Iris Yellow Spot Virus Isolates Research Articles

English

Iris yellow spot virus (IYSV) is an important pathogen of Allium species worldwide. It has a tripartite genome consisting of the large (L), medium (M) and small (S) RNA segments. Despite its worldwide distribution, very few complete gene and genome sequences are available in public databases. The aim of this study was to obtain full gene sequences of a garlic-infecting IYSV isolate by next-generation sequencing (NGS) for understanding its evolution. Total RNA was extracted from an IYSV-positive garlic leaf and sequenced on the Illumina HiSeq platform using paired-end chemistry 125 × 125 bp reads. The quality of raw reads was assessed using FastQC software before trimming with Trimmomatic version 0.36. The resultant paired-end sequences were used for both de novo and reference-based genome assembly. The resultant consensus gene sequences were analyzed using SIAS (for sequence identity and composition), ExPASy (for protein molecular weight) and ORF Finder (for open reading frame identification). Three full gene sequences, that is, nucleocapsid (N), nonstructural protein (NSs) and movement protein (NSm) were recovered. The N gene did not display any distinct clustering patterns based on geographical locations and was most identical to an onion-infecting isolate from Serbia (Accession KT272878). The NSs and NSm genes clustered closely with homologous sequences of IYSV isolates that were retrieved from GenBank and EMBL. This study lays the foundation for complete genome studies of IYSV in Zimbabwe.   Key words: Allium species, emerging pathogen, reverse transcription polymerase chain reaction (RT-PCR), serology, tospovirus.

Variabilidad y síntomas causados por Iris yellow spot virus en Nicotiana benthamiana

<p>En cultivos de cebolla <em>Allium cepa</em> del estado de Morelos, México, se observan síntomas típicos y severos asociados a <em>Iris yellow spot virus </em>(IYSV). En esta investigación se estudiaron las alteraciones que ocasionan los aislamientos de IYSV procedentes de síntomas típicos y severos en <em>Nicotiana benthamiana</em>, las diferencias en el gen N y su filogenia. Cuatro aislamientos típicos y cinco severos inoculados mecánicamente causaron infección sistémica. En cámara bioclimática los aislamientos severos ocasionaron mayor severidad de síntomas. La secuencia del gen N de ambos aislamientos tuvo 98-99% de identidad con la nucleoproteína de IYSV y no se observaron cambios en la secuencia de nucleótidos entre ellos. Ambos aislamientos se agruparon con el genotipo IYSV<sub>BR</sub> y tuvieron mayor similitud con los reportados en Canadá y Estados Unidos.</p>

Iris yellow spot virus in Zimbabwe: Incidence, severity and characterization of Allium-infecting isolates

Iris yellow spot virus (IYSV), an emerging pathogen of alliaceous crops, has been reported in many countries worldwide. The pathogen has recently been reported infecting garlic (Allium sativum), leek (A. ampeloprasum) and onion (A. cepa) in Zimbabwe. A study was carried to determine its incidence, severity and distribution in Zimbabwe. IYSV disease surveys were conducted in 18 districts across six provinces. Symptomatic alliaceous leaf samples were tested for IYSV by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Furthermore, the pathogen was characterized by transmission studies, transmission electron microscopy and molecular assays. The pathogen was detected in garlic, leek, shallot (A. aggregatum) and onion crops in all districts, with disease incidences ranging from 26.7 to 78.8% and disease severities of up to 3.7 in some districts. Up to 70% of onion seedlings that were mechanically inoculated with sap from diseased onion plants produced typical IYSV symptoms characterized by green chlorotic tissues surrounded by tan-colored necrotic tissues. Electron microscopy studies revealed spherical enveloped particles that were 80–120 nm in diameter. Analysis of the partial nucleocapsid protein (N) gene of the Zimbabwean IYSV isolates revealed that they were at least 94.89% identical and similar to each other at nucleotide and amino acid levels. These isolates were closely related to isolates from Asia, Australia, Europe, South Africa and the USA, but were distinct from isolates from Brazil, The Netherlands and The UK. Further work to ascertain the pathogen's economic impact needs to be carried out. In addition, farmers need to be educated about the disease so that they can control it by growing resistant varieties and/or controlling the vector.

Iris yellow spot virus on onion crops in Calabria, Southern Italy.

The red onion (Allium cepa) cv. Cipolla rossa di Tropea, is a crop of utmost relevance in Calabria (southern Italy) as it consti- tutes the fourth most important agricultural product of Italy en- dowed with a certified protected geographical indication. In May 2012, symptoms resembling those of Iris yellow spot virus (IYSV), consisting of diamond-shaped lesions on the scapes ac- companied by chlorotic or necrotic spots on the leaves, were ob- served in several commercial plots. Symptomatic plants were col- lected from bulb and seed crops and tested for the presence of IYSV, a virus recorded from northern Italy since 2008 (Tomassoli et al., 2009). Total RNA was extracted from scapes and leaves and tested by single-step RT-PCR using primers specific to the vi- ral nucleocapsid (N) gene (Tomassoli et al., 2009). Five of 14 test- ed samples were IYSV-positive, two from fresh market bulb and three from seed crops. Amplicons (ca. 600 bp) were purified, se- quenced and three of the sequences were deposited in GenBank (accession Nos. JX310661, JX310662, JX310663). IYSV isolates from Calabria showed 98.5 to 100% identity at the amino acid level with the N gene sequences of the isolates previously identi- fied in Italy (FJ185142), Serbia and Brazil (EU750697 and AF067070). Real time RT-PCR assays disclosed a higher number (10) of infected samples, confirming the highly sensitive and rap- id detection of IYSV in onion afforded by this technique (Tiberi- ni et al., 2011). To our knowledge, this is the first report of IYSV in Calabria. It confirms spreading of the virus within Italy and calls for surveillance for reducing the impact of IYSV infections on onion crops and other allium species.

Identification and incidence of Iris yellow spot virus in Allium field crops in Southwest Germany

After the first detection of Iris yellow spot virus (IYSV) in Germany in 2007 a 3-year monitoring program was started to determine the occurrence and geographical distribution of IYSV in Allium field crops in southwest Germany (Rhine valley area) and to characterise the German IYSV isolates on the basis of the nucleotide sequence of the nucleocapsid gene. Surveys revealed that IYSV was present in 27 out of 175 onion fields. In most cases disease incidence was low, but in a few fields infection rates of up to 18 % and 50 % were observed for bulb and bunching onions, respectively. In leek, IYSV was found for the first time in 2010. For about 25 % of the tested samples, IYSV-like symptoms were not confirmed by laboratory tests, such as ELISA and/or RT-PCR. This clearly demonstrates the need for reliable diagnostic tools to identify IYSV. New RT-PCR primers were designed as commonly used primers did not yield a PCR product from many clearly ELISA-positive samples. Phylogenetic analyses of 46 isolates revealed a limited degree of diversity among IYSV isolates from southwest Germany. Nearly all German IYSV isolates were closely related to each other, with only four isolates being genetically distinct from the others. IYSV is considered a serious emerging disease in German Allium field crops, especially in bunching onions.

MS121 LIPID LEVEL OF PLASMA IN RATS AND THEIR BEHAVIOR AFTER SHOCK

Iris yellow spot virus (IYSV), an emerging pathogen of alliaceous crops, has been reported in many countries worldwide. The pathogen has recently been reported infecting garlic (Allium sativum), leek (A. ampeloprasum) and onion (A. cepa) in Zimbabwe. A study was carried to determine its incidence, severity and distribution in Zimbabwe. IYSV disease surveys were conducted in 18 districts across six provinces. Symptomatic alliaceous leaf samples were tested for IYSV by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Furthermore, the pathogen was characterized by transmission studies, transmission electron microscopy and molecular assays. The pathogen was detected in garlic, leek, shallot (A. aggregatum) and onion crops in all districts, with disease incidences ranging from 26.7 to 78.8% and disease severities of up to 3.7 in some districts. Up to 70% of onion seedlings that were mechanically inoculated with sap from diseased onion plants produced typical IYSV symptoms characterized by green chlorotic tissues surrounded by tan-colored necrotic tissues. Electron microscopy studies revealed spherical enveloped particles that were 80–120 nm in diameter. Analysis of the partial nucleocapsid protein (N) gene of the Zimbabwean IYSV isolates revealed that they were at least 94.89% identical and similar to each other at nucleotide and amino acid levels. These isolates were closely related to isolates from Asia, Australia, Europe, South Africa and the USA, but were distinct from isolates from Brazil, The Netherlands and The UK. Further work to ascertain the pathogen's economic impact needs to be carried out. In addition, farmers need to be educated about the disease so that they can control it by growing resistant varieties and/or controlling the vector.

Characterization of Iris yellow spot virus isolates from onion crops in northern Italy.

SUMMARY During spring and summer of 2007 and 2008, a number of onion fields in Emilia Romagna region (northern Italy) showed various virus-like symptoms. DAS-ELISA carried out in 2007 and early 2008 for Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV) and Tomato spotted wilt virus (TSWV) showed the occasional presence of TSWV, whereas a number of samples also reacted weakly with IYSV antiserum. In a number of TSWV-negative samples, electron microscopy of leaf extracts revealed the presence of tospovirus-like particles. Western blot analysis on the same set of samples gave positive results with antisera against Tomato fruit yellow ring virus (TFYRV) and IYSV, two serologically related virus species. Sequence analysis of RT-PCR fragments confirmed that the virus in the onion samples was IYSV with approximately 98% identity at the amino acid level with reported Serbian and Spanish sequences of the same virus. Phylogenetic analysis confirmed that the Italian IYSV isolates belong to a newly defined southern European clade. Our data suggest that IYSV is made up of a heterogeneous and serologically distinct group of isolates.

Incidence and Distribution of Iris yellow spot virus on Onion in Serbia.

In a survey to determine the presence and distribution of Iris yellow spot virus (IYSV) in greenhouse ornamentals and onion field crops in 14 districts of Serbia as well as on imported ornamental plants, 1,574 samples were collected and analyzed by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). IYSV was not detected in nearly 1,200 plant samples collected from 39 genera of ornamentals grown in greenhouses in Serbia or imported from other countries during 2005 to 2007. The virus was detected in samples from an onion seed crop in the Sirig locality (South Bačka District) that showed symptoms resembling those caused by IYSV and in samples without IYSV-like symptoms from an onion bulb crop in the Obrenovac locality (City of Belgrade District). Mechanical transmission of IYSV isolates was difficult, and only the isolate 605-SRB could infect four plant species, but not in all replications. No virus transmission could be demonstrated in 5,000 tested seeds originating from IYSV-infected onion crops. For further confirmation of IYSV, the nucleotide sequence of its nucleocapsid (NC) gene was obtained by reverse transcription-polymerase chain reaction (RT-PCR) in symptomatic onion samples as well as in symptomless leaves of Nicotiana benthamiana. Four previously developed primers were tested to determine their suitability for routine detection of Serbian IYSV isolates. Phylogenetic analysis showed clustering of isolates 605-SRB and 622-SRB from the onion seed crop and isolate 283-SRB from the onion bulb crop into two distant clades. The analysis indicated that Serbian isolates of IYSV do not share a recent common ancestor and that they represent two distinct lineages of IYSV in Serbia. Considering that onion is one of the most important and traditionally grown vegetable crops in Serbia, IYSV represents a potentially devastating pathogen in this country.

Iris yellow spot virus(IYSV) infecting lisianthus (Eustoma grandiflorum) in the UK: first finding and detection by real-time PCR

In June 2007, a sample of leaves was received from a year-round crop of lisianthus (Eustoma grandiflorum) growing under glass in Suffolk, UK. The sample exhibited necrosis, mainly observed as pale, necrotic lesions. In the worst affected block up to 20% of plants were reported as showing similar symptoms. A test performed by another laboratory had previously detected Iris yellow spot virus (IYSV) in the affected plants. To confirm this diagnosis officially, an ELISA test was performed using an IYSV polyclonal DAS-ELISA kit (Loewe). This test was positive. The result was confirmed using a new real-time PCR (TaqMan®) assay (forward primer (DQ658242-524F): TCCAGAATGTGAAAAAAGAAGCACT; reverse primer (DQ658242-524R): TGCCATGACTCTTGCAACTTTG; MGB Probe (DQ658242-552T): TATAAGCAGATTCTCAA CTTA). This new assay was designed using an available IYSV nucleocapsid (NC) protein gene sequence (GenBank Accession No. DQ658242) and further alignments against 45 other IYSV sequences available on public databases. It was validated with 4 known IYSV isolates; one purchased from Loewe and three kindly supplied by Ko Verhoeven, PPS, The Netherlands. Total RNA extraction (CTAB method) and real-time PCR assay conditions were essentially as described previously (Mumford et al., 2004). For further confirmation, conventional RT-PCR was performed using IYSV-specific primers (Pappu et al., 2006), on extracts made from leaf material with symptoms. A product of the correct predicted size (822 bp) was obtained and sequenced. The deduced NC gene sequence obtained (Accession No. AM900393) was analysed and shown to share at least 84% nt identity with all other IYSV NC sequences; the highest homology (98%) being with a Dutch isolate from Iris hollandica (Accession No. AF001387). Widely distributed around the world in onion and leek crops (Jones, 2005; EPPO, http://www.eppo.org/QUARANTINE/Alert_List/viruses/IYSV00.htm), IYSV has been identified in various ornamental crops, including lisianthus (Kritzman et al., 2000). However, this is the first finding of IYSV in the UK. The infected crop has now been removed and measures taken to eradicate the infection.

Phylogenetic Analysis of Iris yellow spot virus Isolates from Onion (Allium cepa) in Georgia (USA) and Peru

Abstract Iris yellow spot virus (IYSV) was first observed in sweet onions in Georgia (USA) in 2003 in the Vidalia region. The virus had been reported in the onion‐growing regions in western USA several years before being detected in Georgia in the east. Although symptoms were observed on onions in Peru several years earlier, the presence of IYSV was not confirmed in Peru until after the virus was detected in Georgia. We characterized nine isolates of IYSV recovered from sweet onions in both Georgia (four isolates) and Peru (five isolates) by sequencing the nucleocapsid (N) gene and compared those sequences with sequences available in GenBank. Sequence divergence between IYSV isolates from Georgia and Peru was low with 1.1%, and comparisons with IYSV isolates from other regions showed divergence of up to 11.4%. Bootstrap analysis indicated with a high degree of confidence that the Georgia and Peruvian isolates fell into the same clade and were different from known isolates from western USA that fell into sister clades. The high degree of similarity between Georgia and Peruvian isolates suggests that gene flow occurred from Peru into Georgia.

Sequence diversity of the nucleoprotein gene of iris yellow spot virus (genus Tospovirus, family Bunyaviridae) isolates from the western region of the United States

Iris yellow spot virus (IYSV), a tentative virus species in the genus Tospovirus and family Bunyaviridae, is considered a rapidly emerging threat to onion production in the western United States (US). The present study was undertaken to determine the sequence diversity of IYSV isolates from infected onion plants grown in California, Colorado, Idaho, Oregon, Utah and Washington. Using primers derived from the small RNA of IYSV, the complete sequence of the nucleoprotein (NP) gene of each isolate was determined and the sequences compared. In addition, a shallot isolate of IYSV from Washington was included in the study. The US isolates of IYSV shared a high degree of sequence identity (95 to 99%) with one another and to previously reported isolates. Phylogenetic analyses showed that with the exception of one isolate from central Oregon and one isolate from California, all the onion and shallot isolates from the western US clustered together. This cluster also included onion and lisianthus isolates from Japan. A second distinct cluster consisted of isolates from Australia (onion), Brazil (onion), Israel (lisianthus), Japan (alstroemeria), The Netherlands (iris) and Slovenia (leek). The IYSV isolates evaluated in this study appear to represent two distinct groups, one of which largely represents isolates from the western US. Understanding of the population structure of IYSV would potentially provide insights into the molecular epidemiology of this virus.

タマネギ（Ａｌｌｉｕｍ ｃｅｐａ）から分離されたＩｒｉｓ ｙｅｌｌｏｗ ｓｐｏｔ ｖｉｒｕｓ （ＩＹＳＶ）の遺伝的特性およびＩＹＳＶ２系統のタマネギおよびネギ（Ａｌｌｉｕｍ ｓｃｈｏｅｎｏｐｒａｓｕｍ）に対する病原性

Iris yellow spot virus (IYSV) was isolated from onion with streaks on leaves in Saga and Chiba prefectures, Japan. Phylogenetic analysis based on the amino acid sequence identities of the nucleocapsid genes showed the presence of two strains, as represented by an isolate from onion in Brazil (IYSVBR) and that from Dutch iris (Iris hollandica) in the Netherlands (IYSVNL), on onion in Japan. Pathogenicity was tested on 11 cultivars of onion and five of leaf onion by mechanical inoculation with either of the two IYSV isolates, which were genetically similar with IYSVBR and IYSVNL, respectively. Both isolates caused the same type of streaks only on inoculated leaves of all onion cultivars tested, and the virus was not detected in upper leaves. None of the leaf onions developed symptoms on either inoculated or upper leaves, even though IYSV was detected in the inoculated leaves. Onion thrips (Thrips tabaci) transmission to onion, leaf onion, wakegi (Allium wakegi) and shallot (Allium grayi) was examined, and IYSV was detected from onion leaves where thrips fed.

アイリスイエロースポットウイルス（ＩＹＳＶ）によるアルストロメリア条えそ病（新称）とウイルスの分布解析

Alstroemeria plants (Alstroemeria sp. and A. ligtu) with necrotic spots and streaks on leaves were found in Chiba prefecture, Japan. Tospovirus-like enveloped, spherical particles 80-100nm in diameter and filamentous particles 750-850nm in length were observed together in the infected leaves. The enveloped particles were identified as Iris yellow spot virus (IYSV) by RT-PCR. Deduced amino acid sequences of the nucleocapsid gene of the two IYSV isolates (designated CbAlsD1 and Als1) were compared with those of IYSV isolates reported previously; the isolates were genetically similar to an isolate from Dutch iris (Iris hollandica) in the Netherlands. A local lesion isolate of CbAlsD1 reproduced the original symptoms on alstroemeria seedlings without the presence of filamentous virions. These results showed that IYSV was the causal virus of necrotic spots and streaks. Naturally infected A. ligtu plants produced new shoots that appeared healthy when grown under thrips-free conditions. Although IYSV could not be detected in these symptomless shoots by RT-PCR alone, the virus was detected by Southern blotting of the RT-PCR products. Therefore, a low level of IYSV virions exist in the symptomless shoots that developed from infected alstroemeria plants.