Insect DNA Research Articles

Camelpox Virus in Western Kazakhstan: Assessment of the Role of Local Fauna as Reservoirs of Infection.

This article investigates the role of local fauna in Western Kazakhstan as potential reservoirs of the camelpox virus (CMLV). The study emphasizes analyzing possible sources and transmission pathways of the virus using polymerase chain reaction (PCR) and serological methods, including virus neutralization tests and enzyme-linked immunosorbent assays (ELISA). Samples were collected from both young and adult camels, as well as rodents, ticks and blood-sucking insects in the Mangystau and Atyrau regions. The PCR results revealed the absence of viral DNA in rodents, ticks and blood-sucking insects; also, the ELISA test did not detect specific antibodies in rodents. These findings suggest that these groups of fauna likely do not play a significant role in the maintenance and spread of CMLV. Consequently, the primary sources of transmission are likely other factors, potentially including the camels themselves. The study's results indicate the need to reassess current hypotheses regarding infection reservoirs and to explore alternative sources to enhance strategies for the control and prevention of the camelpox virus.

Effect of temperature and humidity on insect DNA integrity evaluated by real-time PCR.

Insects collected in dry traps can degrade rapidly, especially in warm, humid environments where many biodiversity and biosecurity surveillance activities are undertaken. Degradation can severely impact diagnostics, as trap catches can become difficult to identify to species level using morphological characters or, of increasing importance, molecular approaches. This is especially problematic for biosecurity surveillance of exotic tephritid fruit flies, where diagnostics are heavily reliant on morphological characters. We tested the effects of differing temperature and humidity conditions on mock samples of tephritid fruit flies in a controlled environment and compared our results to field trap catches. DNA degradation was quantified using real-time PCR assays, including one assay newly developed and tested here. We observed a correlation between increasing DNA degradation and increasing temperature and humidity. The greatest DNA degradation occurred under combined high humidity (90% relative humidity) and constant high temperature (35 °C). Unexpectedly, fluctuating temperature did not have a significant impact on DNA. Other factors, such as trap design, time in the field, and rainfall, did not significantly correlate with DNA quality across the field samples tested. When plotted against mock samples, field samples clustered together, with no clear pattern or predictability regarding the quantity of DNA preserved, indicating other untested environmental variables may be at play. Predictably, increased exposure time was found to have a detrimental effect on DNA quality for all treatments. These findings will improve the delivery of surveillance activities through the implementation of shorter trap clearance timeframes and improved trap designs and procedures.

CRISPR/Cas9-mediated genome editing technique to control fall armyworm (Spodoptera frugiperda) in crop plants with special reference to maize.

Fall Armyworm imposes a major risk to agricultural losses. Insecticides have historically been used to manage its infestations, but it eventually becomes resistant to them. To combat the pest, a more recent strategy based on the use of transgenic maize that expresses Bt proteins such as Cry1F from the bacteria has been used. Nonetheless, there have been numerous reports of Cry1F maize resistance in FAW populations. Nowadays, the more effective and less time-consuming genome editing method known as CRISPR/Cas9 technology has gradually supplanted these various breeding techniques. This method successfully edits the genomes of various insects, including Spodoptera frugiperda. On the other hand, this new technique can change an insect's DNA to overcome its tolerance to specific insecticides or to generate a gene drive. The production of plant cultivars resistant to fall armyworms holds great potential for the sustainable management of this pest, given the swift advancement of CRISPR/Cas9 technology and its varied uses. Thus, this review article discussed and critically assessed the use of CRISPR/Cas9 genome-editing technology in long-term fall armyworm pest management. However, this review study focuses primarily on the mechanism of the CRISPR-Cas9 system in both crop plants and insects for FAW management.

DNA metabarcoding diet analysis in a generalist omnivore: feeding trials reveal the efficacy of extraction kits and a multi-locus approach for identifying diverse diets.

Metabarcoding-based diet analysis is a valuable tool for understanding the feeding behavior of a wide range of species. However, many studies using these methods for wild animals assume accuracy and precision without experimental evaluation with known positive control food items. Here, we conducted a feeding trial experiment with a positive control community in pasture-raised chickens and assessed the efficacy of several commonly used DNA extraction kits and primer sets. We hand-fed 22 known food items, including insects and plants, to six backyard laying hens and collected their excreta for eight h. We evaluated the efficacy of three DNA extraction kits, three primer sets for plant identification (targeting rbcL, trnL, and internal transcribed spacer 2 [ITS2]), and three primer sets for arthropod identification (targeting cytochrome oxidase subunit I [COI]). The detection success rate of our positive control food items was highly variable, ranging from 2.04% to 93.88% for all kit/primer combinations and averaging 37.35% and 43.57% for the most effective kit/primer combination for plants and insects, respectively. Extraction kits using bead-based homogenization positively affected the recovery proportion of plant and insect DNA in excreta samples. The minimum time to detect known food items was 44 min post-feeding. Two COI primer sets significantly outperformed the third, and both recovery proportion and taxonomic resolution from ITS2 were significantly higher than those from rbcL and trnL. Taken together, these results display the potential variability that can be inherently present in DNA-based diet analyses and highlight the utility of experimental feeding trials in validating such approaches, particularly for omnivores with diverse diets.

Comparison of Different DNA Isolation Protocols in Old and New Insect Samples

Insects belong to the Arthropoda phylum and are the most numerous animal group in the world, with more than 1.000.000 species. Insects ensure the sustainability of life on earth by pollinating plants, improving soil texture by decomposing organic materials, and providing nutrients to humans. DNA isolation is a necessity for performing analyses such as Sanger sequencing, DNA fingerprinting, and gene-genome analysis. Isolated insect DNA samples can be used to carry out studies such as species identification, taxonomic relations, comparison of insect-plant and –microfauna relations, revealing genomic, population, and genetic diversity, bio-geography determination, combating agricultural pests, etc. In this study, it is aimed to compare three different isolation methods in terms of time and quality for obtaining genetic material from museum samples (old) and new samples of insects. The samples used in this investigation belong to the same insect species of Cerambycidae family (Coleoptera). Samples collected at most 9-12 months ago are considered as “new specimen”, whereas “old specimens” consist samples of 7-28 years old. Three DNA isolation protocols: Phenol-Chloroform, Salting Out and DArT seq, are compared in this study. Considering quality gel images and A260/280 and A260/230 values in newly collected samples, the best results in terms of quality were obtained with the phenol-chloroform method. When A260/280 values were examined alone, DArT seq protocol appears to be the most appropriate protocol in terms of purity in both old and new insect samples. In terms of time, the Phenol-chloroform method was found to be the shortest protocol lasting for about 2 h. Accordingly, the phenol-chloroform method was deduced to be the better choice for both old and new insect samples. After concentration adjustments, the obtained DNAs can be used for the next experimental stages or stored as stock material at -20 ºC. Determining the appropriate protocol to obtain high-quality DNA in a short time is important for the continuation of the studies. Our findings are important in terms of accelerating the studies for identification and determining systematic status and especially in examining the taxonomic relationships of the insect species. Using molecular taxonomy in addition to classical taxonomy allows the identification of insects on a species basis. These types of studies will generate useful information for researchers who study insect molecular biology.

Molecular characterization of whitefly on different host plants

The objective of this work was to determine the whitefly (Bemisia tabaci Genn.) biotypes that occur in the state of Paraná. For the determination of the biotypes, whiteflies were collected in different host plants during 2016 in 21 cities of the state of Paraná, and molecular biology techniques were used for the analysis of the samples. Total insect DNA extraction was performed with Chelex® 100 resin, followed by PCR amplification of the mitochondrial cytochrome oxidase 1 (mtCOI) gene region. The PCR products were sequenced and analyzed with Mega 7.0.21 software along with the ClustalW2 site. The dendrogram of the samples generated along with the patterns of the other species showed a clustering of all the samples with those of the MEAM1 species (biotype B), being the only species found in the studied regions. The identity of the nucleotides among the whiteflies ranged from 96.94% to 100%. Biotype A was not found in regions where it was previously occurring, probably due to the MEAM 1 species. The whiteflies of the MEAM 1 species (biotype B) were found in 14 different plant species. These results are important in the current scenario of Paraná and could contribute to better efficiency in the management of this pest.

An analysis of morphological and genetic diversity of mango fruit flies in Pakistan.

Fruit flies of genus Bactrocera are important insect pests of commercially cultivated mangos in Pakistan limiting its successful production in the country. Despite the economic risk, the genetic diversity and population dynamics of this pest have remained unexplored. This study aimed to morphologically identify Bactrocera species infesting Mango in major production areas of the country and to confirm the results with insect DNA barcode techniques. Infested mango fruits from the crop of 2022, were collected from 46 locations of 11major production districts of Punjab and Sindh provinces, and first-generation flies were obtained in the laboratory. All 10,653 first generation flies were morphologically identified as two species of Bactrocera; dorsalis and zonata showing geography-based relative abundance in the two provinces; Punjab and Sindh. Morphological identification was confirmed by mitochondrial cytochrome oxidase gene subunit I (mt-COI) based DNA barcoding. Genetic analysis of mtCOI gene region of 61 selected specimens by the presence of two definite clusters and reliable intraspecific distances validated the results of morphological identification. This study by morphological identification of a large number of fruit fly specimens from the fields across Pakistan validated by insect DNA barcode reports two species of Bactrocera infesting mango in the country.

Unveiling the Genetic Symphony: Harnessing CRISPR-Cas Genome Editing for Effective Insect Pest Management.

Phytophagous insects pose a significant threat to global crop yield and food security. The need for increased agricultural output while reducing dependence on harmful synthetic insecticides necessitates the implementation of innovative methods. The utilization of CRISPR-Cas (Clustered regularly interspaced short palindromic repeats) technology to develop insect pest-resistant plants is believed to be a highly effective approach in reducing production expenses and enhancing the profitability of farms. Insect genome research provides vital insights into gene functions, allowing for a better knowledge of insect biology, adaptability, and the development of targeted pest management and disease prevention measures. The CRISPR-Cas gene editing technique has the capability to modify the DNA of insects, either to trigger a gene drive or to overcome their resistance to specific insecticides. The advancements in CRISPR technology and its various applications have shown potential in developing insect-resistant varieties of plants and other strategies for effective pest management through a sustainable approach. This could have significant consequences for ensuring food security. This approach involves using genome editing to create modified insects or crop plants. The article critically analyzed and discussed the potential and challenges associated with exploring and utilizing CRISPR-Cas technology for reducing insect pest pressure in crop plants.

Technique for the identification of insect species in processed foods based on three short DNA sequences

For pest control, it is necessary to identify insect species in food. However, it is difficult to identify the insect species in processed food based on their morphological characteristics owing to deformation or fragmentation. DNA sequence-based identification is useful not only to corroborate morphological identification, but also as an alternative identification approach. Therefore, markers are required to obtain the target specific amplicons from insect DNA sequences fragmented by food processing. We developed a DNA sequence-based insect species identification technique that combined two markers in the cytochrome oxidase subunit I (COI) region and one marker in the 16S ribosomal RNA (rRNA) region, with amplicons up to 200 bp in size. The identification results from this technique were consistent with those from the morphological identification of 89% of the 38 insect samples selected from seven orders. This technique identified the insect species in insect samples recovered from model food that were heat-treated at 118 °C for 18 min.

Molecular Characterization of Pollinators in Cotton Ecosystem

DNA barcoding using cytochrome c oxidase I (mtCO1) for molecular characterization is a taxonomic method that uses a short genetic marker in an insect DNA to identify a species, including an unknown species. The coming-to-light of this identification tool is timely when we are facing perhaps the greatest rate of species loss in recent millennia. This study contributes to increasing the number of published accounts of DNA barcoding and accurately distinguishing the pollinator fauna of cotton in Punjab, India. The mtCOI region of all the samples was amplified, cloned and the nucleotide sequences were determined and analyzed. This study reveals that specimens collected in cotton belong to order Hymenoptera and Diptera. Hymenopterans include Apis dorsata, Apis florea, Xylocopa fenestrata, Sceliphron madraspatanum and Polistes wattii. Dipterns include Eristalinus quinquelineatus and Musca convexifrons.

Taxonomic identification accuracy from BOLD and GenBank databases using over a thousand insect DNA barcodes from Colombia.

Recent declines of insect populations at high rates have resulted in the need to develop a quick method to determine their diversity and to process massive data for the identification of species of highly diverse groups. A short sequence of DNA from COI is widely used for insect identification by comparing it against sequences of known species. Repositories of sequences are available online with tools that facilitate matching of the sequences of interest to a known individual. However, the performance of these tools can differ. Here we aim to assess the accuracy in identification of insect taxonomic categories from two repositories, BOLD Systems and GenBank. This was done by comparing the sequence matches between the taxonomist identification and the suggested identification from the platforms. We used 1,160 COI sequences representing eight orders of insects from Colombia. After the comparison, we reanalyzed the results from a representative subset of the data from the subfamily Scarabaeinae (Coleoptera). Overall, BOLD systems outperformed GenBank, and the performance of both engines differed by orders and other taxonomic categories (species, genus and family). Higher rates of accurate identification were obtained at family and genus levels. The accuracy was higher in BOLD for the order Coleoptera at family level, for Coleoptera and Lepidoptera at genus and species level. Other orders performed similarly in both repositories. Moreover, the Scarabaeinae subset showed that species were correctly identified only when BOLD match percentage was above 93.4% and a total of 85% of the samples were correctly assigned to a taxonomic category. These results accentuate the great potential of the identification engines to place insects accurately into their respective taxonomic categories based on DNA barcodes and highlight the reliability of BOLD Systems for insect identification in the absence of a large reference database for a highly diverse country.

Classifying the unknown: Insect identification with deep hierarchical Bayesian learning

Abstract Classifying insect species involves a tedious process of identifying distinctive morphological insect characters by taxonomic experts. Machine learning can harness the power of computers to potentially create an accurate and efficient method for performing this task at scale, given that its analytical processing can be more sensitive to subtle physical differences in insects, which experts may not perceive. However, existing machine learning methods are designed to only classify insect samples into described species, thus failing to identify samples from undescribed species. We propose a novel deep hierarchical Bayesian model for insect classification, given the taxonomic hierarchy inherent in insects. This model can classify samples of both described and undescribed species; described samples are assigned a species while undescribed samples are assigned a genus, which is a pivotal advancement over just identifying them as outliers. We demonstrated this proof of concept on a new database containing paired insect image and DNA barcode data from four insect orders, including 1040 species, which far exceeds the number of species used in existing work. A quarter of the species were excluded from the training set to simulate undescribed species. With the proposed classification framework using combined image and DNA data in the model, species classification accuracy for described species was 96.66% and genus classification accuracy for undescribed species was 81.39%. Including both data sources in the model resulted in significant improvement over including image data only (39.11% accuracy for described species and 35.88% genus accuracy for undescribed species), and modest improvement over including DNA data only (73.39% genus accuracy for undescribed species). Unlike current machine learning methods, the proposed deep hierarchical Bayesian learning approach can simultaneously classify samples of both described and undescribed species, a functionality that could become instrumental in biodiversity monitoring across the globe. This framework can be customized for any taxonomic classification problem for which image and DNA data can be obtained, thus making it relevant for use across all biological kingdoms.

Development of a DNA Metabarcoding Method for the Identification of Insects in Food.

Insects have the potential to become an efficient and reliable food source for humans in the future and could contribute to solving problems with the current food chain. Analytical methods to verify the authenticity of foods are essential for consumer acceptance. We present a DNA metabarcoding method that enables the identification and differentiation of insects in food. The method, developed on Illumina platforms, is targeting a 200 bp mitochondrial 16S rDNA fragment, which we found to be suitable for distinguishing more than 1000 insect species. We designed a novel universal primer pair for a singleplex PCR assay. Individual DNA extracts from reference samples, DNA extracts from model foods and food products commercially available were investigated. In all of the samples investigated, the insect species were correctly identified. The developed DNA metabarcoding method has a high potential to identify and differentiate insect DNA in the context of food authentication in routine analysis.

Monitoring Yellow Mealworm (Tenebrio molitor) as a Potential Novel Allergenic Food: Effect of Food Processing and Matrix.

The consumption of insects has increased in western countries, raising concerns about their potential to induce food allergic reactions in sensitized/allergic individuals. This work intended to develop a real-time PCR approach for the detection/quantification of yellow mealworm (Tenebrio molitor) as a potential allergenic food in complex matrices. For this purpose, reference mixtures simulating the production of pork sausages and wheat biscuits containing known amounts of mealworm were used. Real-time PCR with TaqMan probe targeting the cytochrome b gene of T. molitor was able to detect up to 2 fg of insect DNA, and 1.0 and 0.1 mg/kg of mealworm flour in autoclaved sausages and baked biscuits, respectively. Generally, the method showed acceptable analytical performance parameters, confirming its suitability/applicability for a wide range of foods. However, real-time PCR data showed significant differences among food matrix and processing, highlighting the importance of using appropriate calibration models for quantitative analysis. Finally, the real-time PCR approach was successfully validated with blind mixtures and applied to commercial samples, demonstrating its efficacy and reliability in the quantification of mealworm in processed foodstuffs.

Monitoring methods for novel insect-derived food: the PCR protocol for the detection and identification of Hermetia Illucens insects based on the HEI-COI probe and primer system

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods. Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion. The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion. A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials.

The influence of storage conditions and total DNA extraction protocol on the results of molecular analysis of the European spruce bark beetle (Ips typographus L.)

One of the key steps of the molecular identification of bark beetles is obtaining a sufficient quantity of high-quality DNA extract. In this study, we investigated the influence of different storage procedures for Ips typographus (L.) specimens and various DNA extraction protocols on the quantity and quality of DNA intended for use in molecular diagnostics. Adult beetles were frozen at -20 °C, either dry or in ethanol. We tested four different protocols for DNA extraction. We compared the quantity of extracted DNA and assessed its quality with PCR and Sanger sequencing. Different storage protocols had no significant effect on the quantity of DNA extracted. However, freezing specimens in ethanol provided higher-quality DNA for molecular applications. Only two of the extraction protocols produced sequenceable amplicons, and the difference in the amount of extracted DNA between them was not significant. We propose the optimal combination of storing specimens in ethanol at -20°C and using the Nucleospin Insect DNA extraction kit from Macherey Nagel, enabling a timeefficient identification process.

A method for DNA extraction and molecular identification of Aphids

Aphid species (Insecta, Hemiptera) are economically important invasive pest throughout the world, though their identification is intricate due to tiny size and inconspicuous nature of morphology. Mitochondrial cytochrome c oxidase I (mtCOI) region has been proven to be a standard barcode to identify the diverse array of insect groups. Isolation of good quality DNA is a fundamental first step in insect DNA barcoding which is obtained by standardizing the DNA isolation method. In this study, we demonstrate a modified CTAB method for the isolation of DNA to maximize the quality and yield from small aphids. This method will help the researchers to efficiently isolate DNA from small aphid and the method can be utilized for other small insects as well. We evaluated the quality of the isolated DNA and the mtCOI gene region were subjected to PCR amplification. Further, the gene segment was sequenced and gene annotation was done by NCBI BLAST program through which the insect was found to be Aphis gossypii. This study provides a set of molecular tools that can be used for identification of insect at species level through DNA barcoding and biodiversity analysis.•Detailed method to maximize quality and quantity of genomic DNA isolated from aphids.•Molecular identification of aphids using mtCOI gene amplification and sequence validation.•First report on Aphis gossypii infecting Solanum trilobatum provides insights of pest identification and management.

Detecting Natural Wolbachia Infection and Supergroup Identification of Metochus uniguttatus in North India

Introduction: Insect endosymbionts have a crucial evolutionary and ecological role. Insects, particularly arthropods, have evolved to tolerate a wide range of endosymbionts that provide them with external biochemical, genetic, and reproductive capacities that improve their fitness. Wolbachia is a widely prevalent bacterial endosymbiont that is gaining popularity in insect research due to its utility in pest and vector management. Although India has a diverse insect population, little research has been undertaken on insect-microbe interactions. Therefore, This study aimed to ascertain the spread of Wolbachia in a randomly sampled set of insects, identify any novel Wolbachia infections, and determine the Wolbachia infection’s supergroup. Materials and methods: Field capture of insects was carried out manually with netting and gloves, and the insects were immediately stored in absolute ethanol to immobilize them. Phenol-chloroform-isoamyl alcohol was the method used to extract the insect DNA. Insect species identification was carried out via the CO1 mitochondrial gene using PCR amplification. PCR was utilized to identify the presence of Wolbachia, and 16S Wspec DNA was amplified to confirm its presence. The Sanger method was used to sequence the amplified CO1 and the positive samples for Wspec. Using NCBI blast, the sequences of the infected insects were compared with the database sequences. The obtained FASTAs were then aligned using Sequencher 5.4.6, and the chromatograms were examined to ensure contig quality and similarity. Results: Among the 21 insects screened, one was found weakly positive (Playpleura octoguttata) and two were strongly positive (Metochus uniguttatus and Velarifictorus micado) with Wolbachia, which represented an infection rate of 14.29%. Although the individual infection rate in this limited sample size falls at the lower end compared to extensive surveys reporting rates between 20% and 76%. This study indicated the dissemination of Wolbachia in randomly screened insects. Moreover, this is one of the first records of Metochus uniguttatus being infected with Wolbachia in North India. Conclusion: This study represents an initial exploration of insects not previously considered hosts of the Wolbachia endosymbiont. The results could be useful for future studies on insect biocontrol and pest management.

Molecular identification of scale insect (Eulecanium giganteum) in Hibiscus rosa-sinensis

Hibiscus rosa-sinensis is a widely grown evergreen valuable medicinal, ornamental species planted in India. Scale insects are small herbivorous insects found on all continents and they are serious sap sucking pests of many ornamental plants. These scale insects are undetectable due to their tiny size, basic morphology, and polyphagous feeding nature. Hence, the management of these tiny insects become a serious concern across the globe. To afford a prospective solution to the problem, an accurate, simple, and developmental-stage-independent identification method is required, hence this study attempted the molecular identification of scale insect in Hibiscus rosa-sinensis using mitochondrial gene Cytochrome Oxidase Subunit I (mtCOI) sequencing. The experiment was carried out by isolating insect DNA using a modified CTAB method. Through two or three rounds of error-prone PCR followed by a steady procedure to amplify a mtCOI region. This region of mtCOI has been used as a standard DNA barcode for a diverse array of taxa. The confirmation has been done by sequencing of mtCOI which suggest the highest similarities with Eulecanium giganteum. This study addresses the questions of biodiversity and molecular characterization of scale insects. Further, the information obtained in this study provides baseline data for future crop improvement programs and integrated pest management strategies.

Diet analysis of bats killed at wind turbines suggests large‐scale losses of trophic interactions

AbstractAgricultural practice has led to landscape simplification and biodiversity decline, yet recently, energy‐producing infrastructures, such as wind turbines, have been added to these simplified agroecosystems, turning them into multi‐functional energy‐agroecosystems. Here, we studied the trophic interactions of bats killed at wind turbines using a DNA metabarcoding approach to shed light on how turbine‐related bat fatalities may possibly affect local habitats. Specifically, we identified insect DNA in the stomachs of common noctule bats (Nyctalus noctula) killed by wind turbines in Germany to infer in which habitats these bats hunted. Common noctule bats consumed a wide variety of insects from different habitats, ranging from aquatic to terrestrial ecosystems (e.g., wetlands, farmland, forests, and grasslands). Agricultural and silvicultural pest insects made up about 20% of insect species consumed by the studied bats. Our study suggests that the potential damage of wind energy production goes beyond the loss of bats and the decline of bat populations. Bat fatalities at wind turbines may lead to the loss of trophic interactions and ecosystem services provided by bats, which may add to the functional simplification and impaired crop production, respectively, in multi‐functional ecosystems.