Internal Transcribed Spacer Types Research Articles

A taxonomic study of Fulvifomes (Hymenochaetales, Basidiomycota) in the Federated States of Micronesia and identification of two new species

Fulvifomes (Hymenochaetaceae) is a genus that was separated from Phellinus in the early 2000s based on internal transcribed spacer (ITS) and nuclear large ribosomal subunit (nLSU) analyses. Species recognition in the genus is challenging without molecular analysis due to general absence of discrete morphological characteristics. In this study, we examined Fulvifomes diversity in the Federated States of Micronesia (FS Micronesia), primarily found in the tropical and subtropical regions. Seven Fulvifomes species were confirmed: two new species, one unrecorded species and four species previously reallocated to Fulvifomes from other genera. We provide sequences including data on two protein-coding genes (RNA polymerase II; RPB2 and translation elongation factor-1 alpha; TEF1), nLSU and different conspecific ITS types.

The first established microsatellite markers to distinguish Candida orthopsilosis isolates and detection of a nosocomial outbreak in China.

The infection proportion of Candida orthopsilosis, a member of the C. parapsilosis complex, has increased globally in recent years, and nosocomial outbreaks have been reported in several countries. This study aimed to establish microsatellite loci-based typing method that was able to effectively distinguish among C. orthopsilosis isolates. Three reference C. orthopsilosis genome sequences were analyzed to identify repeat loci. DNA sequences containing over eight bi- or more nucleotide repeats were selected. A total of 51 loci were initially identified, and locus-specific primers were designed and tested with 20 epidemiologically unrelated isolates. Four loci with excellent reproducibility, specificity, and resolution for molecular typing purposes were identified, and the combined discriminatory power (DP, based on 20 epidemiologically unrelated isolates) of these four loci was 1.0. Reproducibility was demonstrated by consistently testing three strains each in triplicate, and stability, demonstrated by testing 10 successive passages. Then, we collected 48 C. orthopsilosis non-duplicate clinical isolates from the China Hospital Invasive Fungal Surveillance Net study to compare the DP of the microsatellite-based typing with internal transcribed spacer (ITS) and amplified fragment length polymorphism (AFLP) typing analyses, using ATCC 96139 as a reference strain. These 49 isolates were subdivided into 12 microsatellite types (COMT1-12), six AFLP types, and three ITS types, while all the isolates with the same COMT belonged to consistent AFLP and ITS type, demonstrating the high DP of our microsatellite-type method. According to our results, COMT12 was found to be the predominant type in China, and COMT5 was the second largest and responsible for causing a nosocomial outbreak. This microsatellite-type method is a valuable tool for the differentiation of C. orthopsilosis and could be vital for epidemiological studies to determine strain relatedness and monitor transmission.

Internal Transcribed Spacer Region Typing of Trichophyton interdigitale Isolated from Japanese Patients.

Trichophyton interdigitale, an anthropophilic species, is one of the main causative agents of tinea unguium and tinea pedis. T. interdigitale and the zoophilic species T. mentagrophytes are morphologically and physiologically very similar. Isolates of the T. interdigitale/T. mentagrophytes complex from around the world have been classified into more than 10 internal transcribed spacer (ITS) genotypes. In this study, we isolated T. interdigitale from Japanese patients and investigated which ITS type was more common. The ITS regions of 29 clinical isolates of T. interdigitale and one clinical isolate of T. mentagrophytes were sequenced. The phylogenetic analysis of the ITS region sequences revealed that the 29 isolates of T. interdigitale belong to ITS type II of T. interdigitale. The one clinical isolate of T. mentagrophytes was in the same cluster with ITS type II* of T. mentagrophytes. One terbinafine-resistant strain of T. interdigitale also belonged to ITS type II of T. interdigitale.

Comprehensive Taxonomical Analysis of Trichophyton Mentagrophytes/Interdigitale Complex of Human and Animal Origin from India

Taxonomic delineation of etiologic agents responsible for recalcitrant dermatophytosis causing an epidemic in India is still debated. The organism responsible for this epidemic is designated as T. indotineae, a clonal offshoot of T. mentagrophytes. To evaluate the real identity of the agent causing this epidemic, we performed a multigene sequence analysis of Trichophyton species isolated from human and animal origin. We included Trichophyton species isolated from 213 human and six animal hosts. Internal transcribed spacer (ITS) (n = 219), translational elongation factors (TEF 1-α) (n = 40), ß-tubulin (BT) (n = 40), large ribosomal subunit (LSU) (n = 34), calmodulin (CAL) (n = 29), high mobility group (HMG) transcription factor gene (n = 17) and α-box gene (n = 17) were sequenced. Our sequences were compared with Trichophyton mentagrophytes species complex sequences in the NCBI database. Except for one isolate (ITS genotype III) from animal origin, all the tested genes grouped our isolates and belonged to the "Indian ITS genotype", currently labeled as T. indotineae. ITS and TEF 1-α were more congruent compared to other genes. In this study, for the first time, we isolated the T mentagrophytes ITS Type VIII from animal origin, suggesting the role of zoonotic transmission in the ongoing epidemic. Isolation of T. mentagrophytes type III only from animal indicates its niche among animals. Outdated/inaccurate naming for these dermatophytes in the public database has created confusion in using appropriate species designation.

P505 Genotyping of Trichophyton mentagrophytes infections in animals in Italy through sequencing of the ITS region

Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectives Trichophyton mentagrophytes is a zoophilic dermatophyte that recognizes lagomorphs and rodents as primary hosts. The fungus can also infect other animals, such as dogs and cats. While T. mentagrophytes is a polymorphic sexual species, T. interdigitale is recognized as its clonal offshoot. This delineation is meaningful from a clinical point of view in human patients. Trichophyton interdigitale is exclusively anthropophilic and mainly causes non-inflammatory chronic tinea pedis or onychomycosis. Trichophyton mentagrophytes is predominantly of animal origin and often leads to the development of inflammatory lesions. These two dermatophytes form a species complex and have several ribosomal internal transcribed spacer (ITS) region genotypes. Identifying the ITS type allows species attribution and simultaneously strain typing. Many studies have been dedicated to this argument concerning human infections, while scarce information is available regarding animals. This study aimed to gain insights into the current epidemiology of T. mentagrophytes genotypes in animals.MethodsThe fungal isolates included in the study regarded cases involving various animal species seen at multiple veterinary clinics in Italy (n = 39) and France (n = 1) between 2005 and 2021. DNA was extracted from isolates cultured on Sabouraud dextrose agar using a commercially available kit (NucleoSpin® Tissue, Macherey-Nagel, Düren, Germany). PCR was performed with the primer pair V9G and LR3. PCR products were sequenced using ITS5 and ITS4 primers through a commercial service (Macrogen Europe). Using MEGA11 software (https://www.megasoftware.net/), ITS sequences were aligned with the currently recognized genotypes (6 and 22 for T. interdigitale and T. mentagrophytes, respectively).ResultsFigure 1 shows the ITS Type attribution for our isolates within a phylogenetic tree that includes the currently recognized genotypes. A new genotype (that, following the nomenclature, we called XXVII) was found in two isolates coming from a dog and a cat living in the same city. Figure 2 shows the distribution of the genotypes according to the animal host.A total of 23 samples out of 40 (57.5%) belonged to the ITS Type III*. It was the lone found in rabbits and the most prevalent in cats. This finding agrees with past literature, which reported a wide distribution of this ITS type in European animals. Of note is the high number of isolates with ITS Type II* found in dogs. ITS Type II* differs only by one nucleotide substitution from T. interdigitale and is considered an ‘intermediate’ entity between it and T. mentagrophytes. Clinical pictures, as well as molecular data, would suggest attributing this genotype to T. interdigitale. On the other hand, it has been detected from animal sources (chinchilla, guinea pig, and brown rat) which would justify its interpretation as T. mentagrophytes. Our data support the latter possibility.Though we could not have a detailed description of all the dogs harboring ITS Type II*, it is noteworthy that many showed the same clinical presentation, i.e., exfoliative chronic disseminated alopecia. Moreover, in most cases, despite the extensive lesions, the infection was not transmitted to the owners.ConclusionsThis study adds information on the molecular epidemiology of T. mentagrophytes infections in animals.

Molecular Epidemiology and Antifungal Susceptibility of Trichophyton Isolates in Greece: Emergence of Terbinafine-Resistant Trichophytonmentagrophytes Type VIII Locally and Globally.

Trichophyton isolates with reduced susceptibility to antifungals are now increasingly reported worldwide. We therefore studied the molecular epidemiology and the in vitro antifungal susceptibility patterns of Greek Trichophyton isolates over the last 10 years with the newly released EUCAST reference method for dermatophytes. Literature was reviewed to assess the global burden of antifungal resistance in Trichophyton spp. The in vitro susceptibility of 112 Trichophyton spp. molecularly identified clinical isolates (70 T. rubrum, 24 T. mentagrophytes, 12 T. interdigitale and 6 T. tonsurans) was tested against terbinafine, itraconazole, voriconazole and amorolfine (EUCAST E.DEF 11.0). Isolates were genotyped based on the internal transcribed spacer (ITS) sequences and the target gene squalene epoxidase (SQLE) was sequenced for isolates with reduced susceptibility to terbinafine. All T. rubrum, T. interdigitale and T. tonsurans isolates were classified as wild-type (WT) to all antifungals, whereas 9/24 (37.5%) T. mentagrophytes strains displayed elevated terbinafine MICs (0.25–8 mg/L) but not to azoles and amorolfine. All T. interdigitale isolates belonged to ITS Type II, while T. mentagrophytes isolates belonged to ITS Type III* (n = 11), VIII (n = 9) and VII (n = 4). All non-WT T. mentagrophytes isolates belonged to Indian Genotype VIII and harbored Leu393Ser (n = 5) and Phe397Leu (n = 4) SQLE mutations. Terbinafine resistance rates ranged globally from 0–44% for T. rubrum and 0–76% for T. interdigitale/T. mentagrophytes with strong endemicity. High incidence (37.5%) of terbinafine non-WT T. mentagrophytes isolates (all belonging to ITS Type VIII) without cross-resistance to other antifungals was found for the first time in Greece. This finding must alarm for susceptibility testing of dermatophytes at a local scale particularly in non-responding dermatophytoses.

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Genetic diversity within dominant Enterocytozoon bieneusi genotypes in pre-weaned calves

BackgroundCattle are commonly infected with the microsporidian parasite Enterocytozoon bieneusi. Sequence characterization of E. bieneusi in these animals at the ribosomal internal transcribed spacer (ITS) locus had identified I, J and BEB4 as the dominant genotypes. However, current studies on E. bieneusi in dairy cattle are mostly on infection rates and genotype distribution. This study aims to examine the intragenotypic diversity within dominant E. bieneusi genotypes in pre-weaned dairy calves in Shanghai, China.MethodsEnterocytozoon bieneusi genotypes and subtypes were identified by PCR sequence analysis of ITS and multilocus sequence typing (MLST), based on material from farms. Chi-square test was used to examine differences in E. bieneusi infection rates between farms or age groups.ResultsThe overall infection rate of E. bieneusi was 26.5% (214/809), ranging from 12.6% (Farm 5) to 38.5% (Farm 4). Infection rates increased with age during early life, with the peak infection rate (43.0%; 43/100) occurring at six weeks. Four genotypes were present, including J (n = 145, 67.8%), BEB4 (n = 59, 27.6%), CHN4 (n = 4, 1.9%) and CHN15 (n = 1, 0.5%), with the former two belonging to Group 2 and the latter two belonging to Group 1. Differences were detected in the distribution of the dominant genotypes J and BEB4 among five study farms. Altogether, 10 multilocus genotypes (MLGs) were identified in the two dominant ITS genotypes, including MLG-J1 to MLG-J8 of genotype J and MLG-B1 to MLG-B2 of genotype BEB4. MLG-B1 and MLG-B2 were recovered in Farms 1, 2 and 5, whereas MLG-J1 to MLG-J5 and MLG-J6 to MLG-J8 were found in Farms 3 and 4, respectively.ConclusionsThere is extensive genetic heterogeneity within the dominant E. bieneusi genotypes J and BEB4 in dairy calves in Shanghai, China, and MLST should be used in molecular epidemiological studies of E. bieneusi in cattle.

Use of Internal Transcribed Spacer Sequence Polymorphisms as a Method for Trichomonas vaginalis Genotyping.

Trichomonas vaginalis is the most common non-viral, sexually transmitted pathogen with a worldwide distribution. The aim of the present study was to design a new genotyping tool for T. vaginalis isolates using internal transcribed spacer (ITS) sequences. First, a total of 20 cryopreserved T. vaginalis isolates were thawed and genomic DNA was isolated from fresh cultures. A polymerase chain reaction (PCR) was performed to amplify the ITS regions and the amplicons were sequenced. These sequences were aligned with others from Genbank and polymorphisms were detected. At last, each ITS sequence was given a different sequence type. More than 99% homology was observed among sequences. Of 20 isolates, five had identical ITS sequence to reference (L29561) defined as ITST1. Moreover, 13 had A58 deletion (ITST10), one had C203T mutation (ITST2), and one had both A58 deletion and C203T mutation (ITST11). ITS typing of T. vaginalis sequences on Genbank revealed a total of 11 ITS types with the predominance of ITST1 (44.4%) globally. ITS typing seems to be an applicable and useful tool for a better understanding of molecular epidemiology as well as for the dissemination of T. vaginalis clones.

Comparing in vitro and in vivo virulence phenotypes of Burkholderia pseudomallei type G strains

Burkholderia pseudomallei (Bpm) is a saprophytic rod-shaped gram-negative bacterium and the causative agent of melioidosis. This disease has previously been described as endemic in areas such as northern Australia and Southeast Asia, but, more recently, a better understanding of the epidemiology of melioidosis indicated that the disease is distributed worldwide, including regions of the Americas and Africa. A 16S-23S rDNA internal transcribed spacer (ITS) typing system has been developed for Bpm and has revealed that ITS types C, E, and hybrid CE are mainly associated with Australia and Southeast Asia while type G strains are more associated with cases of melioidosis in the Western Hemisphere. The purpose of the current study was to determine the in vitro and in vivo virulence profiles of the understudied Bpm type G strains Ca2009, Ca2013a, Mx2013, and 724644 and compared such phenotypes to the commonly studied Bpm type C strain K96243. We evaluated virulence by measuring invasion/uptake and survival of these Bpm strains in murine respiratory epithelial LA-4 cells and alveolar macrophage MH-S cells using different multiplicity of infections (MOIs of 1 and 10). We also calculated the lethal dose 50 values (LD50) in BALB/c mice that were inoculated intranasally with either Ca2009, Ca2013a, or Mx2013. Overall, the virulence and lethality phenotypes of Bpm type G strains were similar to the Bpm type C strain K96243. Additional comparative analyses between the Bpm ITS types may lead to a better understanding of the contribution of the ITS type to the epidemiology and ecology of Bpm strains.

Molecular features of hookworm larvae (Necator spp.) raised by coproculture from Ugandan chimpanzees and Gabonese gorillas and humans

Species composition of Necator hookworms was surveyed in (i) Ugandan chimpanzees living around farms and villages at Bulindi, (ii) Gabonese gorillas under habituation in Moukalaba-Doudou National Park (MDNP), and (iii) Gabonese villagers living adjacent to MDNP. Internal transcribed spacers (ITS) of rDNA and partial cytochrome c oxidase subunit 1 (Cox1) gene of mtDNA were analyzed from larvae obtained by coproculture. Three ITS types (I, II and III) and three Cox1 haplotype groups (A, B and C) were demonstrated. ITS type I and Cox1 haplotype group A, representing Necator americanus, were demonstrated in the hookworm larvae from Gabonese gorillas and humans, but not from Ugandan chimpanzees. Type II and haplotype groups B and C, presumably representing N. gorillae, were found in larvae from Ugandan chimpanzees and Gabonese gorillas and humans. These features were overall similar with those found previously in the Central African Republic. Meanwhile, type III was proven in a larva from a Gabonese gorilla as the first demonstration from a non-human primate. Cox1 haplotypes obtained from Ugandan chimpanzees formed a subgroup within group B, presumably reflecting dispersal and diversification processes of the apes.

Biodiversity of green algae covering artificial hard substrate surfaces in a suburban environment: a case study using molecular approaches.

In Middle European suburban environments green algae often cover open surfaces of artificial hard substrates. Microscopy reveals the Apatococcus/Desmococcus morphotype predominant over smaller coccoid forms. Adverse conditions such as limited water availability connected with high PAR and UV irradiance may narrow the algal diversity to a few specialists in these subaerial habitats. We used rRNA gene cloning/sequencing from both DNA extracts of the biofilms without culturing as well as cultures, for the unambiguous determination of the algal composition and to assess the algal diversity more comprehensively. The culture independent approach revealed mainly just two genera (Apatococcus, Trebouxia) for all study sites and five molecular operational taxonomic units (OTUs) for a particular study site, which based on microscopic observation was the one with the highest morphological diversity. The culture approach, however, revealed seven additional OTUs from five genera (Chloroidium, Coccomyxa, Coenochloris, Pabia, Klebsormidium) and an unidentified trebouxiophyte lineage for that same site; only two OTUs were shared by both approaches. Two OTUs or species were recovered for which references have been isolated only from Antarctica so far. However, the internal transcribed spacer (ITS) sequence differences among them supported they are representing distinct populations of the same species. Within Apatococcus five clearly distinct groups of ITS sequences, each putatively representing a distinct species, were recovered with three or four such ITS types co-occurring at the same study site. Except for the streptophyte Klebsormidium only members of Trebouxiophyceae were detected suggesting these algae may be particularly well-adapted to subaerial habitats.

Predominance of Cryptococcus neoformans var. grubii multilocus sequence type 5 and emergence of isolates with non-wild-type minimum inhibitory concentrations to fluconazole: a multi-centre study in China

There are few data on the molecular epidemiology of cryptococcosis in China. Here we investigated the species distribution, molecular types and antifungal susceptibilities of 312 Cryptococcus neoformans species complex isolates from ten hospitals over 5 years. Isolates were identified by internal transcribed spacer (ITS) sequencing and by two matrix-assisted laser desorption–ionization time-of-flight mass spectrometry (MALDI-TOF MS) systems. Multilocus sequence typing (MLST) was used to verify species/variety and to designate molecular types. Susceptibility to six antifungal drugs was determined by the Sensititre YeastOne™ method. Cryptococcus neoformans was the predominant species (305/312 isolates (97.8%), all were ITS type 1, serotype A), of which 89.2% (272/305) were C. neoformans var. grubii MLST sequence type (ST) 5 and 6.2% (19/305) were ST31. Other C. neoformans var. grubii STs were rare but included six novel STs. Only two strains were C. neoformans var. neoformans (both serotype AD). Cryptococcus gattii was uncommon (n = 7, four ITS types) and comprised five MLST STs including one novel ST. For C. neoformans var. grubii, the proportion of isolates with non-wild-type MICs to fluconazole significantly rose in the fourth study year (from 0% (0/56 isolates) in the first year to 23.9% (17/71) in the fourth year), including five isolates with fluconazole MICs of ≥32 mg/L. The study has provided useful data on the species epidemiology and their genetic diversity and antifungal susceptibility. The proportional increase in isolates with non-wild-type MICs to fluconazole is noted.

Genetic Analyses of the Internal Transcribed Spacer Sequences Suggest Introgression and Duplication in the Medicinal Mushroom Agaricus subrufescens.

The internal transcribed spacer (ITS) region of the nuclear ribosomal RNA gene cluster is widely used in fungal taxonomy and phylogeographic studies. The medicinal and edible mushroom Agaricus subrufescens has a worldwide distribution with a high level of polymorphism in the ITS region. A previous analysis suggested notable ITS sequence heterogeneity within the wild French isolate CA487. The objective of this study was to investigate the pattern and potential mechanism of ITS sequence heterogeneity within this strain. Using PCR, cloning, and sequencing, we identified three types of ITS sequences, A, B, and C with a balanced distribution, which differed from each other at 13 polymorphic positions. The phylogenetic comparisons with samples from different continents revealed that the type C sequence was similar to those found in Oceanian and Asian specimens of A. subrufescens while types A and B sequences were close to those found in the Americas or in Europe. We further investigated the inheritance of these three ITS sequence types by analyzing their distribution among single-spore isolates from CA487. In this analysis, three co-dominant markers were used firstly to distinguish the homokaryotic offspring from the heterokaryotic offspring. The homokaryotic offspring were then analyzed for their ITS types. Our genetic analyses revealed that types A and B were two alleles segregating at one locus ITSI, while type C was not allelic with types A and B but was located at another unlinked locus ITSII. Furthermore, type C was present in only one of the two constitutive haploid nuclei (n) of the heterokaryotic (n+n) parent CA487. These data suggest that there was a relatively recent introduction of the type C sequence and a duplication of the ITS locus in this strain. Whether other genes were also transferred and duplicated and their impacts on genome structure and stability remain to be investigated.

Molecular characterization of Trichomonas gallinae isolates recovered from the Canadian Maritime provinces' wild avifauna reveals the presence of the genotype responsible for the European finch trichomonosis epidemic and additional strains.

Finch trichomonosis, caused by Trichomonas gallinae, emerged in the Canadian Maritime provinces in 2007 and has since caused ongoing mortality in regional purple finch (Carpodacus purpureus) and American goldfinch (Carduelis tristis) populations. Trichomonas gallinae was isolated from (1) finches and rock pigeons (Columbia livia) submitted for post-mortem or live-captured at bird feeding sites experiencing trichomonosis mortality; (2) bird seed at these same sites; and (3) rock pigeons live-captured at known roosts or humanely killed. Isolates were characterized using internal transcribed spacer (ITS) region and iron hydrogenase (Fe-hyd) gene sequences. Two distinct ITS types were found. Type A was identical to the UK finch epidemic strain and was isolated from finches and a rock pigeon with trichomonosis; apparently healthy rock pigeons and finches; and bird seed at an outbreak site. Type B was obtained from apparently healthy rock pigeons. Fe-hyd sequencing revealed six distinct subtypes. The predominant subtype in both finches and the rock pigeon with trichomonosis was identical to the UK finch epidemic strain A1. Single nucleotide polymorphisms in Fe-hyd sequences suggest there is fine-scale variation amongst isolates and that finch trichomonosis emergence in this region may not have been caused by a single spill-over event.

Genetic structure of Italian populations ofPyrenochaeta lycopersici, the causal agent of corky root rot of tomato

Pyrenochaeta lycopersici is the causal agent of corky root rot, which is a serious disease worldwide that attacks the roots of tomato. A total of 139 isolates were sampled from eight locations in Italy and Israel and assigned to two molecular types (type 1 and type 2) based on internal transcribed spacer (ITS) sequences. These isolates were genotyped using amplified fragment length polymorphisms (AFLPs) to decipher the population structure. Based on this population structure analysis, three groups of P. lycopersici were identified. One group correlated to ITS type 1, while the other two correlated to ITS type 2. AMOVA indicated high genetic divergence (FST = 0� 40) between the Italian types 1 and 2. These data support the view that the two ITS types represent significant evolutionary entities, although there might be incomplete lineage sorting present. Some isolates of different ITS type were observed to have very similar multilocus AFLP profiles, and some genotypes were intermediate between the two ITS types. This suggests that parasexual hybridization between the two types has had a significant role in shaping the population structure of P. lycopersici. Finally, the average divergence among the populations within the ITS types was very high (FSC = 0� 710, P < 10 � 5 ), probably

AIDS-related Pneumocystis jirovecii genotypes in French Guiana

The study described Pneumocystis jirovecii (P. jirovecii) multilocus typing in seven AIDS patients living in French Guiana (Cayenne Hospital) and seven immunosuppressed patients living in Brest, metropolitan France (Brest Hospital). Archival P. jirovecii specimens were examined at the dihydropteroate synthase (DHPS) locus using a PCR-RFLP technique, the internal transcribed spacer (ITS) 1 and ITS 2 and the mitochondrial large subunit rRNA (mtLSUrRNA) gene using PCR and sequencing. Analysis of typing results were combined with an analysis of the literature on P. jirovecii mtLSUrRNA types and ITS haplotypes.A wild DHPS type was identified in six Guianese patients and in seven patients from metropolitan France whereas a DHPS mutant was infected in the remaining Guianese patient. Typing of the two other loci pointed out a high diversity of ITS haplotypes and an average diversity of mtLSUrRNA types in French Guiana with a partial commonality of these haplotypes and types described in metropolitan France and around the world. Combining DHPS, ITS and mtLSU types, 12 different multilocus genotypes (MLGs) were identified, 4 MLGs in Guianese patients and 8 MLGs in Brest patients. MLG analysis allows to discriminate patients in 2 groups according to their geographical origin. Indeed, none of the MLGs identified in the Guianese patients were found in the Brest patients and none of the MLGs identified in the Brest patients were found in the Guianese patients.These results show that in French Guiana (i) PCP involving DHPS mutants occur, (ii) there is a diversity of ITS and mtLSUrRNA types and (iii) although partial type commonality in this territory and metropolitan France can be observed, MLG analysis suggests that P. jirovecii organisms from French Guiana may present specific characteristics.

Molecular epidemiology of Pneumocystis jiroveci in human immunodeficiency virus-positive and -negative immunocompromised patients in The Netherlands.

Pneumocystis jiroveci infections can cause pneumocystis pneumonia (PCP) or lead to colonization without signs of PCP. Over the years, different genotypes of P. jiroveci have been discovered. Genomic typing of P. jiroveci in different subpopulations can contribute to unravelling the pathogenesis, transmission and spread of the different genotypes. In this study, we wanted to determine the distribution of P. jiroveci genotypes in immunocompetent and immunocompromised patients in The Netherlands and determine the clinical relevance of these detected mutations. A real-time PCR targeting the major surface glycoprotein gene (MSG) was used as a screening test for the presence of P. jiroveci DNA. Samples positive for MSG were genotyped based on the internal transcribed spacer (ITS) and dihydropteroate synthase (DHPS) genes. Of the 595 included bronchoalveolar lavage fluid samples, 116 revealed the presence of P. jiroveci DNA. A total of 52 of the 116 samples were ITS genotyped and 58 DHPS genotyped. The ITS genotyping revealed 17 ITS types, including two types that have not been described previously. There was no correlation between ITS genotype and underlying disease. All ITS- and DHPS-genotyped samples were found in immunocompromised patients. Of the 58 DHPS-genotyped samples, 50 were found to be WT. The other eight samples revealed a mixed genotype consisting of WT and type 1. The majority of the latter recovered on trimethoprim-sulfamethoxazole suggesting no clinical relevance for this mutation.

Molecular analysis shows that soil fungi from ancient semi-natural woodland exist in sites converted to non-native conifer plantations

The restoration of microbial communities may be central to the re-establishment of plant–soil interactions and renovation of function in degraded woodland systems. However, there is currently little knowledge of the extent to which the soil microbial communities associated with past vegetation persist in such systems. This study used fungal-specific internal transcribed spacer (ITS) ribosomal DNA environmental clone libraries to compare fungal communities in four ancient semi-natural woodland sites in the UK with adjacent non-native conifer plantations, and with adjacent grassland. In total, we recovered 190 distinct ITS sequence types (ITS types), of which the greatest diversity occurred in ancient semi-natural woodland. Although ancient semi-natural woodland and adjacent conifer plantations shared 27 ITS types, none were shared between woodland and grassland sites. A total of 16 ectomycorrhizal genera were subsequently identified using BLASTn searches, of which nine were recovered from both woodland types and none were shared between woodland and grassland sites. Only eight of these genera had previously been identified from sporophores during 50 years of surveying carried out at the same woodland sites. We conclude that fungal communities associated with ancient semi-natural woodland also exist on sites converted to non-native conifer plantations. In consequence, attempts to restore native, semi-natural woodland may have an increased chance of success when focussed on restoration of plantations, rather than the creation of new woodland on ex-agricultural land.

High Penetrance of a Pan-Canina Type rDNA Family in Intersection Rosa Hybrids Suggests Strong Selection of Bivalent Chromosomes in the Section Caninae

All dogroses (Rosa sect. Caninae) are characterized by the peculiar canina meiosis in which genetic material is unevenly distributed between female and male gametes. The pan-canina rDNA family (termed beta) appears to be conserved in all dogroses analyzed so far. Here, we have studied rDNAs in experimental hybrids obtained from open pollination of F1 plants derived from 2 independent intersectional crosses between the pentaploid dogrose species (2n = 5x = 35) Rosa rubiginosa as female parent (producing 4x egg cells due to the unique asymmetrical canina meiosis) and the tetraploid (2n = 4x = 28) garden rose R. hybrida ‘André Brichet' as male parent (producing 2x pollen after normal meiosis). We analyzed the structure of rDNA units by molecular methods [CAPS and extensive sequencing of internal transcribed spacers (ITS)] and determined the number of loci on chromosomes by FISH. FISH showed that R. rubiginosa and ‘André Brichet' harbored 5 and 4 highly heteromorphic rDNA loci, respectively. In the second generation of hybrid lines, we observed a reduced number of loci (4 and 5 instead of the expected 6). In R. rubiginosa and ‘André Brichet', 2-3 major ITS types were found which is consistent with a weak homogenization pressure maintaining high diversity of ITS types in this genus. In contrast to expectation (the null hypothesis of Mendelian inheritance of ITS families), we observed reduced ITS diversity in some individuals of the second generation which might derive from self-fertilization or from a backcross to R. rubiginosa. In these individuals, the pan-canina beta family appeared to be markedly enriched, while the paternal families were lost or diminished in copies. Although the mechanism of biased meiotic transmission of certain rDNA types is currently unknown, we speculate that the bivalent-forming chromosomes carrying the beta rDNA family exhibit extraordinary pairing efficiency and/or are subjected to strong selection in Caninae polyploids.