Injection Of Rose Bengal Research Articles

A novel neoadjuvant therapy for early-stage non-small cell lung cancer in a mouse model.

Lung cancer is the common malignancy with high mortality rate in the world. Even with curative resection for early-stage lung cancer patients, the rate of postoperative recurrence and metastasis is still high. Neoadjuvant nivolumab combined with chemotherapy leads to improved pathological complete response rate and event-free survival in resectable non-small cell lung cancer (NSCLC) patients. However, the neoadjuvant therapy is not only accompanied by grade 3 or above adverse events which resulting in the potential missing out on the window for curative surgery for the patients, but also has low efficacy especially in patients with low programmed death ligand 1 (PD-L1) expression. Hence, it is particularly important to explore innovative ways to inhibit tumour recurrence and metastasis. In the present study, we investigated whether neoadjuvant therapy with intralesional Rose Bengal (RB) elicited specific immune responses compared with control group, and then the lung cancer mouse model was used to evaluated the immunological mechanism. The secondary Lewis lung cancer cells (LLCs) tumour growth was significantly suppressed by RB intralesional injection into subcutaneous tumour; the formation rate of secondary tumours induced by the B16 melanoma cell injection was 100%. Intralesional RB neoadjuvant therapy before surgical resection exhibited effectively enhanced T central memory cells (Tcm) and T memory stem cells (Tscm) + naïve T cells (Tn) infiltration, elicited stronger cytotoxic T lymphocyte (CTL) responses against LLCs, and displayed markedly higher proportions of splenic lymphocytes that produce tumour necrosis factor-alpha (TNF-α) and interferon-gamma (IFN-γ) upon restimulation in a lung cancer mouse model. Based on our preclinical data, neoadjuvant therapy with intralesional RB injection generated immune memory and prevented the recurrence and metastasis of tumour in a lung cancer mouse model, which provides a new strategy for neoadjuvant treatment of early-stage NSCLC.

Cellular, histological, and behavioral pathological alterations associated with the mouse model of photothrombotic ischemic stroke

BackgroundPhotothrombotic (PT) stroke model is a reliable method to induce ischemic stroke in the target site using the excitation of photosensitive agents such as Rose Bengal (RB) dye after light illumination. Here, we performed a PT-induced brain ischemic model using a green laser and photosensitive agent RB and confirmed its efficiency through cellular, histological, and neurobehavioral approaches. MethodsMice were randomly allocated into RB; Laser irradiation; and RB + Laser irradiation groups. Mice were exposed to a green laser at a wavelength of 532 nm and intensity of 150 mW in a mouse model after injection of RB under stereotactic surgery. The pattern of Hemorrhagic and ischemic changes were evaluated throughout the study. The volume of the lesion site was calculated using unbiased stereological methods. For investigation of neurogenesis, we performed double - (BrdU/NeuN) immunofluorescence (IF) staining on day 28 following the last- BrdU injection. To assess the effect and quality of ischemic stroke on neurological behavior, the Modified neurological severity score (mNSS) test was done on days 1, 7, 14, and 28 days after stroke induction. ResultsLaser irradiation plus RB induced hemorrhagic tissue and pale ischemic changes over the 5 days. In the next few days, microscopic staining revealed neural tissue degeneration, demarcated necrotic site, and neuronal injury. BrdU staining showed a significant number of proliferating cells in the periphery of the lesion site in the Laser irradiation plus RB group compared to the group (p < 0.05) while the percent of NeuN+ cells per BrdU- positive cells was reduced. Also, prominent astrogliosis was observed in the periphery of irradiated sites on day 28. Neurological deficits were detected in mice from Laser irradiation plus the RB group. No histological or functional deficits were detected in RB and Laser irradiation groups. ConclusionsTaken together, our study showed cellular and histologic pathological changes which are associated with the PT induction model. Our findings indicated that the undesirable microenvironment and inflammatory conditions could affect neurogenesis concomitantly with functional deficits. Moreover, this research showed that this model is a focal, reproducible, noninvasive and accessible stroke model with a distinctive demarcation similar to human stroke conditions.

Modeling Stroke in Mice: Focal Cortical Lesions by Photothrombosis.

Stroke is a leading cause of death and acquired adult disability in developed countries. Despite extensive investigation for novel therapeutic strategies, there remain limited therapeutic options for stroke patients. Therefore, more research is needed for pathophysiological pathways such as post-stroke inflammation, angiogenesis, neuronal plasticity, and regeneration. Given the inability of in vitro models to reproduce the complexity of the brain, experimental stroke models are essential for the analysis and subsequent evaluation of novel drug targets for these mechanisms. In addition, detailed standardized models for all procedures are urgently needed to overcome the so-called replication crisis. As an effort within the ImmunoStroke research consortium, a standardized photothrombotic mouse model using an intraperitoneal injection of Rose Bengal and the illumination of the intact skull with a 561 nm laser is described. This model allows the performance of stroke in mice with allocation to any cortical region of the brain without invasive surgery; thus, enabling the study of stroke in various areas of the brain. In this video, the surgical methods of stroke induction in the photothrombotic model along withhistological analysis are demonstrated.

Mice Deficient in ß2-Glycoprotein I Have a Delayed Time to Thrombosis

Introduction: Antiphospholipid syndrome (APS) is an autoimmune disorder caused by "antiphospholipid" antibodies (aPL) directed in part against β2-glycoprotein I (β2GPI). Though β2GPI is proposed to have numerous anti- and procoagulant properties in vitro, its effect in vivo is not well studied. Β2GPI binds thrombin via exosite 1 and exosite 2 and impairs thrombin activity, in particular thrombin-mediated activation of FXI. Β2GPI also is found to inhibit thrombin mediated platelet aggregation and it inhibits phospholipid-dependent coagulation reactions, such as the prothrombinase and tenase complexes. β2GPI also may inhibit the activation of protein C, an effect potentiated by antiphospholipid antibodies. However, there is little direct information on β2GPI effects on thrombosis in vivo. Methods: We created β2GPI deficient mice using CRISPR-Cas9 technology. Two pairs of guide RNAs (sgRNAs) flanking upstream and downstream exons 2 and 3 on a C57BL/6J background were designed using the CRISPOR program (http://crispor.tefor.net/crispor.py). The PCR product spanning exons 2 and 3 was used to test the efficiency of SgRNA cleavage using the Guide-it Complete sgRNA Screening System. An efficient pair of sgRNAs, one upstream of exon-2 (sgRNA-UP: ATCTTTCCCTTATATGCTAG) and another downstream of exon-3 (sgRNA-DOWN: TCGAGTTAATCACGTGTAGG) were injected into the embryos of C57BL/6J mice with Cas9 protein. Founder mice were genotyped to identify mice with expected deletions in the APOH (encoding β2GPI) gene. Strong founder male mice containing mutated APOH were crossed with wild type C57BL/6J females. Male and female F1 heterozygotes were backcrossed and F2 homozygous knockouts (APOH-/-) were characterized. The Rose-Bengal carotid artery thrombosis assay was performed on 6 to 9 week old wild type and APOH-/- mice. In brief, mice were anesthetized using sodium pentobarbital intraperitoneally. Rose Bengal [isobenzofuran-1(3H)9[9H] xanthan)-3:1 dipotassium salt] was injected via tail vein at a concentration of 50 mg/kg in 0.9% saline in a 100 μl volume. Green laser light at 540 nm was applied to the carotid artery following injection of Rose Bengal. Continuous flow was monitored at the site of injury and time to occlusion was determined. Results: Genotyping of APOH-/- mice revealed complete deletion of exon 2 and 3 (1900 to 2000 bp deletion). Plasma derived from WT-mice, APOH+/- and APOH-/- mice was analyzed by immunoblotting: APOH-/- mice lacked β2GPI protein while heterozygotes had intermediate levels. APOH-/- mice appeared healthy with no obvious phenotype. Carotid artery occlusion times were compared in 5 WT and 5 APOH-/- male mice. In WT-mice, complete vessel occlusion occurred at a mean time of 19.2 +/- 3.1 min, whereas the occlusion time in APOH-/- mice was prolonged approximately 2-fold (38.6 +/- 7.1 min). The prolonged time to occlusion in APOH-/- mice was highly significant (p &lt;0.0005). Conclusion: These results indicate that APOH-/- mice have a net anticoagulant phenotype compared to WT mice, and suggest that β2GPI may have procoagulant properties in vivo. The mechanisms underlying this observation are not immediately apparent and are currently under investigation. However, given the reported effects of β2GPI on inhibition of thrombin generation and thrombin-mediated platelet activation, these findings are unexpected. Additional studies with other thrombosis models are in progress. Identification of β2GPI as a "procoagulant protein" suggests a reconsideration of its role in the pathogenesis of antiphospholipid syndrome. Disclosures McCrae: Sanofi Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees; Pfizer Pharmaceutical: Membership on an entity's Board of Directors or advisory committees; Rigel Pharmaceutical: Membership on an entity's Board of Directors or advisory committees; Dova Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees.

Development of a Novel Model of Central Retinal Vascular Occlusion and the Therapeutic Potential of the Adrenomedullin–Receptor Activity–Modifying Protein 2 System

Central retinal vein occlusion (CRVO) is an intractable disease that causes visual acuity loss with retinal ischemia, hemorrhage, and edema. In this study, we developed an experimental CRVO model in mice and evaluated the therapeutic potential of the pleiotropic peptide adrenomedullin (ADM) and its receptor activity-modifying protein 2 (RAMP2). The CRVO model, which had phenotypes resembling those seen in the clinic, was produced by combining i.p. injection of Rose bengal, a photoactivator dye enhancing thrombus formation, with laser photocoagulation. Retinal vascular area, analyzed using fluorescein angiography and fluorescein isothiocyanate-perfused retinal flat mounts, was decreased after induction of CRVO but gradually recovered from day 1 to 7. Measurements of retinal thickness using optical coherence tomography and histology revealed prominent edema early after CRVO, followed by gradual atrophy. Reperfusion after CRVO was diminished in Adm and Ramp2 knockout (KO) mice but was increased by exogenous ADM administration. CRVO also increased expression of a coagulation factor, oxidative stress markers, and a leukocyte adhesion molecule in both wild-type and Adm KO mice, and the effect was more pronounced in Adm KO mice. Using retinal capillary endothelial cells, ADM was found to directly suppress retinal endothelial injury. The retinoprotective effects of the Adm-Ramp2 system make it a novel therapeutic target for the treatment of CRVO.

Aldosterone Exposure Causes Increased Retinal Edema and Severe Retinopathy Following Laser-Induced Retinal Vein Occlusion in Mice.

To determine the effects of aldosterone exposure on retinal edema and retinopathy in a mouse model of retinal vein occlusion (RVO). RVO was induced immediately following intravenous injection of Rose bengal (66 mg/kg) using a 532-nm wavelength laser to place three to seven applications at 80 mW and 50-μm spot size directed at the superior retinal vein one disc diameter away from the nerve. Negative control consisted of placing an equal number of laser spots without targeting the vein. Male and female C57BL/6J mice aged 7 to 9 months with confirmed absence of Crb1rd8 were used. Aldosterone pellets releasing a daily dose of 0.83 μg/day were implanted subcutaneously 4 weeks prior to RVO. Retinal imaging by optical coherence tomography (OCT) was performed using a Micron IV rodent imaging system. Retinas were analyzed by immunohistochemistry using standard techniques. Retinal imaging and tissue analysis were performed 2, 4, and 7 days following RVO. Comparisons were made using Student's t-test, ANOVA, and Pearson's χ2. RVO caused retinal edema in the form of cystic spaces and retinal thickening detectable by both OCT and histology. RVO also caused Müller glia (MG) dysfunction manifest as upregulated glial fibrillary acidic protein (GFAP) and altered localization of aquaporin 4 (AQP4) and Kir4.1. Treatment with aldosterone caused a significant increase in retinal edema and more severe retinopathy manifest as retinal whitening and extensive intraretinal hemorrhage. MG dysfunction was more severe and persistent in aldosterone-treated mice. Finally, aldosterone greatly increased the number of infiltrating mononuclear phagocytes following RVO. Systemic aldosterone exposure causes a more severe RVO phenotype manifest as increased severity and duration of retinal edema and more severe retinopathy. The effects of aldosterone may be mediated by MG dysfunction and increased infiltration of mononuclear phagocytes. This suggests that small increases in aldosterone levels may be a risk factor for severe RVO.

Protective Effects of Brain Infarction by N-Acetylcysteine Derivatives.

We recently found that acrolein (CH2=CH-CHO) is more strongly involved in brain infarction compared with reactive oxygen species. In this study, we looked for acrolein scavengers with less side effects. Photochemically induced thrombosis model mice were prepared by injection of Rose Bengal. Effects of N-acetylcysteine (NAC) derivatives on brain infarction were evaluated using the public domain National Institutes of Health image program. NAC, NAC ethyl ester, and NAC benzyl ester (150 mg/kg) were administered intraperitoneally at the time of induction of ischemia, or these NAC derivatives (50 mg/kg) were administered 3× at 24-h intervals before induction of ischemia and 1 more administration at the time of induction of ischemia. The size of brain infarction decreased in the order NAC benzyl ester>NAC ethyl ester>NAC in both experimental conditions. Detoxification of acrolein occurred through conjugation of acrolein with glutathione, which was catalyzed by glutathione S-transferases, rather than direct conjugation between acrolein and NAC derivatives. The level of glutathione S-transferases at the locus of brain infarction was in the order of administration of NAC benzyl ester>NAC ethyl ester>NAC>no NAC derivatives, suggesting that NAC derivatives stabilize glutathione S-transferases. The results indicate that detoxification of acrolein by NAC derivatives is caused through glutathione conjugation with acrolein catalyzed by glutathione S-transferases, which can be stabilized by NAC derivatives. This is a new concept of acrolein detoxification by NAC derivatives.

T cell mediated immunity after combination therapy with intralesional PV-10 and blockade of the PD-1/PD-L1 pathway in a murine melanoma model.

Intralesional (IL) injection of Rose Bengal (PV-10) induces regression of injected and uninjected lesions in several murine tumor models. In this study, we investigated the anti-tumor response of combining IL PV-10 with blockade of the PD-1 / PD-L1 pathway and the role of immune cell populations in eliciting this response. To investigate the role of T cell subsets in mediating an immune response, B16 or M05 melanoma-bearing mice received combination therapy as well as CD8+, CD4+, or CD25+ depleting antibodies. Tumor growth was measured. T cells were collected from spleens or tumors, and phenotype, activation markers, and reactivity were measured. Splenocytes from mice treated with combination therapy had increased OVA antigen-specific CD8+ T cells in M05-tumor-bearing mice. Depletion of CD4+ T cells or regulatory T cells (Tregs) in combination with IL PV-10 and anti-PD-1 antibody treatment resulted in an enhanced anti-tumor effect. Treatment with CD8+ depleting antibody abrogated anti-tumor immunity. These results support a clinical study for the safety and anti-tumor immune responses with combination therapy of IL PV-10 and PD-1/PD-L1 blockade.

Focal Ischaemic Infarcts Expand Faster in Cerebellar Cortex than Cerebral Cortex in a Mouse Photothrombotic Stroke Model.

It is generally accepted that the cerebellum is particularly vulnerable to ischaemic injury, and this may contribute to the high mortality arising from posterior circulation strokes. However, this has not been systematically examined in an animal model. This study compared the development and resolution of matched photothrombotic microvascular infarcts in the cerebellar and cerebral cortices in adult 129/SvEv mice of both sexes. The photothrombotic lesions were made using tail vein injection of Rose Bengal with a 532nm laser projected onto a 2mm diameter aperture over the target region of the brain (with skull thinning). Infarct size was then imaged histologically following 2h to 30-day survival using serial reconstruction of haematoxylin and eosin stained cryosections. This was complemented with immunohistochemistry for neuron and glial markers. At 2h post-injury, the cerebellar infarct volume averaged ~ 2.7 times that of the cerebral cortex infarcts. Infarct volume reached maximum in the cerebellum in a quarter of the time (24h) taken in the cerebral cortex (4days). Remodelling resolved the infarcts within a month, leaving significantly larger residual injury volume in the cerebellum. The death of neurons in the core lesion at 2h was confirmed by NeuN and Calbindin immunofluorescence, alongside activation of astrocytes and microglia. The latter persisted in the region within and surrounding the residual infarct at 30days. This comparison of acute focal ischaemic injuries in cerebellar and cerebral cortices provides direct confirmation of exacerbation of neuropathology and faster kinetics in the cerebellum.

Establishment and assessment of a rat model of nonarteritic anterior ischemic optic neuropathy

Objective To establish and evaluate a rat model of nonarteritic anterior ischemic optic neuropathy (NAION). Methods The rats were randomly divided into control group (n=13), sham laser group (n=11) and NAION group (n=23). The right eye was set as the experimental eye. NAION model was induced by directly illuminating the optic nerve (ON) of the right eye with 532 nm green laser, after intravenous infusion with the photosensitizing agent Rose Bengal. Sham laser treatment consisted of illuminating the ON region with 532 nm laser without Rose Bengal injection. Rats in control group underwent no intervention. The appearance of optic disc was observed with funduscope at 12 hours, 1, 3, 7, 28 days post-illumination. The histologic changes in the retina and ON of the NAION model were evaluated qualitatively with hematoxylin and eosin (HE) staining and transmission electron microscopy. The retrograde-labeled retinal ganglion cells (RGC) were counted on photographs taken from retinal flat mounts in a masked fashion. Results The optic disc in NAION eyes were swollen 3 days after photodynamic treatment. HE-stained longitudinal ON sections of NAION revealed vacuolar degeneration on day 3 after induction. Besides, ultrastructural study showed axonal edema and collapsed sheaths in the ischemic optic nerve at the same time point after modeling. ON edema resolved 7 days after induction. The final results revealed optic disc atrophy, extensive axonal loss, severe glial scar, and RGC death in large numbers 4 weeks after modeling. There were no aforementioned manifestations in control and sham laser group. The RGC density of the right eyes was statistically significantly lower in NAION group than that in control group and in sham laser group (t=−14.142, −14.088; P=0.000, 0.000). The survival rate of RGC was statistically significantly lower in NAION group than in control group and in sham laser group (t=−17.048, −16.667; P=0.000, 0.000). There was no difference of RGC density and survival rate of RGC between control and sham laser group (t=0.050, 0.348; P=0.961, 0.731). Conclusion A rat model of NAION was established successfully by photodynamic treatments with Rose Bengal, which induce optic nerve damage and RGC death. Key words: Optic neuropathy, ischemic; Retinal ganglion cells; Disease models, animal

Photocoagulation of the Retinal Nonperfusion Area Prevents the Expression of the Vascular Endothelial Growth Factor in an Animal Model

The purpose of this study was to evaluate whether photocoagulation of the retinal nonperfusion area suppresses ocular vascular endothelial growth factor (VEGF) expression in a rabbit retinal vein occlusion (RVO) model. The retinas of pigmented rabbits were made ischemic by a laser on the main branch of retinal veins following intravenous injection of Rose Bengal. The eyes were enucleated before treatment and at 1, 7, and 14 days after laser occlusion. VEGF protein levels in the vitreous humor, sensory retina, and retinal pigment epithelium-choroid were measured with enzyme-linked immunosorbent assay. In situ hybridization of VEGF messenger RNA was performed to detect the location of VEGF expression in the sensory retina. In the vitreous body, the VEGF protein level in the RVO group, but not that in the RVO + panretinal photocoagulation group, significantly increased on day 14. In the retina, the VEGF protein level in the RVO + panretinal photocoagulation group was significantly higher than that in the RVO group on day 1, but was significantly lower than that in the RVO group on days 7 and 14. In the in situ hybridization analysis, the RVO group showed a high expression of VEGF in the inner nuclear and ganglion cell layers on days 7 and 14. In contrast, VEGF expression in the RVO + panretinal photocoagulation group was strongly suppressed in both the inner nuclear and ganglion cell layers on days 7 and 14. This study is the first using an animal RVO model to demonstrate that laser photocoagulation of the retinal nonperfusion area suppresses VEGF-A expression in the retina.

The influence of Notrombel on the process of photoinduced thrombogenesis

Objectives. Our objectives were to study the effect of Notrombel administration (one of the representatives of a new class of compounds, N, N'-substituted piperazines) on the development of experimental thrombosis. Material and methods. Thrombosis of the femoral artery was induced in Wistar male rats by 30-minute laser irradiation (532 nm, 60 mW, irradiation area - 1 mm 2 ) after intravenous injection of Rose Bengal A (17 mg/kg). The blood flow was recorded by high-frequency ultrasonic dopplerography (20 MHz) before irradiation and every 10 minutes after irradiation. Notrombel and Acetylsalicylic Acid (ASA) were administered intravenously (control - 0.9 % sodium chloride) and intragastrically (control - water) in increasing doses. Results. Thrombosis of the femoral artery developed in all control animals during 30-minute laser irradiation. With a single intravenous administration, Notrombel was more effective than ASA (100 % prevention of thrombosis at doses of 0.0045 mM/kg and 0.05 mM/kg, respectively). The calculated effective dose (ED50) for Notrombel was about 0.0021 mM/kg, and for ASA - 0.029 mM/kg. After seven intravenous administrations of Notrombel, no cumulative effect was observed (a single dose ED50 = 0.0021 mM/kg), in contrast to ASA (ED50 = 0.0032 mM/kg). After seven intragastric injections, the antithrombotic activity of the drugs was close (for Notrombel ED50 = 0.0049 mM/kg, for ASA 0.0041 mM/kg). Conclusions. With a single intravenous injection, the antithrombotic activity of Notrombel (ED50 = 0.0021 mM/kg) is higher than that of ASA (ED50 = 0.029 mM/kg). With the course of intragastric and intravenous administration, the effects of the drugs are comparable. Unlike ASA, Notrombel had no cumulative effect, which indicates the safety of repeated parenteral administrations of the drug.

Focal induction of ROS-release to trigger local vascular degeneration.

Reactive oxygen species (ROS) play an important role in the process of cardiovascular degeneration. We evaluated the potential of a controlled, local induction of ROS-release by application of rose bengal (RB) and photo energy to induce atherosclerosis-like focal vascular degeneration in vivo. After injection of RB, rats fed with a pro-degenerative diet underwent focal irradiation of the abdominal aorta by a green laser (ROS group), while the controls received irradiation without RB. Aortic tissue was analyzed by histology and immunohistochemistry at 0, 2, 4, 8, 28 and 56 days (n = 5). The intimal surface topography was analyzed by scanning electron microscopy. In the ROS group, an initial thrombus formation had disappeared by day 8. Similarly, ROS-derived products displayed the highest concentrations at day 0. Relative matrix metalloproteinase (MMP) activity achieved a maximum after 8 days (ROS group vs. control group: 1.60 ± 0.11 vs. 0.98 ± 0.01; p < 0.001). After 28 days, no significant differences in any aspect were found between the ROS group and the controls. However, after 56 days, the aortic tissue of ROS animals exhibited relative media-pronounced thickening (ROS vs. control: 2.15 ± 0.19 vs. 0.87 ± 0.10; p < 0.001) with focal calcification and reduced expression of alpha smooth muscle actin (aSMA). The ROS-releasing application of RB and photo energy allowed for the induction of vascular degeneration in a rodent model. This protocol may be used for the focal induction of vascular disease without systemic side effects and can thereby elucidate the role of ROS in the multifactorial processes of vessel degeneration and atherogenesis.

A pharmacological approach in newly established retinal vein occlusion model

The mechanism underlying the effects of anti-vascular endothelial growth factor (VEGF) antibody in retinal vein occlusion (RVO) treatment is poorly understood, partly due to the lack of RVO animal models that mimic clinical pathology. The aims of this study were to establish a suitable RVO model, clarify the pathogenic mechanisms, and evaluate the effects of anti-VEGF antibody in the model. Mouse retinal veins were occluded by laser photocoagulation after rose bengal injection. Reduction of the b/a wave amplitude ratio, retinal nonperfusion, cystoid edema, and hard exudates were observed after occlusion, and expression of RVO-related genes was altered. Administration of anti-VEGF antibody immediately, or 7 days, after occlusion resulted in reduction and increase of the nonperfused area, respectively. We conclude that the present model will be useful for clarification of the pathogenic mechanisms, and that the timing of anti-VEGF antibody administration is important for the successful amelioration of retinal nonperfusion.

Intralesional rose bengal in melanoma elicits tumor immunity via activation of dendritic cells by the release of high mobility group box 1.

Intralesional (IL) therapy is under investigation to treat dermal and subcutaneous metastatic cancer. Rose bengal (RB) is a staining agent that was originally used by ophthalmologists and in liver function studies. IL injection of RB has been shown to induce regression of injected and uninjected tumors in murine models and clinical trials. In this study, we have shown a mechanism of tumor-specific immune response induced by IL RB. In melanoma-bearing mice, IL RB induced regression of injected tumor and inhibited the growth of bystander lesions mediated by CD8+ T cells. IL RB resulted in necrosis of tumor cells and the release of High Mobility Group Box 1 (HMGB1), with increased dendritic cell (DC) infiltration into draining lymph nodes and the activation of tumor-specific T cells. Treatment of DC with tumor supernatants increased the ability of DCs to stimulate T cell proliferation, and blockade of HMGB1 in the supernatants suppressed DC activity. Additionally, increased HMGB1 levels were measured in the sera of melanoma patients treated with IL RB. These results support the role of IL RB to activate dendritic cells at the site of tumor necrosis for the induction of a systemic anti-tumor immune response.

Precise Characterization of the Penumbra Revealed by MRI: A Modified Photothrombotic Stroke Model Study.

AimsTo precisely characterize the penumbra by MRI based on a modified photothrombotic stroke mouse model.MethodsThe proximal middle cerebral artery was occluded by a convenient laser system in conjunction with an intravenous injection of Rose Bengal in mice. And the suture MCAO model was performed in seven mice as a comparison of the reproducibility. One hour after occlusion, the penumbra was defined in six random photothrombotic stroke mice by mismatch between perfusion-weighted imaging and the apparent diffusion coefficient map on a home-made workstation. After imaging, three random mice of them were chosen to perform the reperfusion surgery. And the other three mice were sacrificed to stain for several potential penumbra markers, such as c-fos and heart shock protein 90. In the remaining mice, the evolution of the lesions was detected on the apparent diffusion coefficient map, diffusion-weighted imaging and T2-weighted imaging at 1, 3, 6, 12 and 24 hours. After evaluating the neurological deficit scores, the brains were sectioned and stained by triphenyltetrazolium chloride and Nissl.ResultsThe mice subjected to photothrombosis showed significant behavioral deficits. One hour after occlusion, the low perfusion areas on the perfusion-weighted imaging interlaced with the hypointense areas on the apparent diffusion coefficient map, demonstrating that the penumbra was located both surrounding and inside the lesions. This phenomenon was subsequently confirmed by the c-fos and heart shock protein 90 staining. The final T2-weighted images of the mice subjected to the reperfusion surgery were also consistent with the penumbra images at one hour. At early stages, the lesions were clearly identified on the apparent diffusion coefficient map; the volumes of the lesions on the diffusion-weighted imaging and T2-weighted imaging did not reach a maximum until 12 hours. The coefficient of variation (CV) of the final lesions in the photothrombotic stroke mice was 21.7% (0.08 of 0.37) on T2-weighted imaging and 27.8% (0.10 of 0.35) on triphenyltetrazolium chloride, representing a high reproducibility (n = 7). While the CV of the lesions in the MCAO stroke mice was only 70% (0.24 of 0.34, n = 4).ConclusionsThis study has provided a precise imaging definition of the penumbra based on a reproducible photothrombotic stroke mouse model.

Toxic acrolein production due to Ca2+ influx by the NMDA receptor during stroke

Background and purposeN-Methyl-d-aspartate (NMDA) receptors have a high permeability to Ca2+, contributing to neuronal cell death after stroke. We recently found that acrolein produced from polyamines is a major toxic compound during stroke. Thus, it was determined whether over-accumulation of Ca2+ increases the production of acrolein from polyamines in a photochemically-induced thrombosis mouse model of stroke and in cell culture systems. MethodsA unilateral infarction was induced in mouse brain by photoinduction after injection of Rose Bengal. The volume of the infarction was analyzed using the public domain National Institutes of Health image program. Protein-conjugated acrolein levels at the locus of infarction and in cells were measured by Western blotting. Levels of polyamines were measured by high-performance liquid chromatography. ResultsWhen the size of brain infarction was decreased by N1, N4, N8-tribenzylspermidine, a channel blocker of the NMDA receptors, levels of Ca2+ and protein-conjugated acrolein (PC-Acro) were reduced, while levels of polyamines were increased at the locus of infarction. When cell growth of mouse mammary carcinoma FM3A cells and neuroblastoma Neuro2a cells was inhibited by Ca2+, the level of polyamines decreased, while that of PC-Acro increased. It was also shown that Ca2+ toxicity was decreased in an acrolein toxicity decreasing FM3A mutant cells recently isolated. In addition, 20–40 μM Ca2+ caused the release of polyamines from ribosomes. The results indicate that acrolein is produced from polyamines released from ribosomes through Ca2+ increase. ConclusionThe results indicate that toxicity of Ca2+ during brain infarction is correlated with the increase of acrolein.

Intralesional Rose Bengal in melanoma elicits tumor immunity via HMGB1

Intralesional (IL) therapy is under investigation to treat dermal and subcutaneous metastatic cancer. Rose Bengal (RB) is a staining agent that was originally used by ophthalmologists and in liver function studies. Previously, IL injection of RB induced regression of injected and uninjected tumors in murine models. However, the relevant mechanism is yet unknown. In this study, we used an OVA-expressing B16 melanoma murine model and found that IL RB treatment led to increased tumor-specific T cells with memory characteristics. CD8+ T cell are crucial for tumor-specific response elicited by IL RB. IL RB therapy also increased antigen-specific T cell proliferation and enhanced tumor regression. In addition, IL RB facilitated dendritic cells (DCs) infiltrating lymph nodes draining from tumor. Incubation of melanoma cells with RB led to necrosis and the release of High Mobility Group Box 1 (HMGB1), which activated DCs via up-regulation of CD40 expression. The blockade of HMGB1 significantly reduced the antigen-presenting ability of DCs. To determine whether this mechanism was relevant in patients treated with IL RB, we performed a pilot clinical study in melanoma patients (NCT01760499). IL RB led to tumor regression in both RB-injected and uninjected lesions, associated with an increase in circulating T cells. Increased tumor-specific response was found from those circulating T cells of 5 out of 7 tested patients after IL RB treatment. HMGB1 levels in patient sera were also elevated. Together, these results reveal a clinically relevant immunoadjuvant pathway triggered by tumor cell death secondary to ablation with RB.

Photothrombosis-induced Focal Ischemia as a Model of Spinal Cord Injury in Mice.

Spinal cord injury (SCI) is a devastating clinical condition causing permanent changes in sensorimotor and autonomic functions of the spinal cord (SC) below the site of injury. The secondary ischemia that develops following the initial mechanical insult is a serious complication of the SCI and severely impairs the function and viability of surviving neuronal and non-neuronal cells in the SC. In addition, ischemia is also responsible for the growth of lesion during chronic phase of injury and interferes with the cellular repair and healing processes. Thus there is a need to develop a spinal cord ischemia model for studying the mechanisms of ischemia-induced pathology. Focal ischemia induced by photothrombosis (PT) is a minimally invasive and very well established procedure used to investigate the pathology of ischemia-induced cell death in the brain. Here, we describe the use of PT to induce an ischemic lesion in the spinal cord of mice. Following retro-orbital sinus injection of Rose Bengal, the posterior spinal vein and other capillaries on the dorsal surface of SC were irradiated with a green light resulting in the formation of a thrombus and thus ischemia in the affected region. Results from histology and immunochemistry studies show that PT-induced ischemia caused spinal cord infarction, loss of neurons and reactive gliosis. Using this technique a highly reproducible and relatively easy model of SCI in mice can be achieved that would serve the purpose of scientific investigations into the mechanisms of ischemia induced cell death as well as the efficacy of neuroprotective drugs. This model will also allow exploration of the pathological changes that occur following SCI in live mice like axonal degeneration and regeneration, neuronal and astrocytic Ca(2+) signaling using two-photon microscopy.

Intralesional Injection of Rose Bengal Induces a Systemic Tumor-Specific Immune Response in Murine Models of Melanoma and Breast Cancer

Intralesional (IL) injection of PV-10 has shown to induce regression of both injected and non-injected lesions in patients with melanoma. To determine an underlying immune mechanism, the murine B16 melanoma model and the MT-901 breast cancer model were utilized. In BALB/c mice bearing MT-901 breast cancer, injection of PV-10 led to regression of injected and untreated contralateral subcutaneous lesions. In a murine model of melanoma, B16 cells were injected into C57BL/6 mice to establish one subcutaneous tumor and multiple lung lesions. Treatment of the subcutaneous lesion with a single injection of IL PV-10 led to regression of the injected lesion as well as the distant B16 melanoma lung metastases. Anti-tumor immune responses were measured in splenocytes collected from mice treated with IL PBS or PV-10. Splenocytes isolated from tumor bearing mice treated with IL PV-10 demonstrated enhanced tumor-specific IFN-gamma production compared to splenocytes from PBS-treated mice in both models. In addition, a significant increase in lysis of B16 cells by T cells isolated after PV-10 treatment was observed. Transfer of T cells isolated from tumor-bearing mice treated with IL PV-10 led to tumor regression in mice bearing B16 melanoma. These studies establish that IL PV-10 therapy induces tumor-specific T cell-mediated immunity in multiple histologic subtypes and support the concept of combining IL PV10 with immunotherapy for advanced malignancies.