. parviflora, Avena delavayi, Koeleria grisebachii var. mendocinensis, Koeleria pubescens subsp. cossoniana, Koeleria pumila, Koeleria salzmannii, Phalaris pubescens, Trisetum aureum, Trisetum cernuum, Trisetum fuscescens, Trisetum longiglume, and Trisetum wolfii; and we designate one neotype for Alopecurus litoreus.

Amphisphaeria hongheensis sp. nov. (Amphisphaeriaceae, Amphisphaeriales) from Yunnan Province, China

Yunnan Province encompasses the highest fungal diversity in China, and novel fungal species are regularly introduced. Several saprobic fungi were collected during surveys of fungi associated with woody plants in Yunnan Province, Southwestern China. The fungi samples were initially identified as Amphisphaeria. Multi-gene phylogenetic analysis based on combined datasets of LSU, ITS, rpb2, and tub2 regions and morphological characteristics confirmed that the samples represent a previously unidentified fungus belonging to Amphisphaeria, which is named A. hongheensis sp. nov. This paper provides a full description, illustrations, and a phylogenetic tree showing the new species' taxonomic placement.

Morphometric and Molecular Characterization of Fasciola spp. in Livestock From Northwestern Provinces of Iran.

Liver flukes from the genus Fasciola are the causative agents for human and livestock fascioliasis. Accurate identification of Fasciola spp. is essential to understanding the epidemiology of fascioliasis. This study aimed to determine the morphometric and molecular characterization of Fasciola spp. in livestock from Northwestern provinces of Iran. Five hundred adult Fasciola flukes were obtained from different definitive hosts (cattle, sheep, goats, and buffaloes) in four local abattoirs in the northwestern provinces of Iran (West-Azerbaijan, East-Azerbaijan, Ardabil, and Zanjan) from September 2021 to August 2022. All samples were examined by morphometric criteria; then, 49 samples were identified using PCR-RFLP based on ITS1 region and 23 sequence of isolates analyzed by cox1 marker. PCR-RFLP methods compared morphometric results, and cox1 gene sequences were used to confirm PCR-RFLP results and phylogenetic analysis. The differences between the body length, body width, cephalic cone length, cephalic cone width, body area, and distance between the ventral sucker and posterior end of the body in two species were significant (p < 0.05). Based on the morphometric criteria, 139 samples (27.8%) were identified as Fasciola gigantica and 361 (72.2%) as Fasciola hepatica. Similarly, PCR-RFLP analysis of ITS1 region confirmed morphometric results. No hybrid forms of Fasciola were detected. Partial sequences of cox1 showed 13 variable sites with eight haplotypes in F. hepatica and 12 variable sites with five haplotypes in F. gigantica. Based on the results of this study, the PCR-RFLP method can be used to confirm the morphological method of Fasciola species, but it is insufficient to study their genetic diversity. Also, sequences of cox1 results of the present study showed that F. hepatica and F. gigantica species in the Northern provinces of Iran have different genetic structures and haplotypes.

Proteomic analysis of psychedelic mushroom isolate and exploring potential antimicrobial peptides against bacteria

Psychedelic mushrooms belonging to basidiomycota have gained prominence in research due to the range of hallucinogenic compounds. To combat the challenge of antimicrobial resistance, exploring alternative antimicrobial peptides has become crucial. In this study, we present the proteomic analysis of psychedelic mushroom. Psilocybe cubensis was identified by molecular characterisation using the ITS1 and ITS4 regions. Subsequently, LC-MS/MS and gene ontology analyses were used to characterise the proteome of P. cubensis. The proteomic analysis unveiled several antimicrobial peptides. The results revealed favourable binding scores, suggesting the potential efficacy of these peptides against Staphylococcus aureus. Hence the inhibition of bacterial growth, supporting the antimicrobial properties of the identified peptides. In our findings, the individual peptides from P. cubensis against S. aureus suggest a promising avenue for the discovery of novel antimicrobial peptides.

New Data on the Distribution and Systematic Position of Marsupella minutissima, a Poorly Known Species from Gymnomitriaceae (Marchantiophyta)

Marsupella minutissima was recorded for the first time outside of Japan in Jeju-do in the Republic of Korea. The new data significantly improve the knowledge of the species distribution. An analysis of the phylogenetic affinities of the species based on nuclear ITS and plastid trnL-trnF regions showed that it is resolved within the clade corresponding to Marsupella sect. Ustulatae, which is where the most morphologically similar M. funckii and M. sprucei are placed. These tree taxa are well delimited geographically. When found within the same region, such as a mountain chain, they occupy different altitudinal belts. Our results showed clear molecular delimitation; however, we failed to estimate the affinities of M. minutissima within the section based on the available molecular data. A description, line-art illustrations and photographs of the collected materials are provided; data on the oil bodies of the species were obtained for the first time.

Soil Properties and Rhizosphere Microbes Community Structure Reveal Nitrogen Uptake Preferences and Nitrogen Use Efficiency of Two Ecotypes of Paphiopedilum micranthum

Paphiopedilum micranthum, an IUCN Red List species, is discontinuously distributed in the karst limestone mountain of southwest China and exhibits ecological specialization, typically through lithophytic and terrestrial ecotypes. Whether the distribution of rhizosphere bacteria and fungi in these different habitats is random or reflects soil preferences requires further investigation. A total of 73 samples from the core distribution areas in China, representing all habitats in two sites, were analyzed for soil differences by comparing edaphic properties and microbial community structure based on high-throughput sequencing of bacterial 16S rRNA genes and fungal ITS region sequences, alongside soil physiochemical data. The results showed no significant differences in microbial community richness and diversity across the heterogeneous habitats. However, significant differences in taxa were observed across various habitats. Dominant bacterial phyla included Actinobacteriota, Proteobacteria and Acidobacteriota, with dominant genera such as Crossiella, Pseudonocardia, 67-14, Mycobacterium and RB41. The primary fungal phyla were Basidiomycota and Ascomycota, featuring prominent genera such as Phlegmacium, Archaeorhizomyces, Trechispora, and Lepiota. There were 16 bacterial genera and 13 fungal genera associated with nitrogen transformation and fixation. Alkali-hydrolyzed nitrogen (AN) was identified as a main driver of soil bacterial and fungal community variation. Based on an analysis of soil physicochemical properties, ammonium nitrogen content was consistently higher than nitrate nitrogen across different habitats. Furthermore, across all heterogeneous habitats, P. micranthum showed no significant differences in nitrate nitrogen, ammonium nitrogen, or their ratio. The nitrogen-use efficiency of P. micranthum ranged from 7.73% to 9.87%, with the highest efficiency observed in the terrestrial habitat of Shedu. These results suggest that P. micranthum prefers habitats rich in organic matter and nitrogen, showing a preference for ammonium nitrogen uptake in natural conditions. Heterogeneous habitats affect plant nitrogen-use efficiency as well as changes in microbial community composition.

First report of potato pink rot caused by Phytophthora erythroseptica in Colorado.

Pink rot, caused by the oomycete Phytophthora erythroseptica, is a serious disease that may cause substantial losses to potato growers. In 2023, high infection rates of pink rot were noticed in the San Luis Valley (SLV), Colorado around harvest time and in storage with several growers losing complete storage pins to pink rot. In September 2023, tubers with pink rot symptoms were collected from two grower fields of Russet Norkotah (~2-3% infection) and Canela Russet (~5% infection) near the San Luis Valley Research Center at harvest time. Infected tubers showed dark discoloration on the surface at the stem end. Upon cutting, affected tissue developed salmon pink color about 20-30 min later (Fig. 1). DNA was extracted from two symptomatic tubers from each cultivar and healthy tubers using DNeasy PowerSoil Pro Kit (Qiagen, MD, USA) according to the manufacturer's instructions. The conventional PCR and qPCR assays developed by Cullen et al. (2007) were used to detect P. erythroseptica. In the conventional PCR, the primer pair Pery2F1/R1 produced expected bands of 135bp from symptomatic tubers but not from the healthy tubers. The symptomatic tubers were positive in the qPCR using the primer-probe set 99F, 177R, and 133T (Cullen et al., 2007). P. erythroseptica was isolated by culturing specimens of infected tissues on PARP selective media (Jeffers and Martin, 1986). A week later colonies of white color grew on the media. These colonies were confirmed to be of P. erythroseptica by PCR as mentioned above. The colonies of two isolates were transferred to water agar media, then three days later a mycelium tip was excised and cultured on PDA media for single isolation. On PDA media the colonies showed chrysanthemum pattern. Four days later DNA was extracted from the two isolates, RN296-1 and Canela-2, and tested positive for P. erythroseptica by the above-mentioned PCR. PDA agar plugs of two isolates were used to inoculate surface sterilized potato tubers. The isolate SLV-2023-Canela2 was inoculated on tubers of Russet Norkotah and Reveille Russet, 10 each, while10 tubers of Russet Norkotah were inoculated with the isolate SLV-2023-RN296-1. Ten tubers of Russet Norkotah were inoculated by sterilized plugs of PDA for negative controls. Tubers were left at room temperature for a week. All tubers of Russet Norkotah inoculated with SLV-2023-Canela2 and RN296-4 developed pink rot symptoms and tested positive for P. erythroseptica by PCR, while only 9 tubers of Reveille Russet inoculated with SLV-2023-Canela2 developed symptoms and were positive to P. erythroseptica by PCR. No symptoms were observed on the mock inoculated tubers and no P. erythroseptica was detected by the PCR. P. erythroseptica was isolated again from Russet Norkotah tubers inoculated with RN296-1 on PDA media and tested positive for P. erythroseptica by PCR one week later. To further confirm the identity, the ITS region was amplified using the primers ITS-1 and ITS-4 (White et al., 1990) from DNA extracted from inoculated Russet Norkotah tubers with SLV-2023-Canela2 isolate. PCR product was purified using QIAquick Gel Extraction Kit (Qiagen, MD, USA)and cloned using TOPO TA Cloning Kit for Sequencing (Invitrogen, MD, USA). Four clones were submitted for sequencing. The 846 nt sequence of the ITS was submitted to the GenBank (accession number PP587391) shared 99.76% identity with the P. erythroseptica strain BBA 62683 (KJ755119). P. erythroseptica was identified previously using morphological tools from tubers with symptoms resembling pink rot collected in the SLV (Tyler et al., 2002). However, in that report neither Koch's Postulates, nor molecular identification were conducted, hence, the current study presents the first molecular report of pink rot in the SLV, Colorado. Rapidly changing climate and increased temperature around harvest time may lead to an increase in the incidence of pink rot, hence effective management strategies need to be developed and implemented.

Gut and intraocular fluid dysbiosis in people with type 2 diabetes-related retinopathy in India: A case for further research.

To explore the relationship between gut microbiome, gut mycobiome, and intraocular (aqueous humor) microbiome dysbiosis in people with type 2 diabetes (T2DM) and diabetic retinopathy (DR). Multiple case-control studies. We evaluated three groups of people: healthy controls (HC), people with T2DM without retinopathy, and those with DR. The study samples included fecal matter (30-50 g) and aqueous humor (0.05-0.1 mL). After amplicon sequencing, we analyzed microbiome profiles (V3-V4 region of bacterial 16S rRNA gene) and mycobiome (ITS2 region of fungal rRNA gene). The main outcome measures were relative abundance, α and β diversity, and dysbiotic bacteria and fungi, analyzed based on the inferred functions of the taxa. We recruited 82 people for gut microbiome (30 HC, 24 DM, and 28 DR); 75 people for gut mycobiome (30 HC, 21 DM, and 24 DR); and 12 people for aqueous humor microbiome (4 each HC, DM, and DR) studies. Generally, there was an increased abundance of pro-inflammatory and pathogenic microorganisms and a decreased abundance of anti-inflammatory and probiotic microorganisms. The differences were higher between HC and DM/DR than between DM and DR. In aqueous humor, there was a wider separation in microbiome profiles of people with DR than their gut microbiome. The gut and aqueous humor microbiota of people with diabetes and DR may differ from those without diabetes. Given these unique observations in individuals living in one region of India, further research involving people from different regions is required to identify indices for possible regional or global use.

Particle size and band gap evaluation of green gold nanoparticles (AuNPs) with potential applications

Abstract The present study was aimed towards green synthesis of gold nanoparticles (AuNPs) using fungal strain (SGSK-7) with assessment of their size using different techniques viz., X-ray diffractormeter, Dynamic light scattering, Atomic force microscopy, FE-Scanning Electron Microscopy and Fourier transform Infrared Spectroscopy. The intense characteristic diffraction peaks at angle 2Ѳ (38.13˚) presented the crystalline nature of the reduced gold solution and calculation of crystalline size (12 nm) using Scherer’s equation further confirmed synthesis of gold nanoparticles while dynamic light scattering analysis indicated the particle size range of gold nanoparticles between 2 nm to 50 nm. Field Emission Scanning Electron Microscopic (FESEM) and Atomic Force Microscopy (AFM) analysis of extracellular gold nanoparticles depicts spherical shape of AuNPs of approximately 40 nm. Fourier transform Infrared (FTIR) Spectroscopy depicted the presence of the gold nanoparticles along with the other biomolecules secreted by fungus which plays vital role in reduction, capping and stabilization of gold nanoparticles. Energy dispersive X-ray, mapping analysis, Zeta potential and UV-Vis spectrophotometery analysis further confirmed the presence and stability of gold nanoparticles, respectively. Zeta potential of gold nanoparticles leads to conclude the neutral nature (-10 mV to 10mV) of the particles. The UV-Visible spectrophotometeric analysis also confirmed the formation of gold nanoparticles with an absorption peak at 547 nm. On the basis of UV-Visible spectra the optical band gap of 2.44 eV is examined. The phylogenetic relatedness of SGSK-7 revealed 99% homology with Aspergillus tamari after sequencing of the ITS region followed by BLAST.

Genetic Diversity of the Species of the Genus Deschampsia P.Beauv. (Poaceae) Based on the Analysis of the ITS Region: Polymorphism Proves Distant Hybridization

The species of the genus Deschampsia are difficult for identification, and the genus is difficult for taxonomic treatment. The regions of 35S rRNA genes were studied for the species of the genus Deschampsia of different geographical origin with a method of sequencing by Sanger (ITS1–5.8S rRNA gene–ITS2, 14 species) and with a method of a locus-specific next-generation sequencing (NGS) on the Illumina platform (ITS1–5.8S rRNA, 7 species). All species of Deschampsia formed one clade; the species, referred by some authors on the basis of morphological characters to the species D. cespitosa s.l., entered one subclade. Subantarctic species formed a separate subclade and their ribotypes formed their own subnetwork. Avenella flexuosa, earlier referred to Deschampsia, entered the other clade, though this species contains some ribotypes common with some Deschampsia species. Deschampsia pamirica and related mountain species have their own specific ribotype groups. On the network of the ribotypes, one can see that D. cespitosa from Great Britain forms a network with some species, but D. cespitosa from the USA forms its own network. Ribotype analysis of each sample revealed traces of introgression with Deyeuxia/Calamagrostis in D. cespitosa and with A. flexuosa and probable introgression of Northern and subantarctic species.

The Fungal Side of the Story: Saprotrophic- vs. Symbiotrophic-Predicted Ecological Roles of Fungal Communities in Two Meromictic Hypersaline Lakes from Romania

Over three-quarters of Earth’s surface exhibits extreme environments where life thrives under harsh physicochemical conditions. While prokaryotes have often been investigated in these environments, only recent studies have revealed the remarkable adaptability of eukaryotes, in particular fungi. This study explored the mycobiota of two meromictic hypersaline lakes, Ursu and Fără Fund, in Transylvania (Romania). The intrinsic and extrinsic fungal diversity was assessed using amplicon sequencing of environmental DNA samples from sediments, water columns, surrounding soils, and an associated rivulet. The fungal communities, illustrated by the 18S rRNA gene and ITS2 region, exhibited contrasting patterns between the lakes. The ITS2 region assessed better than the 18S rRNA gene the fungal diversity. The ITS2 data showed that Ascomycota was the most abundant fungal group identified in both lakes, followed by Aphelidiomycota, Chytridiomycota, and Basidiomycota. Despite similar α-diversity levels, significant differences in fungal community structure were observed between the lakes, correlated with salinity, total organic carbon, total nitrogen, and ammonium. Taxonomic profiling revealed depth-specific variations, with Saccharomycetes prevalent in Ursu Lake’s deeper layers and Lecanoromycetes prevalent in the Fără Fund Lake. The functional annotation using FungalTraits revealed diverse ecological roles within the fungal communities. Lichenized fungi were dominant in Fără Fund Lake, while saprotrophs were abundant in Ursu Lake. Additionally, wood and soil saprotrophs, along with plant pathogens, were more prevalent in the surrounding soils, rivulet, and surface water layers. A global overview of the trophic relations in each studied niche was impossible to establish due to the unconnected graphs corresponding to the trophic interactions of the analyzed fungi. Plotting the unweighted connected subgraphs at the genus level suggests that salinity made the studied niches similar for the identified taxa. This study shed light on the understudied fungal diversity, distribution, and ecological functions in hypersaline environments.

New species diversity and host association of Lactarius sect. Deliciosi: describing L. gibbosus and L. parvihatsudake (Russulaceae, Russulales) in southern China

Lactarius gibbosus and L. parvihatsudake, two red-colored species of Lactarius sect. Deliciosi are described as new from southern China. Lactarius gibbosus is a rare species, growing in fagaceous forest in southwestern China, similar to L. subindigo. Its pileipellis with slightly thick-walled swollen cells is unique in the section. The macrocystidia filled with golden yellow contents are another good character. This is the first report of red-colored species of L. sect. Deliciosi growing in fagaceous forest. Lactarius parvihatsudake grows in forest of Pseudolarix amabilis, an ancient relict Chinese tree only in eastern China. It has smaller basidiocarps and bigger spores than L. hatsudake. The discovery of this species added Pseudolarix to the potential host list of L. sect. Deliciosi. Phylogenetic analyses of the ITS region and glyceraldehyde-3-phophate dehydrogenase gene showed that L. gibbosus was a sibling of L. subindigo. These two species formed an early diverging lineage of L. sect. Deliciosi. Lactarius parvihatsudake was nested deeply in L. sect. Deliciosi but its closest relatives cannot be determined. These data update our understanding of the diversity of L. sect. Deliciosi in Asia and will hopefully help to understand the role of host shift in speciation of ectomycorrhizal fungi.

Exploring the antifungal activity of clove oil (Syzygium aromaticum) against wilt disease caused by Fusarium equiseti in bitter gourd (Momordica charantia L.)

This study investigates the isolation and characterization of Fusarium equiseti, a fungal pathogen causing wilt in bitter gourd. It explores the antifungal activity of essential oils, particularly clove oil, as a natural management approach. The pathogen was isolated from wilt-infected bitter gourd stems and it was confirmed as F. equiseti morphologically by the presence of three-septate falcate macroconidia and globose microconidia and also confirmed molecularly by PCR amplification of the ITS region (PP501044.1). Among the tested essential oils, clove oil demonstrated the highest mycelial growth inhibition (100%) at a concentration of 0.5%, followed by peppermint, wintergreen and tea tree oils. In comparison, neem oil exhibited the least inhibition (15.54%). GC-MS analysis of clove oil revealed 38 compounds, where eugenol is the predominant compound that played a crucial role in antifungal activity. Additionally, metabolic analysis revealed several enriched pathways in F. equiseti during its interaction with clove oil, particularly those involved in lipid metabolism and energy production. Pot culture experiments confirmed the efficacy of clove oil in reducing disease severity and incidence in bitter gourd, achieving a 66.99 % reduction when combined with soil application.Furthermore, clove oil-treated plants showed increased activity of defense-related enzymes, including peroxidase (PO), polyphenol oxidase (PPO) and phenylalanine ammonia-lyase (PAL), suggesting the induction of systemic resistance. This study highlights the potential of clove oil as an eco-friendly alternative to synthetic fungicides for managing F. exquisite-induced wilt in bitter gourd. Future research should focus on optimizing clove oil application methods and understanding its interactions with fungal pathogens at the molecular level to enhance its efficacy in sustainable disease management.

Deciphering the Cape Gooseberry Fruits Mycobiome for Further Safety Improvement Postharvest.

Cape gooseberries are exquisitely flavored fruits; their rapid deterioration reduces their shelf life. Understanding the unique mycobiome of fruit peels is an essential step in identifying the taxa causing postharvest loss. The current study proposes to analyze the fungal communities of cape gooseberry peels collected from an organic orchard at unripe and ripe stages and purchased from open-air market sites, using the ITS2 region metabarcoding. According to the Kruskal-Wallis test, there were no statistically significant differences found in either the phylogenetic or non-phylogenetic alpha diversity indices. Significant differences in fungal communities were observed between the market and orchard groups based on beta diversity results. Ascomycota (85.72-96.76%), Basidiomycota (3.21-13.91%), and Chytridiomycota (0.07-9.35%) were the most common fungal phyla, their abundance varying with the ripening stage and origin. Dothideomycetes in the orchard group and Saccharomycetes in the market group were the two most prevalent classes. Furthermore, we investigate which taxa showed a significant difference in abundance between the two conditions (market vs. orchard) using the analysis of compositions of microbiomes with bias correction (ANCOM-BC) test. Regardless of the phase, the orchard samples exhibited a notable increase in the mean absolute abundance of various beneficial fungal taxa, including Tilletiopsis washingtonensis and Articulospora proliferata, whereas the market samples demonstrated a high abundance of harmful yeasts and molds such as Meyerozyma guilliermondii, Candida railenensis, and Botrytis caroliniana. Although it is unclear how these microorganisms augment at the market sites and might impact the fruit quality after harvest, from a fruit safety perspective, it is essential to comprehend the diversity and variation of the mycobiome composition at different ripening stages to further develop strategies to improve food safety postharvest.