Sequence Analysis Of ITS Region Research Articles

Diversity of unique, nonmycorrhizal endophytic fungi in cultivated Phalaenopsis orchids: A pilot study.

Orchids comprise one of the largest, most diverse, and most broadly distributed families of flowering plants and contribute significantly to habitat biodiversity. One key aspect of orchid growth and development is the formation of mycorrhizal symbioses with compatible endophytic fungi, which are maintained throughout the life of the plant. Substantial efforts to identify the fungi that form mycorrhizal symbioses across a range of orchid species have often also uncovered numerous nonmycorrhizal, endophytic fungi. These fungi could also have significant effects on orchid growth and development and are beginning to be analyzed more closely, particularly in wild species. The role of endophytic fungi in the production, distribution, and continued growth by the hobbyist of orchids is not known. As an initial step toward characterizing nonmycorrhizal endophytic fungi associated with cultivated orchids, we undertook a survey of fungi residing within roots of Phalaenopsis plants growing in home environments. Sequence analysis of ITS regions amplified from total DNA isolated from roots allowed rapid identification of endophytic fungi to the class level and may offer a useful initial screening method for beneficial species, for example, in horticultural settings. ITS-PCR sequences subsequently obtained from individual fungi cultured from surface-sterilized orchid roots corroborated the findings of the initial screen, while also providing a more complete characterization of the array of fungal taxa that were present. Although lower in diversity than has been reported for orchids growing in the wild, these endophytes have the potential to substantially enhance the growth and disease resistance of horticultural orchids.

First report of entomopathogenic fungi, Aspergillus tamarii (Eurotiales: Trichocomaceae) on Musca domestica (Diptera: Muscidae) larvae

A fungus isolated from mango wasp was found to be pathogenic to houseflies. The isolated fungus was identified as Aspergillus tamarii using morphological characteristics and by comparative nucleotide sequence analysis of ITS regions. Fragments covering the region encoding ITS-1, 5.8S rDNA, and ITS-2 were amplified using the universal primers, ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (TCCTCCGCTTATTGATATGC). The results of bioassays against early second instar larva showed dose-dependent mortality. Larvicidal activity was carried out at eight different concentrations viz, 1x106, 1x107, 1x108, 2x106, 2x107, 2x108, 3x106, 3x107, and 3x108 spores/ml. Among the two different methods of bioassays, bait method showed highest mortality. Beauveria bassiana was used as a positive control. Tween 80 (0.05%) was used as negative control. Larval mortality commences from day 3 until pupation in both bait and immersion methods. The least LC50 value observed for bait method was 5.28x107 spores/ml followed by immersion method, 5.12x109 spores/ml. On the other hand, the larva treated with commercial fungal strain, Beauveria bassiana showed an LC50 value of 1.26x108 spores/ml and 1.32x108 spores/ml for bait and immersion methods, respectively. Visual observation of mycosis was noticed on treated larva. Treated larvae had extensive growth of fungal hyphae on the larval surface. Scanning Electron Microscopy studies of treated larvae clearly showed the process of fungal infection. Longitudinal section of the treated larva showed fungal hyphae on the haemocoel.

First Report of Yeast-Spot Disease of Soybean Seeds Caused by Eremothecium coryli in Serbia.

Over the last 15 years, the area planted with soybeans (Glycine max) in Serbia has increased drastically, from 131,000 hectares in 2005 to 230,000 in 2019, and the average yield reached 3.2 t/ha in 2020. The Province of Vojvodina is the most important soybean production region with 95% of the total soybean area in Serbia (www.stat.gov.rs). During the 2021 growing season, soybean seeds with various kinds of symptoms including colour changes, light and dark brown spots, blotching, necrosis, and shriveling were collected from soybean field before harvest of soybean cv. Dukat in the Tamiš locality (South Banat District, Vojvodina Province: GPS: 44°56'12.936"N 20°43'24.216"E) in Serbia. The incidence of symptomatic seeds was estimated at 6.4%. Symptomatic soybean seeds were surface disinfected with 2% NaOCl for 2 min, rinsed in sterile water, dried on sterile filter paper, placed on potato dextrose agar (PDA) and were incubated at 25°C in the dark for 10 to 14 days. The identification of fungi at the genus level based on morphological characteristics revealed the presence of species of Macrophomina, Botrytis, Cercospora and Alternaria, which were previously reported as pathogens of soybean seed in Serbia (Krsmanović et al. 2020). Also, seven white to slightly creamy colonies with yeast-like morphology were observed around seeds expressing discoloration and necrotic and sunken spots. Ten days later, microscopic observations of yeast-like colonies revealed the presence of globose budding cells (diameter of 20 to 28 μm) mostly single or rarely in short chains. Also, two to eight needle-shaped ascospores (52 to 80 μm in length) were arranged lengthwise in many cylindrical to naviculate asci (60 to 96 x 8 to 12, avg. 72.4 x 9.2 µm). Ascospores were with a unilateral, slender, flexuous, whip-like appendage. The morphology of the different fungal structures indicated that the pathogen was Eremothecium coryli (Pelgion) Kurtzman and it was further supported by molecular identification. Total DNA was extracted directly from fungal mycelium with a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and PCR amplification performed with primers ITS1F (Gardes and Bruns 1993) and ITS4 (White et al. 1990). Sequence analysis of ITS region revealed that the Serbian isolate ND2/21 (GenBank Accession No. OL958602) shared the highest nucleotide identity of 100% with E. coryli isolate (Accession No. KY103387). For pathogenicity test, fresh soybean seeds (cv. Sava) were surface-disinfected with 2% NaOCl and rinsed in sterile water before inoculation. The seeds were pierced 3-4 times with a sterile insect pin through a drop of yeast suspension (concentration 106 ascospores/ml) of one selected single-spore isolate (ND2-21). Similarly, control seeds were pierced with sterile insect pins through a drop of sterile distilled water. Five inoculated seeds and control (five replicates per treatment) were arranged uniformly in a Petri dish (9 cm diameter) and incubated at 22 to 25°C in the dark and kept under >95% relative humidity during the first 48 h. Twenty days after inoculation, small brown necrotic lesions were visible on the soybean seeds. Re-isolation from symptomatic seeds on PDA dishes yielded yeast-like colonies with the same morphological characteristics as those used for inoculation, thus confirming Koch's postulates. The control seeds had no symptoms. This fungus is widely known as a pathogen of yeast spot disease on soybean seeds (Heinrichs et al. 1976; Kimura et al. 2008), but to our knowledge, it has never been reported in Serbia. Considering that invasive species Nezara viridula L. and Halyomorpha halys (STÅL, 1855), the vectors of this fungus, were reported in our country (Kereši et al. 2012; Šeat 2015) and that their mass appearance has been documented in recent years (Konjević et al. 2020), the presence of this pathogen has the potential to cause considerable damage and severe yield losses, resulting in significant economic impact on soybean production in Serbia.

First Report of Sclerotinia minor on lettuce in Serbia.

Lettuce (Lactuca sativa L.) is the world's most popular leafy salad vegetable. One of the major challenges facing lettuce producers are fungal diseases that could, under favorable conditions, devastate the harvest (Raid, 2004). During February 2021, poor growth, plant stunning and blanching of leaves of lettuce plants, cultivated in unheated plastic tunel in Potočanje (Zlatibor region), Serbia, were observed. The crowns were softened with spreading decaying lesions covered with white mycelium, particulary on the leaves near the soil surface. Approximately 2 to 3 weeks before harvest, diseased plants began to wilt and collapse. Estimated disease incidence was 50-55%. In order to identify the causal agent, symptomatic tissues from diseased plants were cut into small pieces, surface sterilized with 70% ethanol for 1 min, rinsed three times in sterile distilled water and placed on potato dextrose agar (PDA). Five isolates with uniform morphology were derived from infected tissue. The colonies had fast-growing, white, cottony aerial mycelium, producing profuse numbers (184 sclerotia/ Petri plate in average) of small, black, irregularly shaped sclerotia, less than 2 mm in diameter. Based on morfological features, the isolates were identified as Sclerotinia minor Jagger (Kohn, 1979). To confirm the species identity, the internal transcribed spacer region of nuclear rDNA of a representative isolate 15-2 was amplified using the primer pair ITS1/ITS4 (White et al. 1990). Sequence analysis of ITS region revealed 100% nucleotide identity between the isolate 15-2 (GenBank Accession No. OL423632.1) and 14 isolates of S. minor from different parts of the world (e.g., accession Nos. MK356551.1, KY707828.1, JF2798801.1). Pathogenicity tests were conducted by artificial inoculation of 55-day-old lettuce plants cv. 'Majska kraljica', grown on commercial growth substrate in l L pots. The obtained isolates were grown on PDA for 7 days and mycelial plugs, 5 mm in diameter, were cut from the margin of the colony and placed mycelium-side down on undamaged ground-level leaves of lettuce plants. Two plugs per isolate were placed onto five plants each for a total of ten replicates per isolate. Negative control plants (5) were inoculated similarly with sterile PDA plugs. Inoculated plants were covered with transparent plastic bags, sprayed with water (under the plastic) twice a day for 3 to 5 days to maintain high humidity, and kept in a growth chamber at 22°C (13 h light). After 7 to 10 days, all pathogen-inoculated plants developed lettuce drop disease symptoms, whereas the control plants remained symptomless. The pathogen was reisolated from symptomatic leaves and Koch's postulates were completed by confirming the identity of the isolates. To our knowledge, this is the first report of S. minor on lettuce in Serbia. More research is needed to better understand this disease, establish control strategies and minimize the spread of the pathogen to other lettuce-producing areas of the country.

Enhancing the Discovery of Bioactive Secondary Metabolites From Fungal Endophytes Using Chemical Elicitation and Variation of Fermentation Media.

Endophytic microorganisms are an important source of bioactive secondary metabolites. In this study, fungal endophytes obtained from A*STAR’s Natural Product Library (NPL) and previously isolated from different habitats of Singapore were investigated for their diversity, antimicrobial, and cytotoxic activities. A total of 222 fungal strains were identified on the basis of sequence analysis of ITS region of the rDNA gene. The identified fungal strains belong to 59 genera distributed in 20 orders. Majority of the identified strains (99%; 219 strains) belong to the phylum Ascomycota, while two strains belonged to the phylum Basidiomycota, and only one strain was from Mucoromycota phylum. The most dominant genus was Colletotrichum accounting for 27% of all the identified strains. Chemical elicitation using 5-azacytidine and suberoylanilide hydroxamic acid (SAHA) and variation of fermentation media resulted in the discovery of more bioactive strains. Bioassay-guided isolation and structure elucidation of active constituents from three prioritized fungal strains: Lophiotrema sp. F6932, Muyocopron laterale F5912, and Colletotrichum tropicicola F10154, led to the isolation of a known compound; palmarumycin C8 and five novel compounds; palmarumycin CP30, muyocopronol A-C and tropicicolide. Tropicicolide displayed the strongest antifungal activity against Aspergillus fumigatus with an IC50 value of 1.8 μg/ml but with a weaker activity against the Candida albicans presenting an IC50 of 7.1 μg/ml. Palmarumycin C8 revealed the best antiproliferative activity with IC50 values of 1.1 and 2.1 μg/ml against MIA PaCa-2 and PANC-1 cells, respectively.

Screening and biocontrol evaluation of indigenous native Trichoderma spp. against early blight disease and their field assessment to alleviate natural infection

BackgroundEarly blight disease of tomato caused by pathogenic fungi Alternaria solani is the most significant and common disease throughout the world as well as in Kingdom of Saudi Arabia. The aim of this study was to isolate and identify native Trichoderma species from the Jeddah region in Saudi Arabia; evaluate their antagonistic potential against A. solani; and study their influence early blight disease severity in greenhouse and in open field.ResultsThe present study focused to explore the biocontrolling potential of native Trichoderma spp. against A. solani strain to compare with a conventional fungicide. Out of 21, 3 Trichoderma isolates showed an antifungal activity and significantly inhibited the mycelial growth of pathogen that were identified as Trichoderma atroviride, T. harzianum and T. longibrachiatum by their ITS region sequence analysis. Strong in vitro mycelial growth suppression (70.66%) was also recorded at 400 ppm Mancozeb (90%WP®) fungicide. Further, these Trichoderma bioagents and fungicide were further evaluated in greenhouse (artificially inoculated) and in field on naturally infected tomato plants. In greenhouse, (13.74%) disease severity after T. harzianum treatment was recorded, followed by T. longibrachiatum (25.83%) and T. atroviride (21.67%). The disease severity after fungicide (50 mg/L; 10 ml per plant) application was (7.91%). Further, positive impact on the plant biomarkers was demonstrated by all selected Trichoderma isolates in greenhouse. Under natural infection in season I, the disease severity (%) after T. longibrachiatum, T. atroviride and T. harzianum treatments was 11.5, 13.26 and 16.81%, respectively, followed by control (32.12%), whereas 7.18% disease severity was recorded after fungicide application.ConclusionsThe results revealed that native Trichoderma of this region had potential to mitigate the early blight disease intensity in field.

<p><strong>Polyphasic taxonomy of Indian Trichoderma species</strong></p>

Trichoderma speies are known for their diverse applications as potent bio-control organisms. 34 isolates of Trichoderma were obtained from various geographical locations in India and were subjected to phenotypic evaluation. Species identification if based on only morphology, may lead to sometimes erroneous, uncertain or remains unclear due to overlapping characters. Therefore, molecular characterization was also performed based on ITS region sequence analysis for reliable identification using both morphological and molecular characters. The isolates were identified into 20 different species viz., T. aggressivum, T. asperellum, T. atroviride, T. brevicompactum, T. citrinoviride, T. crassum, T. erinaceum, T. ghanense, T. hamatum, T. harzianum, T. koningiopsis, T. longibrachiatum, T. longipile (Syn. Hypocrea longipilosa), T. minutisporum, T. pubscenes, T.reesei, T. saturnisporum, T. spirale, T. tomentosum and T. virens based on the integrated approach of both morphological and molecular characterisation. ß-tub gene sequence analysis was also performed to find out the phylogenetic relationship of these species. The ß-tub gene sequences differentiated all the 20 different species of Trichoderma better than the ITS region sequences. The morphological characters viz., colony, conidiophores, phialides, conidia and chlamydospores of all the twenty species of Trichoderma were described along with photomicrographs. The ITS and β-tub gene sequences of all the 20 species studied have been deposited in the Genbank.

Comparison of Autof ms1000 and Bruker Biotyper MALDI-TOF MS Platforms for Routine Identification of Clinical Microorganisms.

Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is widely used in clinical microbiology laboratories because it is cost-effective, reliable, and fast. This study is aimed at comparing the identification performance of the recently developed Autof ms1000 (Autobio, China) with that of the Bruker Biotyper (Bruker Daltonics, Germany). From January to June 2020, 205 preserved strains and 302 clinical isolates were used for comparison. Bacteria were tested with duplicates of the direct transfer method, and formic acid extraction was performed if the results were not at the species level. Fungi were tested with formic acid extraction followed by ethanol extraction methods. 16S rRNA or ITS region sequence analysis was performed on isolates that could not be identified by any of the instruments and on isolates that showed inconsistent results. The time to result of each instrument was also compared. Among preserved strains, species-level identification results were obtained in 202 (98.5%) strains by the Autof ms1000 and 200 (97.6%) strains by the Bruker Biotyper. Correct identification at the species/complex level was obtained for 200 (97.6%) strains by the Autof ms1000 and for 199 (97.1%) strains by the Bruker Biotyper. Among clinical isolates, species-level identification results were obtained in 301 (99.7%) strains and 300 (99.3%) strains by the Autof ms1000 and Bruker Biotyper, respectively. Correct identification at the species/complex level was achieved for 299 (99.0%) strains by the Autof ms1000 and for 300 (99.3%) strains by the Bruker Biotyper. The time to analyze 96 spots was approximately 14 min for the Autof ms1000 and approximately 27 min for the Bruker Biotyper. The two instruments showed comparable performance for the routine identification of clinical microorganisms. In addition, the Autof ms1000 has a short test time, making it convenient for use in clinical microbiology laboratories.

Evolutionary biology and interaction among the anastomosis groups of Rhizoctonia spp.

Rhizoctonia solani Kuhn and other Rhizoctonia spp. are the plant pathogenic fungi widespread in the world and in both cultivated and noncultivated soils. Rhizoctonia spp. are readily isolated from diseased plants and soils, which differ in their pathogenicity, cultural, morphological and physiological characteristics. Identification of species and intraspecific groups (ISGs) is sometimes very difficult, due to the absence of the authentic cultures, which hinders mycological and pathological studies. The genus Rhizoctonia can be identified using various techniques such as, sequence analysis of ITS regions, DNA fingerprinting and the rDNA coding sequence. The introduction of the concept of anastomosis groups (AGs) or intraspecific groups has also aided species and subspecies identification. There are 13 different anastomosis groups exists in Rhizoctonia solani of which AG 1-4 were strong pathogenic on many plants and AG 6-10 were orchid mycorrhizae. Analysis of restriction fragment length polymorphisms (RFLPs) and the sequences within ribosomal RNA genes (rDNA) among different anastomosis groups of R. solani isolates exhibited DNA base sequence homology and diverging evolutionary affinities for hyphal anastomosis. More recently, ribosomal DNA (rDNA) sequences have been used to study the genetic relationships between AG of R. solani. The ecology and epidemiology of each ISG of R. solani must be investigated in order to gain a better understanding of this important group of fungi.

Isolation and identification of Aspergilli causing Banana fruit rot

Banana is a commercially and nutritionally important food crop worldwide and is affected by several fungal diseases. The most important post-harvest disease is fruit rotting. Fruit rot is responsible for significant losses in banana. The present study was therefore, designed to isolate and explore the mycoflora associated with banana fruit rot. For this, infected samples were grown on different media to obtain pure cultures of isolated fungal pathogens. Identifications were made initially on morphological basis and then confirmed by genetic analysis. A comprehensive study of micro and macroscopic features revealed four Aspergillus species with two of <i> Aspergillus fumigatus</i>, one of <i> Aspergillus flavus</i> and one of <i> Aspergillus niger</i>. Genetic analysis by Nucleotide sequence analysis of ITS region of rDNA was performed. The sequence alignment of two different isolates of <i> Aspergillus fumigatus</i> showed \(99\%\) homology to different strains deposited in Genbank i.e., \(004(\text{KU}321562.1)\), \(\text{SK}1(\text{KM}207771.1)\), and \(98\%\) homology to \(\text{AHBR}16(\text{KF}305755.1), \ \ \text{SF}8(\text{KX}011021.1).\)

Isolation and molecular identification of industrially important enzyme producer yeasts from tree barks and fruits.

This study aimed to identify the yeast strains associated with the tree bark samples collected from the Aegean and Marmara regions and from rotten fruit samples. Fifty-one yeast strains were successfully isolated and screened for their abilities to produce industrially important extracellular enzymes. Thirty isolates demonstrated ability to produce at least two different enzymes and were selected for subsequent molecular identification using sequence analysis of ITS region and D1/D2 domain of the 26S rDNA. The most prevalent strains belonged to Papiliotrema laurentii (%23), Papiliotrema terrestris (%13) and Candida membranifaciens (%10). Papiliotrema laurentii and Papiliotrema terrestris recorded the highest enzymatic activities for all the screened enzymes. To the best of our knowledge, this is the first report that identifies the yeast strains associated with the tree barks of Turkey and among the limited comprehensive studies that screened considerable number of isolates for their ability to produce several industrially important enzymes.

Mathematical modeling for bioprocess optimization of a protein drug, uricase, production by Aspergillus welwitschiae strain 1\u20134

Microbial uricase is effective protein drug used to treat hyperuricemia and its complications, including chronic gout, also in prophylaxis and treatment of tumor lysis and organ transplants hyperuricemia. Uricase is commonly used as diagnostic reagent in clinical analysis for quantification of uric acid in blood and other biological fluids. Also, it can be used as an additive in formulations of hair coloring agents. A newly isolated strain, Aspergillus sp. 1–4, was able to produce extracellular uricase on a medium containing uric acid as inducer. Phylogenetic analysis based on ITS region sequence analysis and phenotypic characteristics showed that Aspergillus sp. strain 1–4 is closely related to Aspergillus welwitschiae and its nucleotide sequence was deposited in the GenBank database and assigned sequence accession number MG323529. Statistical screening using Plackett-Burman design with 20 runs was applied to screen fifteen factors for their significance on uricase production by Aspergillus welwitschiae. Results of statistical analysis indicated that incubation time has the most significant positive effect on uricase production followed by yeast extract and inoculum size with the highest effect values of 13.48, 5.26 and 4.75; respectively. The interaction effects and optimal levels of these factors were evaluated using central composite design. The maximum uricase production was achieved at incubation time (5 days), yeast extract (2 g/L) and inoculum size (4 mL/50 mL medium) are the optimum levels for maximum uricase production (60.03 U/mL). After optimization, uricase production increased by 3.02-folds as compared with that obtained from the unoptimized medium (19.87 U/mL).

Molecular authentication and differentiation of Dendrobium species by rDNA ITS region sequence analysis

Owing to their significant medicinal and edible values, the natural Dendrobium species have underdone over-collection and habitat destruction, and cultivated species emerged for candidates. However, these Dendrobium plants are similar in shape to be easily confused, leading to extreme difficulties for identification based on their morphological and chemical features. In this study, the rDNA ITS region sequence analysis was developed for rapid and accurate identification of thirteen wild and cultivated Dendrobium species belonging to two sections Formosae and Chrysotoxae. By cloning and sequencing the rDNA ITS region genes from 13 Dendrobium species, the phylogenetic relationships among them were analyzed. Results showed that the variation of the ITS region, together with the lengths and Guanine and Cytosine contents of ITS, 5.8s rDNA, ITS1 and ITS2 sequences occurred in the tested Dendrobium species, and which from section Chrysotoxae was higher than that from section Formsae. Phylogenetic analysis based on neighbor-joining and maximum p-arsimony trees indicated that the Dendrobium species of sections Formosae and Chrysotoxae could be well divided into two groups. A majority of Dendrobium species exhibited distinctive ITS2 secondary structures, while for those with close genetic relationships were similar. Therefore, the ITS2 region sequence analysis is simple, quick, and highly reliable that can be used as an effective tool for molecular identification and classification, as well as the reconstruction of the phylogeny of wild and cultivated Dendrobium species belonging to different sections.

Molecular characterization of new isolates of the entomopathogenic fungus Beauveria bassiana and their efficacy against the tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae)

Thirteen fungal isolates, having characteristics similar to Beauveria bassiana, were isolated from field soils of Punjab, India, on Beauveria-specific selective medium (BS medium). Molecular screening of the B. bassiana isolates, using PCR amplification with B. bassiana-specific primer and nucleotide sequence analysis of ITS region, confirmed only three isolates as B. bassiana (now named as BbR1, BbR2, and BbR3) along with MTCC 2028 reference isolate. Comparative RAPD-PCR amplification with ten different RAPD primers showed that all the three isolates were closely related. Genetic relatedness dendrogram developed, using RAPD-PCR data by UPGMA, measured the quantitative description of genetic diversity and showed that the standard isolate MTCC2028 was 58% similar to new isolates. B. bassiana isolates achieved their maximum growth during the optimum incubation period of 7 days. Significant mortality rates of the tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae), were recorded at all the tested concentrations of conidial suspensions (103 to 107 conidia ml−1) of B. bassiana. BbR2 was found to be the most potential local isolate, causing the maximum mortality (83.33%) of S. litura, with LC50 value of 935.663 conidia ml−1, followed by BbR3 (74.33%), BbR1 (72.22%), and BbM1 (67.12%) isolates.

Genetic characterization and virulence of Fusarium spp. isolated from chickpea

Fusarium wilt causing yield losses in chickpea is one of the most important diseases, and occurs due to some fungi especially F. oxysporum and F. solani. Molecular studies are important in revealing the genetic characterization and virulence of the pathogen. In this study ten Fusarium genotypes isolated from chickpea plants showing symptoms of wilting were used. The ITS region was amplified by using the thermal cycler and genetic similarities and differences among species were revealed by performing sequence analysis of ITS region. Samples except for two of Fusarium genotypes; N1, N2, N3, N4, N5, N7, N9 and N10 genotypes showed a close relative to F. oxysporum. However, the N8 genotyped was found to be similar to F. solani, and interestingly the N6 genotype showed an equal relationship with F. solani and F. oxysporum so, it could not be fully identified. According to the phylogenetic tree, F. oxysporum, N2, N4 and N10 were determined in a separate group and F. oxysporum N5, N7 and N9 formed separate another group which showed a close relationship to each other. The severity of disease caused by isolates on ILC-482 chickpea variety varied between 1.25 and 3.50. The close relationship was found between F. oxysporum, N2, N4, N5, N7, N9 and N10 isolates was confirmed the result of the pathogenicity test of same isolates. The results revealed that N7 isolate prevented the emergence of plants by causing disease on chickpea seeds and it also indicated the high virulence.

Rhizoctonia fragariae causes black root rot on strawberry seedlings in Turkey

Samples of strawberry transplants were randomly collected from 47 growers in Aydin province of Turkey. A total of 10 Rhizoctonia isolates were identified by morphological characterization, analysis of rDNA-ITS sequences. Pathogenicity tests were carried on strawberry seedlings and detached stolon. Ten pathogenic binucleate Rhizoctonia isolates were defined as AG-A, AG-G and AG-K on the basis of ITS region sequence analysis. To our knowledge, this is the first report of the presence of Rhizoctonia fragariae in strawberry transplants in Turkey.

Identification of Endoglucanase Gene Responsible for Cellulose Degradation Using Aspergillus flavus

Twentytwo of cellulose-degrading fungal isolates were isolated from five differentsamples; rotted sugar cane bagasse, rotted plant, termites, soil and animalmanure. Out of 22 isolates, 21 strains showed hydrolyzing zone on agar platescontaining carboxy methyl cellulose after iodine staining. The fungal isolateNo. S4, exhibited the highest endoglucanase (CMCase) activity with (0.165IU/ml) in cellulase production culture. The bestexoglucanase (FPase) and endoglucanase (CMCase) of fungal isolate S4 wasobtained after incubation at 30°C for 7 days. Sugar cane bagasse (SCB) inducedthe production of FPase and CMCase with maximum activity of 3.6 fold and 2.2fold, respectively more than that of the maximum yield in case ofcarboxy methyl cellulose (CMC). The fungal isolate S4 was identified as Aspergillusflavus on the basis of 18S rRNA and ITS region sequence analysis.

COMBRETUM INDICUM – A NEW HOST RECORD OF ALTERNARIA BRASSICAE LEAF SPOT DISEASE FROM PAKISTAN

Combretum indicum leaf spot disease was observed during a survey of horticultural plants in Lahore. Isolation of causal organism was carried out from the disease leaves. The pathogen, Alternaria brassicae, was first identified considering morphological characters. The morphology based identification was confirmed by nucleotide sequence analysis of ITS region of rDNA and phylogentic analysis of this fungus with closely related other fungal species. Pathogenicity of A. brassicae was verified following the Koch’s pathogenicity postulates. This report represents the first record of leaf spot of Combretum indicum by Alternaria brassicae from Pakistan.

Incidence and biodiversity of yeasts, dermatophytes and non-dermatophytes in superficial skin infections in Assiut, Egypt

The aim was to identify the incidence of the causal agents from dermatophytes, non-dermatophytes and yeasts in Assiut Governorate employing, beside the morphological and physiological techniques, the genotypic ones. Samples from infected nails, skin and hair were taken from 125 patients. Patients who presented with onychomycosis, tinea capitis, tinea corporis, tinea cruris and tinea pedis during the period from February 2012 to October 2015 were clinically examined and diagnosed by dermatologists and were guided to Assiut University Mycological Centre for direct microscopic examination, culturing and identification. Onychomycosis was the most common infecting (64.8% of the cases) followed by tinea capitis (17.6%). Direct microscopic preparations showed only 45 positive cases, while 96 cases showed positive cultures. Infections were more frequent in females than males. Fifty-one fungal species and 1 variety were obtained. Yeasts were the main agents being cultured from 46.02% of total cases. Non-dermatophytes were the second etiologic agents. Aspergillus was responsible for infecting 19.47% of total cases and dermatophytes appeared in only 15.93% of the cases. Yeasts were the main causal agents followed by non-dermatophytic fungi (mainly species of Aspergillus, then Alternaria, Scopulariopsis and Fusarium). Both direct microscopic preparations and culturing are recommended for mycological evaluation of clinical specimens. Sequence analysis of ITS region is recommended for yeast identification.

Morphological and Molecular Characterization of Phoma complanata,a New Causal Agent of Archangelica officinalis Hoffm. in Poland.

The paper concerns the fungus Phoma complanata, isolated for the first time in Poland, from the roots and umbels of angelica (Archangelica officinalis) in 2009. The morphology of fungal isolates was tested on standard culture media. Moreover, the sequence analysis of ITS regions was conducted. Morphological similarity of P. complanata Polish isolates to the reference isolate obtained from CBS culture collection was determined and together with the molecular analysis confirmed the affiliation of the fungus to the species.