Internal Transcribed Spacer Nucleotide Research Articles

First Report of Panax notoginseng Leaf spot Disease Caused by Boeremia exigua in China.

Panax notoginseng a perennial herb native to China, is widely grown in the Yunnan Province. (Yang et al. 2022). From July to August 2022, a new leaf spot disease was observed on fully expanded leaves of P. notoginseng from a planting base in the Xundian, Yunnan Province, China. Approximately 250 ha. of P. notoginseng is the cultivated area, and the incidence of leaf spot disease was around 10-15%. Round spots appeared on the infected leaves and as the disease progressed these leaves fell off the plant. A total 21 symptomatic leaves were randomly collected from the planting base to isolate the pathogens and further study in the laboratory. The surface of infected leaves were sanitized with 0.5% sodium hypochlorite for 2 min. and 75% alcohol for 1 min., and then rinsed thrice with sterile water. Once drying, the samples were placed on potato dextrose agar (PDA), plates and incubated at 25 °C for 5 days. The fungus was isolated from the symptomatic tissue, but only three isolates were preserved for further identification. Pure cultures of the representative strain Zhaochanglin 118 were obtained using the singlespore method, and the colonies obtained were dark-green to dark-black in appearance. The pycnidia were dark brown, solitary, or congregated with an inconspicuous neck. The conidia were colorless, ellipsoidal, and measured between 4.5 to 7 × 2 to 3 μm (n = 30). These morphological characteristics were similar to those described for Boeremia exigua (Valenzuela-Lopezi et al. 2018). The genomic DNA of the isolate was extracted using the DN14 cetyltrimethylammonium bromide rapid plant genome extraction kit. The internal transcribed spacer (ITS), RNA polymerase second largest subunit (RPB2) and translation elongation factor 1-alpha (TEF1) genes were amplified via polymerase chain reaction using the primers ITS1/ITS4 (White et al. 1990), Af/Cf (Matheny et al. 2002), and EF1-983F/EF1-2218R (Chen et al. 2015), respectively. All sequences were deposited in GenBank (OQ996531 for ITS; OR291158 for RPB2 and OR291159 for TEF1). A BLASTN homology search using the ITS nucleotide sequence indicated that this has 99.6% identity with the sequence MH859059, named B. exigua from CBS culture collection (517/519 bp); the RPB2 sequence has 97.5% identity with sequence GU371780, named B. exigua from CBS culture collection (704/722 bp); and the TEF1 sequence has 98.4% identity with sequence GU349080, named B. exigua from CBS culture collection (871/885 bp). To test Koch's postulates, a pathogenicity test was carried out on the leaves of six fully expanded P. notoginseng plants in the Xundian planting base. Conidial suspensions were prepared for one isolates at a concentration of 106 spores per milliliter. Three leaflets on different plants were applied with 20µl spore suspension and the other three leaflets were drop of 20 µl sterile distilled water. The whole experiment was repeated three times. The P. notoginseng plants were incubated under sterile conditions at 25°C for 7 days. Inoculated leaves showed the characteristic brown round spots, while control leaves were asymptomatic so, Koch's postulates were fulfilled by re-isolating the pathogen from symptomatic tissue, which was subsequently confirmed as B. exigua through morphological and molecular analyses. Koch's postulates were fulfilled. To our knowledge, this is the first report of B. exigua causing leaf spot disease in P. notoginseng in China, which lays a foundation for further study and developing disease control methods.

Occurrence of Fusarium fujikuroi Causing Fusarium Wilt on Carthusian Pink in China.

Carthusian pink (Dianthus carthusianorum) is native to Europe and is widely grown in China for landscaping. In September 2022, wilting symptoms of carthusian pink were found in Xixia City (33°18'31″ N, 111°29'45″ E), Henan Province, China, with a disease incidence of 65%. Approximately 100 plants were surveyed on the landscaping lawns of the park. Initial symptoms were yellow to brown lesions on the base of stems and leaves. Later, the lesions spread throughout the plants, turning leaves yellow, and leading to root and leaf rot. Eventually, the plants shriveled and died (Figure S1a). Thirty diseased tissues isolated from the roots and leaves were cut into 5×5 mm pieces, which were surface sterilized with 75% ethanol solution for 30 seconds and 1% NaClO solution for 1 minute, rinsed three times in sterilized water, placed on potato dextrose agar (PDA) plates supplemented with 50 μg ml-1 streptomycin, and incubated at 28°C for five days. A total of 25 purified fungal strains with similar phenotypic features were obtained. Three representative strains named OSZ-P1, OSZ-P2, and OSZ-P3 were selected for identification. Fungal colonies developed an abundant aerial mycelium, initially white, which subsequently developed red to purple pigments (Figure S1b). Macroconidia were slender, straight, and measured 12.74 to 49.39 × 2.07 to 4.39 μm (n=50), with two to five septa. Microconidia were clavate and measured 6.31 to 11.61 × 2.15 to 4.02 μm (n=50) (Figure S1c). These morphological characteristics were consistent with Fusarium spp.. The rDNA internal transcribed spacer (ITS), β-tubulin gene (tub2), translation elongation factor 1-alpha gene (tef1), calmodulin (cmdA), RNA polymerase largest subunit (rpb1), and RNA polymerase II second largest subunit (rpb2) were amplified with primers ITS1/ITS4, BT-2a/BT-2b, EF1/EF2, CL1/CL2A, Fa/G2R, and 5F2/7Cr, respectively, for further identification (Yilmaz et al. 2021, O'Donnell et al. 2022). ITS (OQ726389, OQ726390, OQ726391), tub2 (OQ730191, OQ789645, OQ789646), tef1 (OR088904, OR088905, OR088906), cmdA (OR133730, OR133731, OR133732), rpb1 (OR088907, OR088908, OR133729), and rpb2 (OR133733, OR133734, OR133735) nucleotide sequences of the strains OSZ-P1, OSZ-P2, and OSZ-P3 were submitted to GenBank. BLASTn analysis of OSZ-P1 sequences exhibited 99 to 100% similarity with Fusarium fujikuroi sequences (strains Augusto2, I1.3, and CSV1) CP023096, CP023108, CP023084 of cmdA, CP023089, CP023077 of rpb1, and CP023093, CP023105, CP023081 of rpb2. A Phylogenetic tree was constructed of combined genes (tub2, tef1, cmdA, rpb1, rpb2) of sequences, alongside the sequences of the type strains by the neighbor-joining method. The three strains formed a clade with the type strains CBS257.52 and Augusto2 of F. fujikuroi in phylogenetic trees, being clearly separated from other Fusarium spp. (Figure S2). The morphological features and molecular analyses supported the strains as members of F. fujikuroi. To verify the pathogenicity, aboveground parts of the plants of five healthy six-month-old potted plants were sprayed with 100 µl of conidial suspension per pot (106 conidia ml-1), and five similar plants were sprayed with sterilized water as a control. All plants were placed in a climate incubator at 28°C and 90% relative humidity. Seven days after inoculation, withered and yellowed lesions were observed, similar to the natural lesions (Figure S1e). No symptoms were observed on the control plants. The whole pathogenicity tests were performed thrice. Reisolation resulted in cultures that were morphologically and molecularly identical to the original isolates, fulfilling Koch's postulates. Fusarium wilt disease has been reported on other plants of the genus Dianthus. Vascular wilt on Dianthus caryophyllus (carnation) caused by Fusarium oxysporum is the most destructive disease of carnation crops worldwide (Ardila et al. 2014). Fusarium acuminatum causing Dianthus chinensis root rot and foliage blight has recently been reported in Nanjing, China (Xu et al. 2022). To our knowledge, this is the first report of F. fujikuroi causing Fusarium wilt on carthusian pink worldwide. The host range of F. fujikuroi still needs to be clarified for accurate disease management in the selection of plant species for landscape.

First report of Colletotrichum gloeosporioides causing anthracnose on grapevine (Vitis vinifera) in Shaanxi province, China.

Grape anthracnose caused by Colletotrichum spp. is an economically important disease in most vineyards during rainy and humid weather. In June 2021, widespread anthracnose was observed in leaves of Vitis vinifera cv. Red Globe in Yangling city (latitude = 34.28, longitude = 108.07), Shaanxi Province. Diseased plants exhibited circular brown necrotic lesions with yellow borders in young leaves (Fig. 1A). Approximately 80% of the 75 grape plants showed disease symptoms that were consistent with those previously reported for anthracnose on grape caused by C. acutatum, C. gloeosporioides, and C. viniferum (Hong et al. 2008; Oo and Oh 2017). To isolate the pathogen, ten diseased leaves were collected. Small pieces (0.5 mm × 0.5 mm) of symptomatic tissue were surface sterilized with 75% alcohol for 30 s, transferred to 4% NaClO for 2 min, and then washed twice with sterile distilled water. The pathogen was isolated and cultured on potato dextrose agar (PDA) at 25 °C with a 12 h light/dark photoperiod. Hyphal tips of the isolate were transferred to fresh PDA after 1 day. Acervuli were formed after 15 days on PDA. The colonies were single-spored to obtain pure cultures. Pure cultures on PDA appear white to grey, and the reverse of the colonies was olive gray or yellowish white (Fig. 1B, C). Conidia were single-celled, hyaline, straight cylindrical with ends rounded, and measured 12.50 to 17.78 μm (length) (mean=15.19 μm, n=50) × 3.66 to 5.82 μm (width) (mean=4.48 μm, n=50) (Fig. 1D). The morphological characteristics matched the previous descriptions of C. gloeosporioides by Sawant et al. (2012). For molecular identification, genomic DNA was extracted from isolate YLRG13, and the actin (ACT), internal transcribed spacer (ITS), and beta-tubulin (TUB2) were amplified using the primer pairs ACT-512F/ACT-783R (Carbone and Kohn 1999), ITS1F/ITS4 (White et al. 1990), and T1/T2 (O' Donnell and Cigelnik 1997), respectively. The ACT (OQ031183 and MZ686707), ITS (OP999326 and MZ669974), and TUB2 (OQ031184 and MZ686708) nucleotide sequences of isolates YLRG5 and YLRG13 were deposited in GenBank. BLASTn showed 99 to 100% similarity with C. gloeosporioides. Neighbor-joining trees based on the three genes was constructed using PAUP version 4.0b10. The results showed the isolated YLRG5 and YLRG13 from V. vinifera was closely related to C. gloeosporioides with high bootstrap values (Fig. S2). Pathogenicity testing was performed with isolate YLRG13 by 10 μL conidial suspension (4×108 conidia/ml) on the surfaces of five wounded detached leaves of six-year-old Vitis vinifera cv. Red Globe. Sterile distilled water was used as a control. Inoculated plants were placed in a humid chamber at 25 °C. Conidial germination was observed at 24 hours post-inoculation (Fig. S1E). Four days after inoculation, typical anthracnose symptoms developed on inoculated grape leaves (Fig. S1F). No symptoms were observed on the controls. The fungus reisolated from the symptomatic grape leaves showed the same morphological characteristics of the inoculated isolate, fulfilling Koch's postulates. To our knowledge, this is the first report of grape anthracnose caused by C. gloeosporioides in Northwestern of China. C. gloeosporioides was reported causing anthracnose on a wide variety of horticultural crops, such as almond, avocado, apple, banana, cashew, citrus, cucumber, grape, guava, mango, onion, papaya, passion fruit, pepper, strawberry, tomato, and watermelon (Sharma and Kulshrestha 2015), suggesting the potential cross-infection between grape and other horticultural crops.

Morphometrical and Molecular Characterization of Oesophagostomum columbianum (Chabertiidae: Oesophagostominae) and Haemonchus contortus (Trichostrongylidae: Haemonchinae) Isolated from Goat (Capra hircus) in Sylhet, Bangladesh.

This study was aimed at describing two (2) intestinal nematodes from naturally infected native breed of goats (Capra hircus) in Bangladesh, identified as Oesophagostomum columbianum (Curtice, 1890) Stossich 1899 and Haemonchus contortus (Rudolphi, 1803) Cobb, 1898. The identification was made based on morphometric features and was confirmed by amplifying internal transcribed spacer (ITS) and cytochrome c oxidase (cox1) gene. Well-developed lateral alae, distinct cervical papillae anteriorly to esophageal expansion, and male spicule length (0.73-0.79 mm, n = 2) were characteristically observed in O. columbianum. At the same time, male spicule length (0.40-0.46 mm, n = 2) and position of female vulvar flap (4.30-4.54 mm from posterior end, n = 3) were observed in H. contortus. DNA sequence homology of the ITS and cox1 gene of both specimens revealed the same results, showing similarity to the GenBank sequences of O. columbianum (GenBank No. KC715827; JX188470) and H. contortus (GenBank No. KJ724377; HQ389229). Phylogenetic analysis computed by maximum livelihood (ML) from the ITS nucleotide sequences revealed that the O. columbianum and H. contortus isolates identified in this study were clustered in the same clade with isolates from China and Iran, respectively. This study, for the first time, illustrates the characteristics of O. columbianum and H. contortus in Bangladesh, combining both morphological and molecular data. The universal primer-based polymerase chain reaction (PCR) protocol could be an economical and efficient option for researchers from poor resource settings for precise identification of nematodes. The information generated in this study may contribute to formulating effective control strategies against these nematodes.

First Report of Stagonosporopsis vannaccii Causing Leaf Spot on Crassocephalum crepidioides in China.

Crassocephalum crepidioides (Benth.) S. Moore, native to tropical Africa, is an important invasive weed in many countries, seriously threatening the safety of agricultural ecosystem. During December 2018, 100% of C. crepidioides plants exhibited leaf spots in the Kudzu (Pueraria lobata) garden in Tianlin County, Baise City, Guangxi, China (24°40'20.42″N, 106°11'33.51″E), but Kudzu was not affected by this disease. The leaf spots appeared as small brown spots surrounded by a yellow-green halo initially, enlarged to subrotund or irregular in shape, slightly sunken, then developed as a dark brown to dark spot with grey-white necrotic center (Supplementary Fig. 1 a,b), and exuded an orange droplet under high humidity conditions (Supplementary Fig. 1 c). Symptomatic leaf tissues were cut into small pieces (5 x 5 mm) from the junction of necrotic and healthy tissues, and small pieces were disinfected in 75% ethanol solution for 30 s and 0.1% mercury dichloride for 30 sec, then rinsed with sterile water 3 times. These tissues were plated onto potato dextrose agar (PDA) medium and incubated in a thermostatic incubator at 28°C under natural sunlight conditions. Four isolates with similar morphological features were obtained after purification. Colonies of these isolates exhibited creme-orange margins and aerial mycelium was sparse. The colonies formed concentric circles on the surface that were fusco-black, violet-slate and vinaceus-grey (from centre to edge), fusco-black on the reverse after 7 days (Supplementary Fig. 2 a,b), and then the pycnidia and conidia produced for about 30 days (Supplementary Fig. 2 c). Pycnidia of representative isolate YTH-12 were black, subglobose, and unilocular, 95.60-168.27 μm (average 128.32 µm) (n = 40) in diameter. The ostiole was single and central, slightly papillate to papillate and occasionally rostrate (Supplementary Fig. 2 d). Conidia were hyaline, oval to elliptical, aseptate, 2.30 to 5.83 × 1.42 to 3.50 µm (average, 4.36 × 2.03 µm) (n = 50) (Supplementary Fig. 2 e). These morphological characters are consistent with those described for Stagonosporopsis vannaccii (Crous et al. 2019). To further identify the isolate YTH-12, the rDNA internal transcribed spacer (ITS) region, 28s large subunit ribosomal RNA (LSU), RNA polymerase II second largest subunit (RPB2) gene and β-tubulin (TUB2) gene were amplified by polymerase chain reaction using the primer pairs ITS1/ITS4 (White et al. 1990), LR0R (Rehner and Samuels 1994)/LR7 (Vilgalys and Hester 1990), Btub2Fd/Btub4Rd (Woudenberg et al. 2009) and RPB2-5F2 (Sung et al. 2007)/fRPB2-7cR (Liu et al. 1999), respectively. The PCR products were purified and sequenced by Sangon Biotech Co. Ltd. (Shanghai, China). The sequences were deposited in GenBank (accession nos. MN892355, MN893911, MN905510 and MN905511). The ITS (522 bp), LSU (1313 bp), TUB2 (380 bp) and RPB2 (1193 bp) nucleotide sequences showed 100% identity to S. vannaccii strain LFNO148 (accession nos. MK519453, MK519452, MK519454 and MN534891). Phylogenetic analysis based on the multi-locus sequences of ITS, LSU, RPB2 and TUB2 was performed in MEGA version 6.0 (Chen et al. 2015). The relative stability of the branches was evaluated by bootstrapping with 1000 replications. The isolate YTH-12 was placed in the same clade as S. vannaccii with 100% bootstrap support. Based on morphology and molecular analyses, this pathogen was identified as S. vannaccii. To satisfy Koch's postulates, the isolate YTH-12 was inoculated on leaves of C. crepidioides plants. Twenty punctured leaves and twenty unwounded leaves were inoculated with a 5-mm-diameter mycelial disc, respectively. Leaves inoculated with sterile PDA discs were used as blank controls. Plants were maintained in a growth chamber (25°C-28°C and relative humidity 80%-90%). Brown spots were observed on inoculated leaves (both punctured and unwounded) about 30 hours after inoculation and typical symptoms appeared about 55 hours after inoculation (Supplementary Fig. 1 d), and the diseased leaves produced black pycnidia and orange droplet 10 days after inoculation (Supplementary Fig. 1 e). All inoculated leaves developed symptoms similar to those on the naturally infected plants in the garden and the disease incidence reached 100%, whereas the control leaves remained symptomless (Supplementary Fig. 1 f). The same fungus was re-isolated from inoculated leaves. To our knowledge, this is the first report of S. vannaccii causing leaf spot on C. crepidioides in China. So far, Stagonosporopsis vannaccii has been reported as a plant pathogenic fungus only in Brazil, causing anthracnose symptoms on pods of soybean (Crous et al. 2019). Crassocephalum crepidioides is a widely distributed weed. If S. vannaccii has strong host specificity, it is possible to be used as a biocontrol fungus to control the weed. Conversely, if the fungus has a wider host range, C. crepidioides may act as a good bridge to spread the pathogen. This study helps to deepen the understanding of S. vannaccii and its associated plant diseases.

<p><strong><em>Urocystis piptatheri</em></strong><strong> sp. nov. (Urocystaceae), a new species of smut fungus on <em>Piptatherum laterale</em> (Poaceae) from Pakistan</strong></p>

A new species of smut fungi, Urocystis piptatheri is described from Kumrat Valley, Pakistan based on morphological characters and molecular phylogenetic analysis of nuclear ribosomal DNA comprising the internal transcribed spacer (ITS) regions along with large subunit (LSU). The new species is characterized by the large size of its spore balls, size and number of central spores, spore wall thickness, sori in leaves and by the host plant species (Piptatherum laterale). Phylogenetic analysis of nuclear ribosomal ITS and LSU nucleotide sequences confirmed the novelty of Urocystis piptatheri. A key for the identification of Urocystis species on Pipthatherum spp. is provided.

Morphological and molecular identification of Phytophthora cinnamomi Rands as causal agent of Crown and root rot in Blueberry (Vaccinium corymbosum) in Peru

La produccion de Arandanos en Peru ha tenido un rapido crecimiento en los ultimos cinco anos, pasando de no tener una superficie de mas de 3050 hectareas en la actualidad. Como resultado de este aumento, han aparecido muchos problemas patologicos de las plantas, entre ellos Phytophthora sp. provocando plantas con sintomas de marchitez, rojizo de hojas inferiores, muerte regresiva, pudricion de raices y copa de diferentes zonas de produccion del Peru. Sin embargo, no se reporta identificacion en Peru. Por ello, este estudio se realizo en la Clinica de Fitopatologia de la Universidad Nacional Agraria La Molina con el objetivo de identificar las especies de Phytophthora. causando pudricion de la corona y la raiz aislada del arandano en Peru. Se identificaron cuatro aislamientos del campo de arandanos por caracteristicas morfologicas, moleculares y patogenicas. Todos los aislamientos formaron colonias de tipo corral con hinchazon de hifas en agar PDA y V-8 y produjeron esporangios obpiriformes o elipsoidales y clamidosporas de globo. El espaciador transcrito interno (ITS) del rDNA se amplifico y secuencio con el cebador ITS1 / ITS4 para confirmar la identificacion.Todas las secuencias de nucleotidos ITS de los aislados obtenidos se enviaron al GenBank de NCBI (numero de acceso MH777152 para aislar AR-1, MH777151 para aislar AR-2, MH777150 para aislar AR-4 y MH777149 para aislar AR-3). Cada una de las secuencias mostro 100% de homologia con secuencias de referencia de P. cinnamomi en GenBank. Las pruebas de patogenicidad mostraron sintomas de enrojecimiento y coloracion amarillenta y pudricion de la raiz y la corona en Blueberry cv. Biloxi despues de 30 dias de inoculacion. Finalmente, concluyo que P. cinnamomi es la especie que causa la pudricion de la corona y la raiz en Blueberry en Peru. Hasta donde sabemos, este es el primer informe de P. cinnamomi en arandanos en Peru.

Amanita glarea, a new species in section Vaginatae from Pakistan

A new species, Amanita glarea, is described and illustrated from Pakistan. Molecular phylogenetic data derived from internal transcribed spacer (ITS) and nuclear ribosomal large subunit (LSU) regions along with morphological characters make it distinct from other currently known Amanita species. Amanita glarea is characterized by a grayish brown, slightly umbonate, pileus having universal veil remnants and striate margins, a long ringless stipe with a saccate volva bearing yellowish brown patches on the verrucose surface, inamyloid globose to subglobose basidiospores, and a filamentous pileipellis with some inflated round to elongated cells. Phylogenetic analysis of nuclear ribosomal ITS and LSU nucleotide sequences resolve A. glarea with other taxa in Amanita section Vaginatae.

Secondary structure of nrDNA Internal Transcribed Spacers as a useful tool to align highly divergent species in phylogenetic studies.

Recently, it has been suggested that internal transcribed spacer (ITS) sequences are under selective constraints to preserve their secondary structure. Here, we investigate the patterns of the ITS nucleotide and secondary structure conservation across the Passiflora L. genus to evaluate the potential use of secondary structure data as a helpful tool for the alignment in taxonomically complex genera. Considering the frequent use of ITS, this study also presents a perspective on future analyses in other plant groups. The ITS1 and ITS2 sequences presented significant differences for mean values of the lowest energy state (LES) and for number of hairpins in different Passiflora subgenera. Statistical analyses for the subgenera separately support significant differences between the LES values and the total number of secondary structures for ITS. In order to evaluate whether the LES values of ITS secondary structures were related to selective constraints, we compared these results among 120 ITS sequences from Passiflora species and 120 randomly generated sequences. These analyses indicated that Passiflora ITS sequences present characteristics of a region under selective constraint to maintain the secondary structure showing to be a promising tool to improve the alignments and identify sites with non-neutral substitutions or those correlated evolutionary steps.

FIRST REPORT OF ALTERNARIA ARBORESCENS CAUSING LEAF SPOT OF DRACAENA MARGINATA IN PAKISTAN

Dracaena marignata (family Asparagaceae) is a common ornamental plant in Pakistan on whose leaves circular brown spots were observed in March 2015 in a private garden at Lahore. For pathogen isolation, one spot per leaf from six symptomatic leaves were cut into pieces, surface-sterilized, inoculated in 2% malt extract agar (MEA) and incubated at 25±2oC. Morphological observations were made on 7-day-old cultures grown on MEA at 25±2oC. Fungal colonies were light brown, conidia were produced in short chains, had echinulate walls, were 1-4 transversely septate and ranged from 15-40 x 812 μm. The fungus was morphologically iden- tified as Alternaria arborescens (FCBP1527) (Simmons, 2007) and this identification was confirmed by sequencing of the internal transcribed spacer (ITS) of rDNA. For this purpose, a DNA fragment of approximately 650 bp was amplified us- ing the universal primers ITS1/ITS4 and total genomic DNA as template (White et al., 1990). BLASTn results indicated that the ITS nucleotide sequence of this strain (KT072732) has 100% similarly with many other isolates of A. arborescens from GenBank (JN634832, JX241641, AF397237, KC707557, KC415812). Spores from a 7-day-old culture were scratched and suspended in sterilized saline Tween 80 solution. For pathogenicity tests 105 spores were injected in stem nodes of three young plants (Farrag and Abo-Elyousr, 2011) while control plants were injected with sterilized water. Injection places were wrapped with moistened cotton. All plants were kept at 27±2oC in a greenhouse. Necrotic spots appeared on the leaves of inoculated plants only 7 days post injection. Re- isolation of the same pathogen fulfilled Koch’s postulates. To our knowledge, this is the first report of D. marginata leaf spot in A. arborescens from Pakistan.

Multiplex PCR을 이용한 4 종류 목향(木香)의 감별

Objectives : Aucklandiae Radix (Muxiang) one of important herbal medicines in oriental medicine, is defined as the dried root of Aucklandia lappa (Asteraceae). Owing to the similarities in the morphology and name, Inulae Radix (Tu-Muxiang) and Vladimiriae Radix (Chuan-Muxiang) as well as Aristolochiae Radix (Qing-Muxiang) originated from other medicinal plants are often used as substitutes and/or adulterants of Aucklandiae Radix. Therefore, a reliable authentication of these herbal medicines is necessarily for the public health and prevention of misuse. Methods : 32 samples of medicinal plants supplying Aucklandiae Radix, Inulae Radix, Vladimiriae Radix, and Aristolochiae Radix were collected in Korea and China. The ITS (Internal transcribed spacer) nucleotide sequences of samples were determined. The PCR primers to amply DNA marker of each herbal medicine were designed basing on the specific ITS regions showing differences in the sequences among medicinal plants. Results : Primer set Al R/IS F designed in this work amplified 220 bp PCR product only in samples of Aucklandiae Radix. In contrast, primer set Ih F/IS R, Vs R/IS F, and AcR F1/Ac R amplified 250 bp product, 356 bp prouct, and 516 bp product respectively to identify Inulae Radix, Vladimiriae Radix, and Aristolochiae Radix. Conclusions : The primers designed basing on the nucleotide sequences of ITS regions appearing differenced in the sequences among medicinal plants amplified the DNA markers for the identification of Aucklandiae Radix, Inulae Radix, Vladimiriae Radix, and Aristolochiae Radix. These herbal medicines were more efficiently identified by multiplex PCR method using all primers in a single PCR process.

Use of DNA sequences for Rickettsia identification in Ixodes ricinus ticks: the first detection of Rickettsia monacensis in Poland

The cosmopolitan tick Ixodes ricinus inhabiting Europe, including Poland, is a vector for many pathogens, such as various Rickettsia species, which spread to new territories. They are present mainly in the Mediterranean countries, but have also been found in Central Europe at increasing frequency. In the present study, the gltA gene, encoding citrate synthase, and an internal transcribed spacer (ITS) were employed to detect the DNA and identify the species of tick-borne pathogens of the Rickettsia genus. The presence of bacterial DNA was detected in 9.5% of the examined I. ricinus individuals. Based on the nucleotide sequences of the analysed genomic fragments, most pathogens were identified as Rickettsia helvetica, while Rickettsia monacensis was revealed in one case. We have described for the first time, to our knowledge, the occurrence of this species in Poland. Both markers employed in the experiments were successful in species identification of R. helvetica. The newly described species R. monacensis may be identified by the protein-coding gene, but the ITS nucleotide sequences proved insufficient.

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1.

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5'TCCGTAGGTGAACCTGCGG3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the "Laboratorio de Sanidad Vegetal" INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco.

Presence of a short repeat sequence in internal transcribed spacer (ITS) 1 of the rRNA gene of Sogatella furcifera (Hemiptera: Delphacidae) from geographically different populations in Asia

Nucleotide sequences of the internal transcribed spacer 1 (ITS1)–5.8S–ITS2 region of the nuclear ribosomal RNA gene were determined in the white-backed planthopper (WBPH) Sogatella furcifera (Horvath) to detect molecular variation among regional populations in Asia. We analyzed 932 sequences from 172 individuals (4–9 clones per individual) of 33 populations collected in 1987–2008 from six countries, Japan, China, Taiwan, Vietnam, Philippines, and Papua New Guinea. WBPH showed intra-individual variation in ITS1, which is mainly attributable to the frequency (0–10) of the 66-bp repeat sequence in ITS1. Among the examined clones, the sequences of 5.8S were mostly identical and those of ITS2 were similar. A single planthopper had a maximum of 6 different variants in the number of ITS1 repeats, suggesting highly varied repeat numbers in individual planthoppers. The ITS1 with four repeats was the most frequently (64%) detected. Such a repeat was not observed in two other economically important planthopper species, Nilaparvata lugens (Stal) and Laodelphax striatellus (Fallen). The ITS nucleotide sequences in the WBPH populations in Asia were genetically close and some variations in the sequences were not related to regional populations, indicating that the nucleotide sequences of the ITS region are not useful for geographical discrimination of the WBPH. This closeness seems to be caused by long distance migration and genetic exchange among populations.

First Report of Verticillium Wilt Caused by Verticillium dahliae on Coleus verschaffeltii in Italy.

Coleus verschaffeltii Lem. (synonym C. blumei Benth., Plectranthus scutellaroides (L.) R. Br., and Solenostemon scutellarioides (L.) Codd), a perennial plant belonging to the Lamiaceae family, is used as a bedding plant for public gardens. The most popular cultivars produce speckled leaves of various colors. In October 2010, severe outbreaks of a previously unknown wilt were observed in a public garden at Torino (northern Italy) on 50 8-month-old plants. Plants were sprinkle irrigated. Initial symptoms were withering of leaves starting from the collar and brown streaks in the vascular tissue of roots, crown, and stem. Subsequently, infected tissues wilted and plants became stunted. Early leaf drop was observed and plants appeared bare, keeping few leaves only at the end of stems. Infected plants did not die but they lost the original ornamental aspect. Seventy percent of the plants were affected. Stems of 10 plants were disinfected with 1% sodium hypochlorite. Cross-sections through symptomatic vascular tissues were plated on potato dextrose agar amended with 25 ppm of streptomycin sulfate. After 10 days at 20 to 23°C, a fungus was consistently recovered from 90% of stems. Irregular, black microsclerotia, 29 to 76 × 14 to 52 (average 49 × 28) μm, developed in hyaline hyphae after 15 days of growth. Hyaline, elliptical, single-celled conidia, 3.9 to 7.2 × 1.7 to 2.8 (average 5.1 × 2.2) μm, developed on verticillate conidiophores with three phialides at each node. On the basis of these morphological characteristics, the fungus was identified as Verticillium dahliae (3). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 (4) and sequenced. BLASTn analysis (1) of the 491-bp segment showed a 99% homology with the sequence of V. dahliae (Accession No. GU461634). The ITS nucleotide sequence of our isolate has been assigned the GenBank Accession No. JF704205. Pathogenicity tests were performed twice using 45-day-old plants obtained from seeds of C. verschaffeltii grown in 1-liter pots containing a 50:20:20:10 steamed mix of peat moss/pumice/pine bark/clay. Roots of 10 healthy plants were immersed in a conidial suspension (1.7 × 107 ml-1) of one culture of V. dahliae isolated from infected plants. Ten plants immersed in sterile water served as controls. Plants were maintained in a glasshouse at daily average temperatures between 20 and 28°C and relative humidity between 50 and 80%. First wilt symptoms and vascular discoloration in the roots, crown, and stems developed 20 days after inoculation. V. dahliae was consistently reisolated from infected vascular tissues of crown and stems of symptomatic plants. Noninoculated plants remained healthy. To our knowledge, this is the first report of Verticillium wilt on C. verschaffeltii in Italy. Verticillium wilt had been previously reported on S. scutellaroides in the United States (2). At this time, the economic importance of Verticillium wilt on C. verschaffeltii in Italy is limited.

Identification of Alternaria alternata as a Causal Agent for Leaf Blight in Syringa Species

While many isolates of Alternaria alternata are common saprophytes on trees and shrubs, this study clearly demonstrated that A. alternata is a primary pathogen in lilac (Syringa sp.), causing a leaf-blight that affects different Syringa species. Isolates of Alternaria sp. were collected from leaf blight samples of lilacs in the field. The internal transcribed spacer (ITS) region and morphological characterization were used to identify lilac blight pathogen. Based on 100% ITS nucleotide sequence identities to the Alternaria genus in the GenBank and morphological features, these isolates were identified as A. alternata. Disease symptoms were reproduced in lilac plants inoculated with A. alternata mycelial plugs and sprayed with a fungus-free culture filtrate, indicating that pathogenesis in lilac involves secondary metabolites or toxins. Diagnostic primers were developed to detect Alternaria sp. and A. alternata in lilac leaf blight based on ITS region and four known genes associated with pathogenesis in A. alternata: mixed-linked glucanase precursor, endopolygalacturonase, hsp70, and histone genes. The results from our study indicated A. alternata is a primary pathogen in lilac leaf blight, and these diagnostic primers can be used as a tool for the fast detection of A. alternata associated with lilac leaf blight.

First Report of Basal Stem Rot and Foliar Blight Caused by Pythium sylvaticum on Miscanthus sinensis in Illinois.

Miscanthus sinensis Anderss., a perennial grass, is native to eastern Asia. It has been widely grown as an ornamental in temperate regions of the world, including the United States, and recently has become an important component of public and private sector bioenergy feedstock Miscanthus selection programs. In August 2008, stem rot and blight was observed on M. sinensis plants in two irregular patches, ~2 to 2.5 × 1 to 1.5 m each in a trial plot that was preceded by corn, at the University of Illinois Energy Farm near Urbana, IL. At the time of the observation, most plants were dead and the wilted tillers had black, soft rotted basal stems. A few plants were stunted and the crowns of the tillers had black-to-brown soft rot. Some tillers' leaves were dead and others had turned light brown. Sample tissue fragments were surface disinfested in 0.5% NaOCl and plated on 1% water agar (WA). After 3 days of incubation in the dark at 23°C, colonies were transferred to corn meal agar (CMA), potato dextrose agar (PDA), or 10% V8 juice agar and incubated at 23°C under continuous white light for up to 2 weeks. Morphological characteristics of the isolates correspond to those originally described for Pythium sylvaticum W.A. Campb. & J.W. Hendrix (1). The mycelia grew and covered the 10-cm-diameter plates within 5 days. On PDA, the culture was a creamy white mycelial mat of coenocytic hyphae. The isolates produced only globose, terminal or intercalary hyphal swellings ranging from 28 to 48 μm in diameter, but no oogonia were produced on any of the three growth media. No zoospores were produced when agar blocks bearing mycelium were flooded with distilled water or 1% soil water. Sequence analysis was performed with the internal transcribed spacer (ITS) region of the rDNA amplified with primer pair ITS1/ITS4 (3) and the mitochondrially encoded cytochrome c oxydase subunit II (cox II) gene using primers FM58/FM66 (2). The resulting 871-bp ITS nucleotide sequence (Accession No. HM991706) was identical among all three isolates analyzed and 99% identical (100% coverage) to ITS sequences of multiple isolates of P. sylvaticum in GenBank. Likewise, the 544-bp cox II sequence (Accession No. HQ454429) was 99% identical (97% coverage) to cox II sequences of multiple isolates of P. sylvaticum. Six pots of M. sinensis seedlings were inoculated by placing two CMA plugs of a 2-week-old culture of isolate F71 at the crown. The control pots were mock inoculated with sterile CMA plugs. The plants were incubated at ~90% relative humidity (RH) and 25°C day and 22°C night for 3 days, and thereafter left on the greenhouse bench at ~65% RH with alternating 9 h of darkness and 15 h of light. Three weeks after inoculation, two of the inoculated seedlings wilted, others were stunted with leaves wilting from the tip downwards and the stems rotting from the crown upward. A thick mat of mycelia was seen on the rotted basal stems. No symptoms were observed in the control. P. sylvaticum was reisolated from both the rotted basal stems and the wilted foliage. To our knowledge, this is the first report of P. sylvaticum on M. sinensis. Infestation of farm soils with P. sylvaticum could limit M. sinensis biomass production significantly by limiting seedling establishment.

Diversity of thermophilic fungi in Tengchong Rehai national park revealed by ITS nucleotide sequence analyses

The geothermal sites near neutral and alkalescent thermal springs in Tengchong Rehai National Park were examined through cultivation-dependent approach to determine the diversity of thermophilic fungi in these environments. Here, we collected soils samples in this area, plated on agar media conducive for fungal growth, obtained pure cultures, and then employed the method of internal transcribed spacer (ITS) sequencing combined with morphological analysis for identification of thermophilic fungi to the species level. In total, 102 strains were isolated and identified as Rhizomucor miehei, Chaetomium sp., Talaromyces thermophilus, Talaromyces byssochlamydoides, Thermoascus aurantiacus Miehe var. levisporus, Thermomyces lanuginosus, Scytalidium thermophilum, Malbranchea flava, Myceliophthora sp. 1, Myceliophthora sp. 2, Myceliophthora sp. 3, and Coprinopsis sp. Two species, T. lanuginosus and S. thermophilum were the dominant species, representing 34.78% and 28.26% of the sample, respectively. Our results indicated a greater diversity of thermophilic fungi in neutral and alkaline geothermal sites than acidic sites around hot springs reported in previous studies. Most of our strains thrived at alkaline growth conditions.

Phylogeny of γ-proteobacteria inferred from comparisons of 3’ end 16S rRNA gene and 5’ end 16S-23S ITS nucleotide sequences

The phylogeny of γ-proteobacteria was inferred from nucleotide sequence comparisons of a short 232 nucleotide sequence marker. A total of 64 γ-proteobacterial strains from 13 Orders, 22 families, 40 genera and 59 species were analyzed. The short 232 nucleotide sequence marker used here was a combination of a 157 nucleotide sequence at the 3’ end of the 16S rRNA gene and a 75 nucleotide sequence at the 5’ end of the 16S-23S Internal Transcribed Spacer (ITS) sequence. Comparative analyses of the 3’ end of the 16S rRNA gene nucleotide sequence showed that the last 157 bp were conserved among strains from same species and less conserved in more distantly related species. This 157 bp sequence was selected as the first part in the construction of our nucleotide sequence marker. A bootstrapped neighbor-joining tree based on the alignment of this 157 bp was constructed. This 157 bp could distinguish γ-proteobacterial species from different genera from same family. Closely related species could not be distinguished. Next, an alignment of the 16S-23S ITS nucleotide sequences of alleles from same bacterial strain was performed. The first 75 bp at the 5’ end of the 16S-23S ITS was highly conserved at the intra-strain level. It was selected as the second part in the construction of our nucleotide sequence marker. Finally, a bootstrapped neighbor-joining tree based on the alignment of this 232 bp sequence was constructed. Based on the topology of the neighbour-joining tree, four major Groups, Group I to IV, were revealed with several sub-groups and clusters. Our results, based on the 232 bp sequence were, in general, in agreement with the phylogeny of γ-proteobacteria based on the 16S rRNA gene. The use of this 232 bp sequence as a phylogenetic marker presents several advantages over the use of the entire 16S rRNA gene or the generation of extensive phenotypic and genotypic data in phylogenetic analyses. First, this marker is not allele-dependant. Second, this 232 bp marker contains 157 bp from the 3’ end of the 16S rRNA gene and 75 bp from the 5’ end of the 16S-23S ITS. The 157 bp allows discrimination among distantly related species. Owing to its higher rate of nucleotide substitutions, the 75 bp adds discriminating power among closely related species from same genus and closely related genera from same family. Because of its higher percentage of nucleotide sequence divergence than the 16S rRNA gene, the 232 bp marker can better discriminate among closely related γ-proteobacterial species. Third, the method is simple, rapid, suited to large screening programs and easily accessible to most laboratories. Fourth, this marker can also reveal γ-proteobacterial species which may appear misassigned and for which additional characterization appear warranted.

Phylogeny of the Order Bacillales inferred from 3’ 16S rDNA and 5’ 16S-23S ITS nucleotide sequences

A short 220 bp sequence was used to study the taxonomic organization of the bacterial Order Bacillales. The nucleotide sequences of the 3’ end of the 16S rDNA and the 16S-23S Internal transcribed spacer (ITS) were determined for 32 Bacillales species and strains. The data for 40 additional Bacillales species and strains were retrieved directly from Genbank. Together, these 72 Bacillales species and strains encompassed eight families and 21 genera. The 220 bp se- quence used here covers a conserved 150 bp sequence located at the 3’ end of the 16S rDNA and a conserved 70 bp sequence located at the 5’ end of the 16S-23S ITS. A neighbor-joining phylogenetic tree was inferred from comparative analyses of all 72 nucleotide sequences. Eight major Groups were revealed. Each Group was sub-divided into sub-groups and branches. In general, the neighbor-joining tree presented here is in agreement with the currently accepted phylogeny of the Order Bacillales based on phenotypic and genotypic data. The use of this 220 bp sequence for phylogenetic analyses presents several advantages over the use of the entire 16S rRNA genes or the generation of extensive phenotypic and genotypic data. This 220 bp sequence contains 150 bp at the 3’ end of the 16S rDNA which allows discrimination among distantly related species and 70 bp at the 5’ end of the 16S-23S ITS which, owing to its higher percentage of nucleotide sequence divergence, adds discriminating power among closely related species from same genus and closely related genera from same family. The method is simple, rapid, suited to large screening programs and easily accessible to most laboratories.