IR Absorption Research Articles

A toolbox for easy entry low wavenumber in situ atomic layer deposition transmission FTIR spectroscopy studies.

A detailed description of a flexible and portable atomic layer deposition (ALD) system is presented for conducting in situ Fourier transform infrared (FTIR) absorption spectroscopy studies during the evolution and growth of ALD films. The system is directly integrated with a commercial FTIR spectrometer (Bruker Vertex 80V) to avoid the necessity of an external optical path to the instrument, thereby mitigating complexity and optical losses. In this work, we use potassium bromide (KBr) with a 5nm layer of sputtered Si as a substrate due to higher infrared transmittance when compared to a single-side polished Si wafer. The FTIR absorption study is conducted at normal incidence in transmission mode using a deuterated L-alanine doped triglycine sulfate (DTGS) detector owing to its potential applicability for reliable measurements at wavenumbers below ∼700cm-1. We demonstrate this by measuring ex situ the transverse optical phonon of bulk Al2O3 centered at 680cm-1. The integrity and functionality of the system to track the nucleation stage are validated by conducting in situ FTIR absorption measurements of Al2O3 using tri-methyl aluminum (TMA) and H2O. The measured IR absorption spectra for the Al2O3 growth after each cycle of TMA and H2O show the formation and removal of CH3 (2800-3000cm-1) groups on the substrate surface and CH4 (3016 and 1306cm-1) molecules in the reactor, thus confirming the successful tracking of ligand exchange. Thus, this instrument, together with the choice of KBr as substrate, can enable straightforward ALD nucleation studies using a DTGS detector having sufficient signal without additional optical setup and modifications to off-the-shelf FTIR systems that allow low wavenumber experiments.

Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria. Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.

Unsymmetric Pentacene- and Pentacenequinone-Fused Porphyrins: Understanding the Effect of Cross- and Linear-Conjugation.

Unsymmetric pentacenequinone-fused (cross-conjugated) and pentacene-fused (linear-conjugated) porphyrins were designed and synthesized. The cross-conjugated (AM 1 -AM 3 ) and linear-conjugated (AM 5 -AM 7 ) porphyrins displayed strikingly different sets of optical and electronic properties, both of which are unusual and nontypical of porphyrins. MCD, DFT, and TDDFT calculations suggest that multiple charge transfer states exist in both π-conjugated systems, which contributes to the complex absorption and MCD spectra of these molecular systems. The general Gouterman's four-orbital model used to explain porphyrin spectroscopy led to contradicting theoretical and experimental data, and is thus not applicable for these molecular systems. The "2 + 4" and "3 + 3" active spaces have been deduced and have proven effective to interpret the absorption and MCD spectra of the pentacenequinone-fused (cross-conjugated) and pentacene-fused (linear-conjugated) porphyrins, respectively. Spectroelectrochemistry of AM 5 -AM 7 revealed broad and intense IR absorptions in the range of 1500-2500 nm, illustrating the exceptional ability of these pentacene-fused systems to accommodate positive charges. A pronounced metal effect was observed for pentacene-fused porphyrins. While pentacene-fused Ni(II) porphyrin (AM6 ) demonstrated an abnormal ability to stabilize pentacene with a half-life of >28.3 days, the half-life of the free base and Zn(II) counterparts were normal, similar to those of pentacene analogues. This work provides important and useful information on guiding new material designs.

Near-IR absorption enhancement and crosstalk reduction of a photodiode in a CMOS indirect time-of-flight sensor.

The photodiode in a CMOS indirect time-of-flight (ITOF) sensor is a two-tap sensor especially designed for ranging. The three most important parameters are the demodulation contrast (DC), quantum efficiency (QE), and crosstalk. A trench nanostructure is commonly used as isolation layer between the pixels in a backside-illuminated CMOS sensor. In this paper, a trench is used to increase the IR absorption and decrease the crosstalk between pixels without a decrease in the DC. A trench grid is designed on top of a 6 µm thick silicon absorption layer to increase the optical path. A metal layer also is placed under the Si absorption layer as a reflection layer. The absorption of 940 nm infrared light can be increased up to 50%. The estimated QE can reach up to 40% at 940 nm. Deep trench isolation with a 6 µm depth is also used to isolate neighboring pixels. The crosstalk between the pixels can be reduced to less than 4% per neighboring pixel. This result shows a feasible CMOS ITOF sensor pixel design that we believe has great potential for use in solid-state lidar, depth cameras, machine vision, biomedical engineering, and facial recognition.

Comparing amorphous silica, short-range-ordered silicates and silicic acid species by FTIR

There is increased interest in the terrestrial silicon cycle in the last decades as its different compounds and species have large implications for ecosystem performance in terms of soil nutrient and water availability, ecosystem productivity as well as ecological aspects such as plant–microbe and plant-animal feedbacks. The currently existing analytical methods are limited. Fourier-transform infrared spectroscopy (FTIR) analysis is suggested being a promising tool to differentiate between the different Si species. We report here on the differentiation of varying Si-species/Si-binding (in synthetic material) using FTIR-analyses. Therefore, we collected FTIR-spectra of five different amorphous silica, Ca-silicate, sodium silicate (all particulate), a water-soluble fraction of amorphous silica and soil affected by volcanic activity and compared their spectra with existing data. A decrease of the internal order of the materials analyzed was indicated by peak broadening of the Si–O–Si absorption band. Peak shifts at this absorption band were induced by larger ions incorporated in the Si–O–Si network. Additionally, short-range ordered aluminosilicates (SROAS) have specific IR absorption bands such as the Si–O–Al band. Hence, SROAS and Si phases containing other ions can be distinguished from pure amorphous Si species using FTIR-analyses.

Role of Ionic Liquid Electrolytes As a Promoter for CO2 Electrocatalysis As Revealed By Vibrational Spectroscopy

Conversion of CO2 into chemicals and materials with an higher energy content makes CO2 electrolysis interesting for sustainable energy storage. One major strategy is to use electrochemical CO2 reduction reactions (CO2RR) in order to convert CO2 into CO, alcohols and formic acid. However, high overpotentials, competitive hydrogen evolution reaction (HER), as well as low product selectivity and Faraday efficiency, impairs CO2 electrolysis for applications so far. In order to reduce existing overpotentials, the use of room-temperature ionic liquids (RTILs) as promising electrolytes has gained much attention. That is because of their wide electrochemical window, excellent electric conductivity and high CO2 solubility. However, the reaction mechanism that is responsible for the drastically lower onset potentials for CO production from CO2RR, is for imidazolium based RTIL still controversial. Using in operando IR absorption and in situ sum-frequency generation (SFG) spectroscopy, we provide new information on the role of the imidazolium cations for CO2RR. For this purpose, we have studied Pt electrodes in contact with 1-butyl-3-methylimidazolium [BMIM], 1-butyl-2,3-dimethylimidazolium [BMMIM] and 1-butyl-1-methylpyrrolidinium bis(trifluoromethylsulfonyl)imide [BMPyrr][NTf2] RTILs that contained 10 to 500 mM H2O. Although, Pt catalysts have clear disadvantages in terms of costs and catalyst performance for CO2RR, because CO forms at low overpotentials but leads to catalyst poisoning and deactivation, the resulting limited number of side reactions renders Pt catalysts interesting for spectroscopic investigations that focus on the molecular origin of the existing low overpotentials. Cyclic voltammetry shows that Pt is active for CO2RR in all three RTILs, with the highest current densities in case of [BMMIM][NTf2]. SFG spectroscopy, demonstrates that CO forms at an onset potential of -0.7 V vs SHE, when [BMMIM] or [BMPyrr] cations and [NTf2] anions are present. This onset potential is independent of the H2O concentration and we propose that CO formation can occur predominantly via an electrostatically stabilized CO2 radical anion. On the other hand, in [BMIM][NTf2] electrolytes a strong dependence on the H2O concentration is observed for potentials <-0.4 V where we show that cations with an active C2 position at the imidazolium ring can act as co-catalysts that enables CO formation through a reactive imidazolium-2-carboxylic acid intermediate.

Measuring H2O concentrations in olivine by secondary ion mass spectrometry: Challenges and paths forward

Abstract Trace concentrations of H2O in olivine strongly affect diverse mantle and magmatic processes. H2O in olivine has been difficult to accurately quantify due to challenges in sample preparation and measurement, as well as significant uncertainties in standard calibrations. Here we directly compare secondary-ion mass spectrometry (SIMS) measurements of the olivine standards of Bell et al. (2003, hereafter Bell03) and Withers et al. (2012, hereafter Withers12) upon which most SIMS and Fourier transform infrared (FTIR) spectroscopy analyses are based. In the same SIMS session, we find that the olivine standards from the two studies are offset by ~50%, forming lines of different slope when comparing SIMS measurements to the independent nuclear reaction analysis (NRA) in Bell03 and elastic recoil detection analysis (ERDA) in Withers12. This offset is similar to the ~40% offset that exists in the FTIR absorption coefficients determined by those two studies, and points to the NRAERDA data as the cause for the offset more than different IR absorption characteristics of the different olivines. We find that the Withers12 olivine standards form the most precise calibration line, and that the measured Bell03 olivine standards have issues of reproducibility and accuracy due to the presence of hydrous inclusions (as documented previously by Mosenfelder et al. 2011). Owing to the limited availability of the Withers12 olivine standards, however, we recommend using orthopyroxene standards (Kumamoto et al. 2017) to calibrate H2O in olivine by SIMS due to similar calibration slopes. We revise the reference values of current orthopyroxene standards to account for uncertainties in the Bell et al. (1995) manometry data. With these revised values, the orthopyroxene calibration line is within 12% of the Withers12 olivine line, which is within the long-term uncertainty of the SIMS olivine measurements. We apply our SIMS calibration protocol to revise estimates of the partition coefficients for H2O between olivine and melt, resulting in a value of 0.0009 ± 0.0003 at pressures ~0.2–2 GPa. This brings into closer agreement between the partition coefficients determined from experimental studies and those based on natural studies of olivine-hosted melt inclusions.

Effect of Li+ ions on structural, optical and nano-crystallization behaviour of Na2O-CaO- P2O5-B2O3 glass system: Biomedical applications

Glassy system of composition xLi2O.3P2O5.21Na2O.26CaO.(50-x)B2O3 (x = 0, 1, 2, 3 and 4 mol%) was prepared by melt quench technique. X-ray diffraction, Infrared spectroscopy and Field emission scanning electron microscope with Energy dispersive spectroscopy were conducted to identify crystalline phase formation in glass powder and to study morphologies. The deconvoluted IR absorption spectra of synthesized samples, were analyzed to examine the structural rearrangements in the glass matrix before and after immersing in the phosphate solution. Optical band gap, Urbach energy and refractive index of the synthesized compositions were also obtained from the analysis of optical absorption spectra to examine the semiconducting behavior. The effects of the treatment in phosphate buffer solution for 12 days on crystallization & structural properties of these glasses were systematically investigated. The dependence of physical parameters on the glass composition suggested a variation in the number of non-bridging oxygen with Li2O content. Morphological and structural study alongside a possibility of hydroxyapatite formation suggests the biomedical applications of these materials.

In English

The possibilities to enhance the properties of nanostructured surfaces are evaluated on “polymer-multiwall carbon nanotube” composites. Influence of sp3 hybridization bonds is investigated in composites derived from polypropylene, polyamide-6, polyamide-12 and polyvinyl chloride after adding CNTs to polymers. IR absorption of “polymer-CNTs” films exceeds that of polymer by 10-103 times in the entire measured spectral range. In addition, two-polar IR absorption are measured on composites with negative components at spectral positions of “D-band” and “2D-band” of sp3 hybridization. In this case, the greater oscillation amplitudes of C-C, CH2 and CH3 bonds correspond to a higher absorption at the vibration frequencies γω(CН) and γω(CH2). Two-polar oscillations of absorption with a negative component in the spectral band ranges “D” and “2D” of sp3 hybridization in nanotubes have been measured for the composites. Frequencies of 2D-band correspond to the second order frequencies of D-band. The intensity of 2D band increases with an increase in the concentration of defects. The absorption of light increases when the frequencies of local oscillations of surface bonds in carbon nanotubes correspond to the frequencies of slotted modes along the boundary of the “nanotube polymer” (surface polaritons). Two-polar oscillations have an ultra-small half width 0.4–0.6 cm–1, which indicates a strong interaction of surface polaritons with photons. Vertically polarized light along carbon nanotubes and horizontally polarized light of D and 2D bands resulted in light beams splitting, two-photon interference and realization of the quantum Hong-Ou-Mandel effect.

Effect of Silver Water Produced by an Engineered Device Designed to Food Industry

Hygienic norms in the food and beverages production systems should be permanently monitored to prevent contamination with pathogens which could cause diseases in humans and animals. As regards the industrial scale of food and beverages production, the maximum extension of the shelf life is an essential task. Peracetic acid (CH3COOOH) is frequently applied in sanitation procedures of production piping and product tanks, but if it is not rinsed well, could drastically affect organoleptic characteristics of the products. Silver water (containing Ag+) could replace the use of peracetic acid. A device for efficient production of silver water is constructed. The silver content of the water produced is determined by atomic absorption spectroscopy, UV-Vis and IR spectral analysis. It is found that minimal inhibitory concentration (MIC) of 1 μg silver content inhibited the yeast (Saccharomyces cerevisiae ATCC 200060) growth (24 ± 1 mm mean inhibition zone) on a similar rate as 30 μg kanamycin (27 ± 1 mm). Bacterial (Escherichia coli ATCC 47093) growth inhibited by 1.5 μg silver content (18 ± 1 mm) is comparable to 10 μg ampicillin (17 ± 1 mm) but not to 30 μg kanamycin (35 ± 1 mm).

Quantum Mechanical Calculations and Electrochemical Study of Vibrational Frequencies, Energies in Some Flavonoids molecules

Quantum mechanical computations is conducted using DFT (Density Functional Theory) and PM3 (Parameterized Model 3), also, using DFT of (B3LYP) with a 6-311++G (d, p) with G09 application. These molecular three components include structure, electronic charge density and energetic characteristics of chosen phytomedicine compounds. The impact of functional groups on physical characteristics were studied using myricetin, linebacker, and flavone because of their chemical structures. For phytomedicine compounds, we utilized quantum mechanical simulations to estimate bond length, energy, vibration(vib.) modes, charge density and mechanical properties (cruelty, strength, stiffness, for the measurements of the lengths and energy of the bonds). Herzberg convention is used to look for the connections between the frequencies of similar modes which was used. IR absorption of the highest vibration frequencies modes of 3N-6 was measured and assigned for all species. Physical parameters were also calculated these include: heat of production, amount of energy, atomic electronic charge density, dipole moment and (E gap) (E = ELUMO-EHOMO). For three phytomedicine molecules, quantum chemical properties were combined. This software also computed and evaluated the electronic charge density distribution on atoms of 3 molecules. The equilibrium geometries of all three molecules were studied.

Electronic Structure Effects Related to the Origin of the Remarkable Near-Infrared Absorption of Blastochloris viridis' Light Harvesting 1-Reaction Center Complex.

Various photosynthetic organisms have evolved to absorb light in different regions of the visible light spectrum, thus adapting to the various lighting conditions available on Earth. While most of these autotrophic organisms absorb wavelengths around the 700-800 nm region, some are capable of red-shifted absorptions above this range, but none as remarkably as Blastochloris viridis whose main absorption is observed at 1015 nm, approximately 220 nm (0.34 eV) lower in energy than their main constituent pigments, BChl-b, whose main absorption is observed at 795 nm. The structure of its light harvesting 1-reaction center was recently elucidated by cryo-EM; however, the electronic structure details behind this red-shifted absorption remain unattended. We used hybrid quantum mechanics/molecular mechanics (QM/MM) calculations to optimize one of the active centers and performed classical molecular dynamics (MD) simulations to sample conformations beyond the optimized structure. We did excited state calculations with the time-dependent density functional theory method at the CAM-B3LYP/cc-pVDZ level of theory. We reproduced the near IR absorption by sequentially modifying the number of components involved in our systems using representative structures from the calculated MD ensemble. Natural transition orbital analysis reveals the participation of the BChl-b fragments to the main transition in the native structure and the structures obtained from the QM/MM and MD simulations. H-bonding pigment-protein interactions play a role on the conformation stabilization and orientation; however, the bacteriochlorin ring conformations and the exciton delocalization are the most relevant factors to explain the red-shifting phenomenon.

Efficient electron extraction by CoS2 loaded onto anatase TiO2 for improved photocatalytic hydrogen evolution

Titanium dioxide (TiO2) as a benchmark photocatalyst has been attracting attention due to its photocatalytic activity combined with photochemical stability. In particular, TiO2 with anatase polymorph holds promise for driving reduction reactions, such as proton reduction to evolve H2 via photocatalysis. In this study, anatase TiO2 is loaded with CoS2 through the hydrothermal route to form a CoS2@TiO2 photocatalyst system. X-ray absorption near edge structure confirms the +2-oxidation state of the Co cation, while extended x-ray absorption fine structure shows that each Co2+ cation is primarily coordinated to six S− anions forming a CoS2-like species. A small fraction of the Co2+ species is also coordinated to O2− anions forming Co x O y species and substitutionally resides at the Ti4+-sites. Further investigations with steady-state IR absorption induced by UV-light and time-resolved microwave conductivity suggest an efficient electron transfer from the conduction band of TiO2 to the surface-loaded CoS2 which acts as a metallic material with no bandgap. The CoS2 shallowly traps electrons at the host surface and facilitates proton reduction. An appreciably enhanced H2 evolution rate (8 times) is recognised upon the CoS2 loading. The CoS2 is here proposed to function as a proton reduction cocatalyst, which can potentially be an alternative to noble metals.

Вплив опромінення фізіологічного розчину високоенергетичними електронами на фізико-хімічні властивості та цитотоксичну активність доксорубіцину

The effect of preliminary irradiation of an aqueous solution of sodium chloride (saline) with 1 MeV high-energy electron beams on optical and cytotoxic/cytostatic properties of the dissolved Doxorubicin cancer drug is studied. With the use of Lewis lung carcinoma cell culture, it has been shown that the said treatment results in an increased cytotoxic/cytostatic action of the Doxorubicin, being the most pronounced in the range of low concentrations of the drug. The delivered dose of ionizing radiation on the saline ranged from 4 to 80 kGy. The maximum changes in the IR absorption spectra of Doxorubicin have been observed for the solutions irradiated with 10 kGy. The possible causes of the observed effects are discussed.

Temperature-resolved surface infrared spectroscopy of CO on Rh(111) and (2 × 1)-O/Rh(111)

Heterogeneously catalyzed reactions over transition metal surfaces are pillars of chemical industry and account for a significant fraction of the global energy demand. CO oxidation provides insight into the relative reactivity of various oxygenaceous surface phases, and it is necessary to first understand where it binds to the surface and the nature of the local environment to develop robust mechanistic pictures of the reaction. Surface IR spectroscopy is a quantitative technique that also provides information about the binding sites and chemical environments of the adsorbed CO molecules. Here, we report results from a study of CO sticking to clean Rh(111) and (2 × 1)-O/Rh(111) that shows that the intensity of the IR absorption was not linear with coverage and is an important consideration for further studies of the catalytic surface.

Nature and Isomorphism of Extra-Framework Components in Cancrinite- and Sodalite-Related Minerals: New Data

New data on the isomorphism of extra-framework components (including chromophores) in two- and multilayer minerals belonging to the cancrinite and sodalite groups, are obtained using chemical and single-crystal X-ray diffraction data as well as infrared, Raman, ESR, UV–Vis–near IR absorption and photoluminescence spectroscopy methods. It is shown that the blue color of these minerals may be due to CO3•− or S3•− radical anions, whereas yellow and pink shadings are typically due to the presence of S2•− radical anions and S4•− or S4, respectively. Two kyanoxalite varieties are distinguished: (1) with predominantly acid oxalate groups and (2) predominantly neutral oxalate groups. Zundel cation H5O2+ and CO2 molecules are shown to be typical impurities in nosean. The Zundel cation is also detected in kyanoxalite and in the 12-layer, cancrinite-related mineral marinellite. Wide isomorphic series involving substitutions of SO4− for SO32− and CO32−, as well as OH− for H2O and F−, are common for eight-layer, cancrinite-group minerals with an afghanite-type framework.

Comparative analysis of alkaline-extracted hemicelluloses from Beech, African rose and Agba woods using FTIR and HPLC

The vast application of hemicellulose in industry is greatly influenced by its chemical components. The current study focuses on identifying the chemical components of a high yield alkaline-extracted hemicellulose and characterization to serve as a guide for more specific and effective biotechnological uses. In this study we isolated hemicellulose from sawdust of three different wood species (Beech, African rose and Agba woods) and characterized them using FTIR and HPLC techniques. Hydroxyl spectra vibrations were observed at 3919-3671 cm−1 and 3454-3211 cm−1 which indicates the presence of non-hydrogen bonded OH stretch and normal polymeric OH stretch in all three samples. The samples contained residual lignin indicated by IR absorption bands at 1592 and 1525 cm−1. The presence of C=O stretching vibrations of acetyl groups at 1734 cm−1 indicated that African rosewood was generally an acetylated molecule. Each heteropolysaccharide also contained reducing monosaccharides at their ends suggested by the C–H stretching vibrations. Infrared absorptions characteristic of asymmetric β-1,6-glycosidic stretching was present in Beechwood and Agbawood, respectively, and African rosewood gave three absorption bands β-1,3-glycosidic stretch, β-1,4-glycosidic stretch and an asymmetric β 1,6-glycosidic stretch, respectively. Agbawood gave a major absorption band at 923.75 cm−1 corresponding to the absorption band at β-1,4-glycosidic stretching. African rosewood contained 96 % mannose and 4 % of an unidentified sugar. Beechwood contained primarily glucose, but Agbawood contained 20, 14, 8 and 57 % glucose, mannose, galactose, and an unidentified sugar, respectively.

Quantitative Modeling of Electron Dynamics and the Effect of Diffusion in Photosensitized Semiconductor Nanocomposites.

Photosensitized semiconducting nanomaterials have received considerable attention because of their applications in photocatalytic and photoelectronic devices. In such systems, photoexcited electrons with sufficiently high energies can be injected into the conduction band (CB) of an adjacent semiconductor. These excited electrons are subjected to various physical processes that can lead to their annihilation before exercising their catalytic/electric functions, and the efficiency of the photosensitized functions depends on the quantity of CB electrons produced and how long they remain near the surface region of the semiconductor. The rise and decay of photoexcited electrons in the semiconductor CB can be probed with transient IR absorption (TA), which was first demonstrated by Lian and co-workers. Results from various laboratories have since revealed that electrons appear in the CB following the excitation of the photosensitizer in tens to hundreds of femtoseconds and that the decay of the CB electrons typically exhibits multiple exponentials on varying ultrafast time scales. The size of the semiconductor nanoparticle appears to influence the diffusion of the CB electrons and thus their lifetimes. In all studies reported, the observed multiexponential decays have been analyzed and interpreted using purely phenomenological models, in which the individual decays were intuitively assigned to one specific relaxation or loss process. In reality, however, each exponential decay can be a convolution of multiple physical processes. In this Account, we report a universally applicable physical model, constructed by including all known electron dynamic processes, to quantitatively account for the multiexponential decays. We characterize the model as universal, as it can be used to analyze our own TA measurements, as well as data acquired in other laboratories. In our study of TiO2 nanorods photosensitized by Ag platelets, we demonstrate that each of the observed triple-exponential decays corresponds to a convolution of several physical decay processes occurring on similar time scales. The rate of each of the processes can be deconvoluted and determined to construct a complete, physically based model to assess the most important question: How many CB electrons are near the semiconductor surface region and what is their lifetime?The size of the semiconductor is an important consideration. Intuitively, as the semiconductor volume increases, there is more room for CB electrons to diffuse around, which increases their lifetime as annihilation occurs primarily at the surface. Indeed, Tachiya and co-workers previously reported that this lifetime increases with particle size. Nevertheless, while CB electrons live longer in the bulk of the particle, they are only useful when they are at the surface. Overall, what really matters is the CB electrons near the surface region, where the photosensitized functions actually occur. In applying our model to analyze the previously reported size-dependent Au/TiO2 results, we successfully reproduced the observation that larger semiconductor nanoparticles lengthen the lifetime of CB electrons because of diffusion into the bulk. More importantly, however, our model reveals that the size of the semiconductor has almost no influence on the retention of CB electrons near the semiconductor surface. This information is only revealed when all physical processes are quantitatively taken into account for the observed electron dynamics, which is not feasible with a phenomenological approach.

Detachable all-carbon-linked 3D covalent organic framework films for semiconductor/COF heterojunctions by continuous flow synthesis

Detachable all-carbon-linked 3D covalent organic framework films for semiconductor/COF heterojunctions by continuous flow synthesis

Ultrasensitive Mid-Infrared Biosensing in Aqueous Solutions with Graphene Plasmons.

Identifying nanoscale biomolecules in aqueous solutions by Fourier transform infrared spectroscopy (FTIR) provides an in situ and noninvasive method for exploring the structure, reactions, and transport of biologically active molecules. However, this remains a challenge due to the strong and broad IR absorption of water which overwhelms the respective vibrational fingerprints of the biomolecules. In this work, a tunable IR transparent microfluidic system with graphene plasmons is exploited to identify ≈2nm-thick proteins in physiological conditions. The acquired in situ tunability makes it possible to eliminate the IR absorption of water outside the graphene plasmonic hotspots by background subtraction. Most importantly, the ultrahigh confinement of graphene plasmons (confined to ≈15nm) permits the implementation of nanoscale sensitivity. Then, the deuterium effects on monolayer proteins are characterized within an aqueous solution. The tunable graphene-plasmon-enhanced FTIR technology provides a novel platform for studying biological processes in an aqueous solution at the nanoscale.