Infected Twigs Research Articles

First report of 'Candidatus Phytoplasma asteris' associated with witches'-broom and plexus bud disease of Cerasus serrula in China.

Cherry blossoms (Cerasus serrula) are native to the temperate zone around the Himalayas in the northern hemisphere, mainly distributed in the west and southwest of China, including Yunnan, Sichuan and Tibet. Cherry has high ornamental, edible and medicinal value. In August 2022, we observed that Cherry trees exhibited witches' broom and plexus bud in Kunming City, Yunan Province, China. The symptoms consisted of many small branches with little leaves at the top of branches, stipule lobation, and clustered adventitious buds that are tumor-like on the branches that usually cannot sprout normally. As disease intensity increased, the branches dried up from the top to the bottom till the death of the whole plant. We named this disease C. serrula witches' broom disease (CsWB). We found CsWB in the areas of Panlong, Guandu, Xishan Districts in Kunming, where more than 17% of the plants we surveyed were infected. We collected 60 samples from across the three districts. These included 15 symptomatic and 5 asymptomatic plants per district. The lateral stem tissues were observed under a scanning electron microscope (Hitachi S-3000N). The nearly spherical bodies were found in the phloem cells of symptomatic plants. Total DNA extraction was conducted from 0.1 g tissue using the CTAB method (Porebski et al. 1997), ddH2O was used as the negative control, and Dodonaea viscose plants with witches' broom symptoms were used as the positive control. The nested PCR was used to amplify the 16S rRNA gene (Lee et al. 1993; Schneider et al. 1993) and PCR amplicon of 1.2 kb were amplified (GenBank accessions: OQ408098; OQ408099; OQ408100). The direct PCR specific to the ribosomal protein (rp) gene yielded amplicons of approximately 1.2 kb with primer pair rp(I)F1A and rp(I)R1A (Lee et a. 2003) (GenBank accessions: OQ410969; OQ410970; OQ410971). The fragment from 33 symptomatic samples was consistent with the positive control, and absent for asymptomatic samples, suggesting an association of phytoplasma with the disease. A BLAST analysis of the 16S rRNA sequences of CsWB phytoplasma showed that it has a 99.76% similarity with Trema laevigata witches' broom phytoplasma (GenBank accession MG755412). The rp sequence shared 99.75% identity with Cinnamomum camphora witches' broom phytoplasma (GenBank accession OP649594). An analysis with iPhyClassifier showed that the virtual RFLP pattern derived from the 16S rDNA sequence shares 99.3% similarity with that of the 'Ca. Phytoplasma asteris' reference strain (GenBank accession: M30790), and the virtual RFLP pattern derived from the fragment is identical (similarity coefficient 1.00) to the reference pattern of 16Sr group I, subgroup B (GenBank accession: AP006628). Thus, CsWB phytoplasma is identified as 'Ca. Phytoplasma asteris'-related strain belonging to sub-group 16SrI-B. The phylogenetic tree was constructed based on 16S rRNA gene and rp gene sequences by using MEGA version 6.0 (Tamura et al. 2013) with neighbor-joining (NJ) method and bootstrap support was estimated with 1000 replicates. The result indicated that the CsWB phytoplasma formed a subclade in 16SrI-B and rpI-B respectively. In addition, the clean 1-year-old C. serrula were tested positive for the phytoplasma using the nested PCR 30 days after being grafted with naturally infected twigs with CsWB symptoms. To the best of our knowledge, Cherry blossoms is a new host of 'Ca. Phytoplasma asteris'-related strains in China. The newly emerged disease is a threat to the ornamental value of cherry blossoms and the production of wood quality.

FirstReportofFusariumsolaniassociatedwithTwigCankerofEnglishWalnut(JuglansregiaL.)inXinjiang, China.

English walnut (Juglans regia L.) is a perennial deciduous fruit tree, and an economically important hardwood tree species cultivated worldwide. As one of the important economic crops, English walnut is also widely cultivated in Xinjiang. In September 2019, twig canker symptoms were observed on English walnut in several orchards, with approximately 15% to 40% disease incidence in southern Xinjiang region (79º95'E, 40º37'N). The branch lesions were long oval, concave, and black to brown. Leaves of the affected branches turned yellow and the branches eventually died. Infected twigs were collected from an infected tree in an orchard. Symptomatic tissue from the margins of cankers was surface disinfested with 75% ethanol for 60 s, rinsed 3 times with sterile water, and then incubated on potato dextrose agar medium (PDA) at 25 ℃ under a 12-hr photoperiod in Light incubator for 7 days. Seven fungal isolates showing similar morphology were obtained from the symptomatic tissue. All the fungal cultures had a pink-white color with loose, cottony mycelium, and the underside of the colonies were light brown. Macroconidia were slightly curved, with one to six septa, both ends were slightly sharp, and they measured 22.8 to 38.5 × 3.5 to 6.7 μm (27.4 ± 0.6 × 4.2 ± 0.3 μm, n=50). Microconidia were oval, hyaline, zero to one septa, measuring 4.5 to 9.6 × 1.8 to 2.3 μm (6.8 ± 0.3 × 2.1 ± 0.1 μm, n=50). According to the morphological characteristics, the seven isolates were identified as a member of the Fusarium solani species complex (Summerell et al. 2003). Genomic DNA was extracted from the representative isolate HSANTUAN2019-1, and the internal transcribed spacer (ITS) region, the translation elongation factor 1-alpha (TEF) were amplified with the primer pairs ITS1/ITS4 (White et al. 1990) and EF1-F/EF2-R (O' Donnell et al. 2010), respectively. The sequences submitted to GenBank (accession nos. OP271472 for ITS, OP293104 for TEF) showed high similarity with the reference sequences of F. solani (ITS, OL691083 [100%]; TEF, HE647960 [99.86%]). Pathogenicity of the seven isolates were assessed on 1-year-old branches of English walnut in the field. Healthy branches (40) were wounded with a sterilized hole punch, and then inoculated with isodiametric mycelial PDA plugs (5 branches per fungal isolate). Five branches were inoculated with sterile PDA plugs as a negative control. The inoculations were performed three times. All treatments were wrapped with fresh film for 3 days. Dark brown necrotic lesions were observed on all inoculated branches 22 days post-inoculation. The controls had no symptoms. The pathogen was reisolated from all the inoculated branches, fulfilling Koch's postulates. To our knowledge, this is the first report of F. solani causing twig canker on English walnut in Xinjiang, China. Twig canker disease often cause a large number of branches to dry out and die. If the disease control and prevention is neglected, the productivity of the English walnut will be seriously affected in the cultivation area. Our finding will provide valuable information for prevention and management of twig canker on English walnut.

Field screening of elite Cacao (Theobroma Cacao L.) clones to vascular streak dieback (VSD) disease as the selection criteria for planting materials

The field screening for VSD disease infection in four elite cocoa clones (KKM22, KKM4, PBC230, and MCBC1) was conducted after two years of transplanting. This study aimed to determine the efficient selection criteria for planting material of cocoa-based on the intensity of VSD disease and new shoot regeneration characteristics such as number, length, and diameter of new shoots after removal of the infected VSD twigs. Around half population (60%) of the trees were infected by the disease but the infection was minor and observed only on the leaf and twigs of 150 mm in length along the jorquette branches. The MCBC1 clone with a disease severity score of 1.82 is classified under the VSD disease resistance clone whereas other clones with a score averaging 2.21 are grouped under the moderately resistance clone. The cultural practice via pruning of all infected twigs (150 mm) was efficient to control the disease from spreading. One month after pruning, the MCBC1 from disease resistance clone had the lengthiest (62.3 mm) and thickest diameter (15.6 mm) of the new shoot compared with other clones. This study indicates the need for the screening of VSD disease in cocoa plantations so that the disease can be managed and controlled at the early stage of infection. This study also reported the first finding on using new shoot regeneration after pruning for the selection criterion of cocoa planting material in the future breeding programme.

The Decay and Fungal Succession of Apples with Bitter Rot Across a Vegetation Diversity Gradient

Bitter rot is a disease of apple caused by fungi in the genus Colletotrichum. Management begins with removal of infected twigs and fruit from tree canopies to reduce overwintering inoculum. Infected apple fruit are usually tossed to the orchard floor, which is generally managed as herbicide-treated weed-free tree rows, separated by grass drive rows. We monitored decay rates and succession of fungi of apple fruit with bitter rot in tree canopies, and on the soil surface in tree rows, grass drive rows, and nearby diverse plant communities. We hypothesized that decay would occur most rapidly within diverse plant communities, which would provide a more diverse array of potential fungal decomposers. Apple fruit in tree canopies became dry and mummified and had more Colletotrichum gene marker copies the following growing season than did fruit on the soil surface. Of the soil-surface samples, those in grass drive rows and diverse plant communities had higher moisture, faster decay rates, and sharper decreases in Colletotrichum gene marker copies than apple fruit in tree rows. Fungal composition across all decaying apple fruit was dominated by yeasts, with higher genus-level richness, diversity, and evenness in fruit from tree canopies than those on the soil surface. In soil-surface apple fruit, we observed clear successional waves of Pichia, Kregervanrija, and [Candida] yeasts, with similar but distinctly diverging fungal composition. Our results show that orchard floor management can influence fungal succession in apple fruit with bitter rot but suggests that bitter rot management should primarily focus on removing infected apple fruit from tree canopies.

First Report of Colletotrichum chrysophilum Causing Anthracnose on Blueberry in Brazil.

Highbush (Vaccinium corymbosum L.) and rabbiteye (V. ashei R.) blueberry are the most important export small fruit crops in southern Brazil. Anthracnose has been considered one of the most destructive disease and exclusively associated with C. karstii in Brazil (Rios et al. 2014). In November 2019, severe anthracnose symptoms including leaf spots but particularly twig blights and fruit rots were observed on all blueberry plants (V. ashei) in one organic orchard in Santa Catarina state, Brazil (27º43'48.96"S, 49º0'57.79"W). Four isolates were obtained from necrotic lesions and monosporic cultures were grown on potato dextrose agar at 25°C and with a 12 h photoperiod under near ultra violet light. After 15 days, colonies showed upper surface color varying from grayish-white to pale-orange and the reverse side pale-orange. Conidia were hyaline, cylindrical with rounded ends, and their length and width ranged from 9.5 to 15.5 µm (x ̅=11.8) and 6.5 to 3.5 µm (x ̅=4.9), respectively. The isolates were identified by multilocus phylogenetic analyses using nucleotide sequences of actin (ACT), β-tubulin (TUB2), calmodulin (CAL), glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), glutamine synthetase (GS), internal transcribed spacer (ITS) and the intergenic spacer between DNA lyase and the mating-type locus MAT1-2-1 (ApMAT). Nucleotide sequences exhibited from 95 to 100% sequence identity to Colletotrichum chrysophilum ex-type (CMM4268) and were deposited in GenBank database (MW868219 to MW868222, MW868211 to MW868214, MW868215 to MW868218, MW868223 to MW868226, MW868202 to MW868205, MW793353 to MW793356, and MW868207 to MW868210). C. chrysophilum belongs to the C. gloeosporioides species complex and was previously described as C. ignotum in banana and other tropical fruits in Brazil (Vieira et al. 2017; Veloso et al. 2018). In addition, this species was recently reported on apple fruit in New York, USA (Khodadadi et al. 2020). To confirm pathogenicity, one-year-old blueberry plants were inoculated by spraying a suspension of 1×106 conidia/ml, incubated in a moist chamber in the dark for 48 h and then kept in the greenhouse. Plants sprayed with sterile distilled water served as control. Additionally, fruits were immersed for 2 min in a conidial suspension (1×106 conidia/ml) and incubated at 25°C and 12 h photoperiod for 20 days. Inoculated plants exhibited first symptoms in twigs at 10 days after inoculation (dai). Infected twigs showed initially dark brown spots that coalesced and became necrotic. On leaves, reddish-brown lesions with less than 2 mm appeared at low intensity at 15 dai. On fruits, sunken areas associated with an abundant orange mucilaginous mass of acervuli and conidia were seen at 7 dai. Symptoms on plants were identical to those observed under field conditions, and the pathogen was re-isolated from lesions fulfilling Koch's postulates. To the best knowledge, this is the first report of C. chrysophilum causing anthracnose on blueberries in Brazil. The identification of this species causing blueberry anthracnose is crucial to improve the disease control strategies and resistance breeding.

Sphaeropsis sapinea and Associated Endophytes in Scots Pine: Interactions and Effect on the Host Under Variable Water Content

The ascomycete Sphaeropsis sapinea is the causal agent of the Diplodia Tip Blight disease on pines and other conifer species. This fungus has a symptomless endophytic life stage. Disease symptoms become visible when trees have been weakened by abiotic stress, usually related to warmer temperatures and drought. Currently, this disease is observed regularly in Scots pine (Pinus sylvestris) sites in parts of Europe, such as Germany, increasing dramatically in the last decade. Changes in climatic conditions will gradually increase the damage caused by this fungus, because it is favored by elevated temperature. Thus, host trees with reduced vitality due to climate change-related environmental stress are expected to be more susceptible to an outbreak of Diplodia Tip Blight disease. There is currently no established and effective method to control S. sapinea. This project aims to reveal the nature of the endophyte community of Scots pine. Utilizing the antagonistic core community of endophytes could serve as a novel tool for disease control. Results from this study provide a starting point for new solutions to improve forest health and counter S. sapinea disease outbreaks. We screened potential antagonistic endophytes against S. sapinea and infected Scots pine seedlings with the most common endophytes and S. sapinea alone and combination. The host was stressed by limiting access to water. The antagonism study revealed 13 possible fungi with the ability to inhibit the growth of S. sapinea in vitro, for example Sydowia polyspora. None of the tested co-infected fungi (Desmazierella acicola, Didymellaceae sp., Microsphaeropsis olivacea, Sydowia polyspora, and Truncatella conorum-piceae) showed strong necrosis development in vivo, even when host stress increased due to drought. However, the infection experiment demonstrated that drought conditions enhance the effect of the disease outbreak, triggering S. sapinea to cause more necrosis in the infected twigs.

First Report of Diaporthe eres Causing Twig Dieback of White Bark Pine in China

White bark pine (Pinus bungeana Zucc.) is popularly cultivated as a garden ornamental tree in China because of the high ornamental value. During July 2017, twig dieback symptoms were found on white bark pine trees in the campus of Henan Agricultural University, Zhenzhou, Henan Province, China. The rate of diseased plants was 25% (up to 40% in 2018) in this campus. Early symptoms appeared as round or oval, red-brown lesions on the twigs, which enlarged progressively, leading to dieback. Two representative Diaporthe strains (zm170130 and zm180920) were isolated and purified from two specimens collected in 2017 and 2018 on potato dextrose agar (PDA). Pycnidia scattered in PDA, dark brown to black, globose to subglobose. Conidiogenous cells phialidic, cylindrical, tapering toward the apex, with periclinal thickening. Two kinds of conidia were produced: α-conidia, unicellular, hyaline elliptical or fusiform, two-guttulate, 5.2 to 9.0 × 2 to 3 µm (n = 50); β-conidia hyaline, aseptate, without guttules, filiform, curved, with obtuse ends, 15.5 to 31 × 0.8 to 1.5 µm (n = 50). These morphological characteristics of the isolates agreed with those of Diaporthe eres (Dissanayake et al. 2015; Liu and Tang 1995; Udayanga et al. 2014). The identity of the two fungal isolates was confirmed by DNA sequencing of the ITS rDNA region (GenBank accession nos. MK265702 and MK265701), TUB gene (GenBank accession nos. MK265704 and MK265703), and histone H3 gene (GenBank accession nos. MK265700 and MK265699), which were over 99% homologous to those consensus sequences of the ex-epitype strain D. eres (KJ210529, KJ420799, KJ210550) (Guarnaccia et al. 2018). The pathogenicity of the isolate zm180920 was tested on 2-year-old healthy twigs of white bark pine in July 2018. Five 2-year-old healthy twigs (30 cm long) cut from 5-year-old trees were used for each treatment. Fifteen mycelial plugs harvested from the periphery of a 7-day-old colony were placed on the surface of the wounded twigs, after the twigs had been surface sterilized with 75% ethanol for 2 min; an equal number of noncolonized plugs of PDA served as the control treatment. All test twigs were kept in a clear plastic box with wet sterilized cotton to maintain high relative humidity at 26 to 30°C in the greenhouse. Symptoms similar to those originally observed on the naturally infected twigs were observed 10 days after inoculation, and the same fungus was reisolated from each of the symptomatic twigs; control twigs remained asymptomatic, and no fungus was isolated. The isolates from the symptomatic twigs were identified as D. eres on the basis of the morphology and the same gene sequences. Koch’s postulates were repeated three times with the same results. The fungus has been reported on peach, grapevine, jujube, Red Robin, and so on in China (Dissanayake et al. 2015; Liu and Tang 1995; Song et al. 2019; Yang et al. 2018; Zhang et al. 2018). To our knowledge, this is the first report of D. eres causing twig dieback of white bark pine in China. Disease control strategies in the region are being further studied.

Occurrence of Colletotrichum fruticola along with C. gloeosporioides in causing anthracnose disease on Citrus sinensis in Tunisia

Information on the Colletotrichum species associated with Citrus anthracnose was lacking. Surveys were conducted from January 2012 to February 2013 on different citrus species and varieties orchards in the Cap-Bon region (Tunisia) to investigate the prevalence of Colletotrichum species. Typical anthracnose symptoms such as dieback and wither-tip of twigs were noticed. The fungi associated with anthracnose were isolated and studied. Morphological features (mycelial and sporulation characterization), molecular identification by using ITS1 and ITS2 primers were done along with pathogenicity test monosporic cultures. Eight Colletotrichum isolates were collected from infected fruits, leaves and twigs and were identified as Colletotrichum gloeosporioides (seven isolates) and Colletotrichum fructicola (one isolate). All eight Colletotrichum isolates were pathogenic on Thomson, Malti and Meski orange varieties, Lunari lemon variety and sweet lime Bergamot detached fruit and leaves. This investigation revealed the prevalence, for the first time of C. fructicola, on Citrus in Tunisia.

Dieback and decline of wild almond (Amygdalus scopariaSpach) in the Harat protected forest of Yazd Province, Iran

AbstractWild almond (Amygdalus scoparia) is a dominant shrub species in mountain forests of the Irano‐Turanian region. Dieback and decline symptoms of wild almond shrubs were first observed in Harat protected forest (Yazd, Iran) in the autumn of 2014. Since then, the incidence and severity of the disease have increased. To study the aetiology and estimate losses from the disease, field studies were conducted in 2016 and 2017. For this purpose, eight stands were selected, in which 24%–99% of the trees were wild almond in their species composition. In total, 50 cankers and 50 infected twigs of wild almond shrubs were collected. Fungal isolates were identified based on morphological and cultural characteristics, as well as sequence data of ITS1 + 5.8S + ITS2 rDNA. Pathogenicity of fungi was checked on detached shoots and evaluated after 40 days by measuring the discoloured lesion length at the inoculation site. Among 681 wild almond shrubs checked, 84.44% showed decline symptoms with different severities; only 15.56% did not show observable disease symptoms. The most frequent colonizers of infected tissues taken from cankers wereWilsonomyces carpophilus(56%),Thyrostroma cornicola(40%) andCollophorina paarla(30%). Infected twigs were extensively colonized byW. carpophilus(36%),Th. cornicola(24%) andUlocladium consortiale(24%). Other species, such asEndoconidioma populi, Microsphaeropsis olivacea,Trichoderma asperellum, Paecilomyces formosus, Saccothecium rubi, Preussiasp.andChaetomium globosum,had lower isolation frequencies.W. carpophilus, Th. cornicola,C. paarlaandU. consortialewere found as pathogens on detached wild almond shoots. Based on the frequency of the isolates and the pathogenicity tests, four fungi, such asW. carpophilus,Th. cornicola,C. paarlaandU. consortiale, are considered serious contributing agents playing a significant role in the dieback and decline of wild almond. All isolated species are reported for the first time on the wild almond shrubs of the world.

Anatomical pathogenesis and histological interaction between Pseudomonas savastanoi pv. savastanoi strain KT11 and Pseudomonas fluorescens strain PICF4 in olive knots

The development of the olive knot disease, caused by Pseudomonas savastanoi pv. savastanoi was studied taking into consideration the anatomical changes at the inoculation sites. The genesis of knots was investigated in the absence and presence of Pseudomonas fluorescens bv. PICF4, a natural colonizer of olive roots and an effective biocontrol agent (BCA) of verticillium wilt of olive. This bacterium was investigated for its potential as a BCA against olive knot disease. Bioassays using 5-month-old olive plants (cv. Arbequina) were performed to assess the interaction between olive plant stems, Pseudomonas savastanoi KT11, isolated from active knots of naturally infected olive twigs, and PICF4. Thus, we studied whether strain PICF4 controlled knot development and anatomy compared with those observed in the absence of PICF4, and the population size of both bacteria when co-inoculated together in stems or separately injected at different intervals after inoculation. Results revealed that PICF4 was able to settle, colonize and persist in stem tissues upon artificial inoculation. While PICF4 was unable to suppress disease development, its presence affected the pathogen population size (reduction of ≈ 25% at 54 days post inoculation) and produced smaller knots. Histological sections (± 40 μm thicknesses) cut with a vibrotome and observed under a light microscope showed less tissue alterations and less cavities inside the knots, compared with those produced when the pathogen was inoculated without PICF4.

The colonization processes of Myrtus communis by strains of Pseudomonas savastanoi with a differential ability to produce phytohormones

The ability to produce indole‐3‐acetic acid (IAA) through the indole‐3‐acetamide (IAM) pathway as well as cytokinins is a common trait of Pseudomonas savastanoi populations causing disease on oleander and olive. These phytohormones are required for the induction and development of an outgrowth of plant cell tissue termed a knot. However, in myrtle orchards of Sardinia (Italy), strains of P. savastanoi unable to produce cytokinins were found coexisting with cytokinin‐producing strains. Data presented here show that the ability to produce IAA through the IAM pathway is also a variable trait within this population, raising questions on the exact role of these plant growth substances in the disease process on myrtle. Three P. savastanoi strains were selected based on their differential ability to produce phytohormones in vitro, and their interaction with the host was investigated over a period of 8 months using histological methods. All strains successfully invaded the infected twigs, moving systemically (unhalted by host defences) upward and downward from the inoculation point, both by completely degrading the cell walls and by taking advantage of the xylem vessels and intercellular spaces. Moreover, all strains induced the development of cankers, which slowly evolved into typical knots only on the twigs inoculated with the phytohormone‐producing strains. This study further demonstrates that cytokinins and IAA are essential for knot development; moreover, it ascertains that bacterial production of cytokinins is not necessary for host colonization and for the expression of pathogenicity (i.e. the ability to cause disease) of P. savastanoi on myrtle.

Perpetuation and host range of Oidium euonymi-japonici causing powdery mildew of Euonymus japonicus in Kashmir valley, India

The pathogen Oidium euonymi-japonici (anamorph) causing powdery mildew of Euonymus japonicus in Kashmir valley overwintered asexually as mycelium on intact infected twigs which started producing conidia in the 4th week of February and continued till ending October during both the years of study 2013 and 2014. The pathogen ceased to produce conidia from the 1st week of November to 3rd week of February, 2013–2014 and 2014–2015. On intact-overwintered infected twigs, maximum conidial production and viability was observed during 1st week of April and 1st week of August in both the years. However, no conidial formation was observed on the twigs, kept 10 cm deep in the soil. The cross inoculation study revealed that inoculum from Euonymus japonicus successfully infected all the other Euonymus genotypes tested but failed to infect the weeds and other test hosts and vice versa.

First report of Phoma tracheiphila causing severe mal secco disease on a mandarin hybrid (cv. Ortanique) grafted onto Citrumelo rootstock in western Greece

The Greek citrus industry covers an area of almost 59,000 ha located mainly in the central and southern parts of Greece. One of the major phytosanitary problems for the industry is a disease of Citrus spp. and hybrids, caused by the fungal pathogen Phoma tracheiphila, which mainly affects lemon trees (Citrus limon) causing significant yield reductions of up to 60%. It has been estimated that 60-100% of the trees can be affected within 20 years after planting (Thanassoulopoulos & Manos, 6). P. tracheiphila is considered to be widespread in Greece (first observed in 1894) but it is listed as a II/A2 quarantine organism by the European Commission as it is absent from citrus plantations in some EU Member States (e.g. Spain and Portugal) (EPPO, 2). Three disease syndromes are associated with the fungus depending upon the site of infection. These are ‘mal secco’, the most common form of the disease, arising from infection in the canopy (wilt and dieback); ‘mal nero’ infection at the base of the trunk (brown discoloration of the heartwood), and ‘mal fulminante’, infection in the roots (sudden wilt of branches or the whole tree). All three syndromes result in desiccation of twigs, branches, or the whole plant (Nigro et al., 4). In addition to lemon (and other citrus species/hybrids), mandarin (C. reticulata) and some of its hybrids can also become affected by the pathogen (Nigro et al., 4). Among rootstocks, sour orange (C. aurantium), the most widespread lemon rootstock in Greece, is considered to be very susceptible to infection (Solel & Oren, 5). By comparison, Citrumelo, a citrus hybrid (C. paradisi x Poncirus trifoliata), is reportedly less susceptible to P. tracheiphila (Nigro et al., 4), and it is recommended as a citrus rootstock due to its resistance to Citrus tristeza virus (Moreno et al., 3). During surveys in citrus orchards in Katohi, western Greece in 2014, decline of a mandarin hybrid (C. reticulata x sinensis, cv. Ortanique) grafted onto Citrumelo rootstocks was observed, with approximately 90% of the trees being affected in an area of 20 ha. Symptoms first appeared in the spring in the apical parts of branches and sprouts including epinasty and shedding of leaves, followed by wilt and dieback of twigs and branches (Fig. 1A). Often individual branches were affected and symptoms appeared on one side of the plant (Fig. 1B). In some cases infection progressed rapidly affecting the entire tree. Infected shoots, twigs, secondary branches and trunk showed the characteristic salmon-pink or orange-reddish discoloration of the wood (Fig. 2). Consistent orange-pink pigmented fungal colonies isolated from infected xylem on potato dextrose agar (PDA) were identified as putative P. tracheiphila based on the formation of mature black pycnidia. DNA was extracted from infected twigs, bark, wood, and from PDA cultures, following PCR using the primer pair PtFOR2/Pt-REV2 developed by Balmas et al. (1); a 380 bp fragment was generated in each case. The identified sequence (KP025953) was 100% identical to P. tracheiphila isolates Pt-42 (AY531666), and IPt-5 (DQ993285) among others. This is the first report of P. tracheiphila occurring on cv. Ortanique grafted onto Citrumelo rootstocks. Cultural and phytosanitary controls on this highly susceptible combination are likely to require intensification to help prevent the spread of the pathogen. This work was supported by Project D808 to GT. The authors would like to thank Mr D. Kitsakis for providing access to the citrus orchards.

Sclerotinia Rot ofOcimum sanctumand the Host Range of its Pathogen

Sclerotinia rot of Ocimum sanctum caused by Sclerotinia sclerotiorum has been recorded for last three years during winter season (2011–2014) at Kalyani, Nadia, West Bengal. The disease appeared in first week of December and progress of the disease continued up to the end of February. Drooping of leaves in one or more young twigs was the first symptom of the disease. Light brown discolouration on the twig and presence of white sclerotia might be associated with the initial symptom. Gradually more and more twigs were affected followed by death and drying of the infected twigs. In humid condition, prominent cottony white mycelia developed on the affected tissue. Towards end of February many plants became dead. Black matured sclerotia were found on the dead branches. On artificial inoculation the causal organism, Sclerotinia sclerotiorum infected fifty plants indicating that the pathogen did not have host specificity. But susceptibility of seventeen plants (Capsicum annum var. grossum, Trichosanthes dioica, Cucurbita pepo, Abelmoschus esculentus, Raphanus sativus, Trigonella foenumgraecum, Amaranthus tricolor, Portulaca oleracea, Pachyrrhizus erosus, Ipomoea batatas, Lathyrus sativus, Ricinus communis, Allium sativum, Foeniculum vulgare, Carica papaya, Chrysanthemum indicum, Chenopodium album) is recorded first time in India.

Avoidance of Needle Rust Fungus By Larval Sawfly On Pinyon Pine

Larvae of the sawfly Neodiprion edulicolus fed on needles of Pinus edulis and were abundant below 1,850 m in elevation at sites near Sunset Crater, Arizona. Coleosporium needle rust, in contrast, infected P. edulis above 1,850 m in elevation and rarely occurred on the same trees as did N. edulicolus. Larval sawfly transferred to P. edulis above 1,850 m fed less frequently on infected twigs and moved off twigs more quickly when transferred to infected trees. Though the negative interactions involved only a small percentage of larval sawfly and rust fungus during this study, the interaction might become more significant in the future if sawflies spread to higher elevations in response to changes in climate or habitat.

First Report of Pitch Canker Disease Caused by Rhizosphaera kalkhoffii on Pinus sylvestris in China.

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 μm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 μm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 μl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report.

A survey of die-back disease of neem in Tamil Nadu, India and PCR-based confirmation of the isolates

A survey of die-back disease of neem was done in different agro climatic regions of Tamil Nadu, India using Global Positioning System (GARMIN 12). Twigs of Azadirachta indica (Neem) infected with die-back were collected from different regions of Tamil Nadu, India and they were further analyzed to determine the pathogen. Phomopsis azadirachtae the causal organism was isolated on malt extract agar from die-back infected neem twigs. They were identified by conventional and molecular methods. Phomopsis genus specific primers (5.8S r-DNA) were then used for the confirmation of P. azadirachtae – the causative agent of die-back of neem by Polymerase chain reaction (PCR). Studies revealed the amplification of expected 141bp DNA in P. azadirachtae isolated from the diseased trees of different regions of Tamil Nadu confirming the causal organism of die-back of neem. Studies revealed a very high incidence of die-back in most of the places of Tamil Nadu. Hand held GPS was used in the study which would help in continuous monitoring of the diseased trees.

First Report of Gummosis Disease of Japanese Apricot Caused by Botryosphaeria dothidea in Taiwan.

Japanese apricot (Prunus mume Sieb. et Zucc.) is an economically important fruit crop grown on more than 10,000 ha in Taiwan. During May 2008, twigs of Japanese apricot trees in the commercial farms of Renai Region (Nantou County) showed symptoms of gummosis disease, with 12 to 18% of the trees affected. The disease was more severe on trees weakened by drought stress. Limb and twig infections began around lenticles as small, sunken, discolored lesions at the margins of wounds. Following infection, cortical cells collapsed, bark became depressed, and blisters developed, which were often cracked with whitish gummy exudation. Necrotic areas were seen on the cortical tissues. Leaves showed yellowing and drooping. In winter months, numerous black pycnidia or perithecia formed on infected twigs. Single conidial isolates of the pathogen were obtained from diseased twigs on acidified potato dextrose agar (PDA) incubated at 25 ± 1°C for 3 days. On the basis of morphological characteristics, the fungus was identified as Botryosphaeria dothidea (3). Conidia (17 to 22.6 × 4.3 to 6.0 μm) were hyaline, unicellular, and spindle shaped. Asci (78 to 125 × 15 to 17 μm) were hyaline, bitunicate, clavate, and eight spored. Ascospores (18 to 22 × 7.0 to 8.2 μm) were hyaline and spindle shaped or fusoid. The pathogen identity was further confirmed by PCR amplification and sequencing of ribosomal DNA internal transcribed spacer from the fungus with the primers ITS5: 5'-GGAAGTAAAAGTCGTAACAAGG-3' and ITS4: 5'-TCCTCCGCTTATTGATATGC-3' (4), and a representative sequence was deposited in NCBI GenBank (Accession No. GU594225). The sequence showed 99 to 100% homology with previously characterized strains of B. dothidea (GenBank Accession Nos. EU441944, DQ177876, and AY786320). Pathogenicity tests were conducted with inoculum prepared by culturing the fungus on PDA under a continuous photoperiod of 128 ± 25 μE·m-2·s-1 at 25°C for 3 days. Shallow cuts (3 × 3 × 3 mm) were made on 12- to 15-month-old healthy twigs with a scalpel and inoculated with either a 5-mm mycelial disc or 0.5 ml of conidial suspension (105 conidia/ml) of the fungus. Two twigs on each of six trees were inoculated. Inoculated areas were covered with moist, sterile cotton and the entire twigs were enclosed in plastic bags. Twigs were inoculated with 5-mm PDA discs or sterile water for controls. The symptoms described above were observed on all inoculated twigs 14 days after inoculation, whereas control twigs remained healthy. Reisolation from the inoculated twigs consistently yielded B. dothidea. In Taiwan, B. dothidea has been reported as the causal agent of gummosis of peach (1) and fruit ring rot of pear (2); however, to our knowledge, this is the first report of B. dothidea causing gummosis on Japanese apricot.

Study of die back disease incidence of neem in Karnataka, India and PCR based identification of the isolates

A disease survey of die back of neem was done in different agroclimatic regions of Karnataka, India using Global Positioning System (GARMIN 12). Twigs of Azadirachta indica (Neem) infected with die back were collected from different regions of Karnataka, India and they were further analysed to determine the pathogen. Phomopsis azadirachtae the causal organism was isolated on malt extract agar from die back infected neem twigs. They were identified by conventional and molecular methods. Phomopsis genus specific primers (5.8S r-DNA) were then used for the detection of P. azadirachtae, the causative agent of die back of neem by polymerase chain reaction (PCR). Studies revealed the amplification of expected 141 bp DNA in P. azadirachtae isolated from the diseased trees of different regions of Karnataka indicating the causal organism of die back disease on neem. Studies revealed a very high incidence of die back in most of the places of Karnataka. This is the first report on disease incidence of die back of neem. Hand held GPS was used in the study which helps in continuous monitoring of the diseased trees.

Lasiodiplodia theobromae causes a damaging dieback of cocoa in India

Central Plantation Crops Research Institute, Regional Station, Vittal, 574 243, Karnataka, IndiaCocoa (Theobroma cacao) is mainly grown as a mixed crop in coco-nut ⁄arecanut gardens in India. In September 2000 a rapid dieback ofcocoa was first observed in Hunsur Taluq of Mysore district, Karnataka,India. Affected trees show sudden yellowing and browning of leaves fol-lowed by rapid dieback of branches from the tips. Infected twigs havebrownish,shortverticalstreaksinthevasculartissues.Affectedtreescon-tinue to decline for several days and they soon die, although new flushesstilldevelopatthecollarregionsduringthemonsoon.Podsdonotdevelopin diseased trees but if formed earlier become mummified. Trees areaffected at all growth stages and throughout the year. Mortality is mostseverefromMarchtoMay.Investigations of the disease began in 2003 but it was not until 2007that the cause was consistently associated with a fungus isolated fromaffected twigs. Colonies were initially milky white on potato dextroseagarplates,laterturningtogrey-whitewithblackpycnidiaonthesurface.Young conidia were hyaline, unicellular, ovoid in shape and on maturityone-septate and ellipsoidal and confirmed as Lasiodiplodia theobromaeby CABI, UK (IMI 394314). Sterile cotton swabs containing L. theobro-mae mycelium were rubbed on pre-wounded stems of eight-month-oldseedlings. Typical vascular streaking and dieback symptoms appearedwithin20 days,exhibitingasimilaraggressiveresponsetoL.theobromaeon cocoa in Cameroon (Mbenoun et al., 2008). Lasiodiplodia theobro-mae was reisolated from the inoculated seedlings. Control swabs withsterilewaterdidnotproducesymptoms.Lasiodiplodia theobromae is a non-prominent pathogen of sixty planthosts inIndia (Varma& Bilgrami, 1977) and is the causeof charcoal podrotofcocoa(Nambiar&Nair,1972).Thisis,however,thefirstreportofa damaging dieback and death of cocoa plants, as witnessed in Mysoredistrict. Currently confined to an area of 260 ha, the incidence of the dis-easeincocoagardensvariesfrom10to56%.Withtherapidexpansionofcocoa in India underway, this disease is a potential threat to future pro-duction.References