Extracts Of Infected Plants Research Articles

Developing of specific monoclonal recombinant antibody fused to alkaline phosphatase (AP) for one-step detection of fig mosaic virus.

Present study was performed to develop a fusion recombinant monoclonal antibody for one-step and accurate detection of FMV with a specific single-chain variable fragment (scFv) fused to alkaline phosphatase (AP) named as scFv(FMV-NP)-AP. The gene encoding-specific scFv recombinant antibody binding to nucleocapsid protein of Fig Mosaic Virus (FMV-NP) was fused to upstream of AP gene and integrated in pET26b bacterial expression vector. As vector contain pelB signal peptide, the expressed protein is secreted into periplasmic compartment. Recombinant fusion protein was produced in transformed E. coli following induction by IPTG. Extraction and purification of fusion protein was performed under denatured condition. The results of SDS-PAGE and western blot analysis indicated high integrity and purity with a single band protein with expected size of 72kDa. The total yield of purified scFv(FMV-NP)-AP fusion protein estimated around 0.5-1mg/l cultured medium. Subsequent colorimetric analysis confirmed presence of alkaline phosphatase activity in prepared scFv-AP fusion protein. Specificity of generated recombinant fusion antibody against cognate antigen and the native virus presented in infected plant extracts was assessed by ELISA, western blot and dot blot assays. Results revealed that scFv(FMV-NP)-AP is able to detect the presence of FMV in infected fig plants. The novel approach, implementing specific recombinant fusion antibody developed in this research, leads to one-step detection of FMV in plants by avoiding the use of chemical enzyme-labeled secondary antibodies.

Production of a polyclonal antiserum against recombinant nucleocapsid protein and its application for the detection of fig mosaic virus

Mosaic disease (MD), caused by Fig mosaic emaravirus (FMV), is the most important and devastating virus disease of fig trees worldwide. The detection of FMV in infected plants is possible only through the use of molecular techniques, i.e. RT-PCR and LAMP, which both offer high sensitivity of detection, but are also considered laborious when dealing with a large number of samples. To cope with this restriction, a polyclonal antiserum through the immunization of a rabbit by injecting the recombinant nucleocapsid protein (NP) of FMV was raised and evaluated for its efficacy in Western Blot, Dot immuno-binding and DAS-ELISA. The results obtained showed that the raised antiserum was able to identify the nucleocapsid protein of FMV (p3) which was found to have an estimated molecular weight of ca. 35 KDa. In addition, the antiserum, when used in the three serological assays, was able to detect the p3 of FMV in protein extracts of infected plants with different levels of efficacy. Dot immuno-binding, using denatured plant protein extract, proved to be the most efficient serological assay for detecting FMV in samples collected from different fig orchards. This is the first report on an antiserum raised against FMV that could be used for immunological detection of the virus.

Presenting Peptides at the Surface of Potyviruses In Planta.

Potyviruses are plant viruses with elongated, flexuous virions amenable to modifications in the only viral structural protein, the coat protein (CP). Out of the several theoretically possible modifications to the CP, the one most exploited for peptide presentation is the genetic fusion of the peptide-to-be-expressed, to the CP N-terminus. Successful high-level expression of the modified CP has been achieved this way. The purified recombinant viral particles incorporate most, if not all, the properties of the expressed peptides. For many purposes, the recombinant virus particles present in extracts of infected plants should be purified for further use. Procedures for carrying out the whole process, from cloning to purification are described in the chapter.

Metabolic changes in Euphorbia palusrtis latex after fungal infection

The variations of metabolic profile of the latex of wild-growing Euphorbia palustris was carried out using multivariate analysis of 1H NMR spectral data. One population was infected with fungi Fusarium sporotrichioides, Fusarium proliferatum and Alternaria alternata, while the other consisted of healthy plant species. The non-polar metabolites of latex extracts such as benzoyl ingenol-laurate, amyrin decadienoate esters, cis-1,4-polyisoprene, and 24-methylenecycloartanol were identified using 1H and 2D NMR spectra. Principal component analysis of 1H NMR data provided a clear discrimination between the latex of infected and healthy plants. Minimum inhibitory concentration and minimum fungicidal concentration values of the latex extracts of healthy and infected plants were determined. The latex of infected plants was found to contain higher levels of benzoyl ingenol-laurate and 24-methylenecycloartanol, of which concentrations were strongly correlated with the antifungal activities of the latex.

Purification of isometric particles from maize plants infected with rayado fino virus

The leafhopper-borne rayado fino virus of maize was purified from infected plant extracts by precipitation with polyethylene glycol and sucrose density gradient centrifugation. Empty protein shells and complete isometric particles of approximately 33 ± 1 nm and 30 ± 1 nm, respectively, separated in the gradient columns. Full particles showed ultraviolet absorbancy typical of nucleoproteins, and were infective when assayed in Dalbulus maidis .

Development of single chain variable fragment (scFv) antibodies against surface proteins of ‘Ca. Liberibacter asiaticus’

‘Candidatus Liberibacter asiaticus’ is the causal agent of citrus huanglongbing, the most serious disease of citrus worldwide. We have developed and applied immunization and affinity screening methods to develop a primary library of recombinant single chain variable fragment (scFv) antibodies in an M13 vector, pKM19. The antibody population is enriched for antibodies that bind antigens of ‘Ca. Liberibacter asiaticus’. The primary library has more than 107 unique antibodies and the genes that encode them. We have screened this library for antibodies that bind to specifically-chosen proteins that are present on the surface of ‘Ca. Liberibacter asiaticus’. These proteins were used as targets for affinity-based selection of scFvs that bind to the major outer membrane protein, OmpA; the polysaccharide capsule protein KpsF; a protein component of the type IV pilus (CapF); and, two flagellar proteins FlhA and FlgI. These scFvs have been used in ELISA and dot blot assays against purified protein antigens and ‘Ca. Liberibacter asiaticus’ infected plant extracts. We have also recloned many of these scFvs into a plasmid expression vector designed for the production of scFvs. Screening of these scFvs was more efficient when phage-bound, rather than soluble scFvs, were used. We have demonstrated a technology to produce antibodies at will and against any protein target encoded by ‘Ca. Liberibacter asiaticus’. Applications could include advanced diagnostic methods for huanglongbing and the development of immune labeling reagents for in planta applications.

Real-time multiplex RT-PCR for the simultaneous detection of the five main grapevine viruses

A real-time multiplex RT-PCR has been developed for the simultaneous detection and identification of the major RNA viruses that infect grapevines (Grapevine fanleaf virus, Arabis mosaic virus, Grapevine leafroll-associated virus 1, Grapevine leafroll-associated virus 3 and Grapevine fleck virus). Serial dilutions of infected plant extracts were tested using the new method, and the results were compared with those obtained using a commercially available ELISA and real-time singleplex RT-PCR. The two real-time RT-PCR versions detected up to the same level of dilution and were at least 10,000 times more sensitive than the ELISA. In addition, 158 grapevine plants collected in a survey of the Protected Designation of Origin in Alicante, Spain were compared using the three methods. The results of the molecular methods were very similar, with only four discordant results, and both were able to detect many more infected plants than the ELISA. The high prevalence of Grapevine fleck virus, Grapevine leafroll-associated virus 3 and Grapevine fanleaf virus suggests that the main pathways of viral introduction are infected plant material that has escaped controls and/or uncontrolled traffic of propagating plant material. Real-time multiplex RT-PCR could be used to facilitate a better control of grapevine viruses.

Gazar virus Y, a new member of the celery mosaic virus group of potyviruses, isolated from carrots in Egypt

A novel potyvirus we call Gazar virus Y (GVY) was isolated from diseased carrot plants in Egypt. It produced symptoms similar to those caused by carrot virus Y. Its particles were visualized in leaf extracts using negative stain, and leaf tissues from carrot plants infected with GVY had many ultra-structural differences from healthy ones. Chemical analyses of healthy and infected carrot roots showed that carrot roots infected with GVY had increased dry weight and decreased moisture, total ash, total carbohydrates, total fibres, vitamin C, β-carotene, vitamin A and the minerals of K, Mg, Na, P and Ca compared to the healthy carrot roots. Molecular methods, including reverse transcription-polymerase chain reaction (RT-PCR), were used to amplify a 335 bp cDNA fragment transcribed from infected plant extracts using degenerate oligonucleotide primers specific for potyviruses. The amplified cDNA was cloned into pGEM®-T Easy vector, and transformed into Escherichia coli (E. coli) strain DH5α . The recombinant inserts were sequenced. The nucleotide sequence (GenBank Accession Code GQ148776) was matched against viral nucleotide sequences in the GenBank database. It is most closely related to viruses of the celery mosaic virus group of potyviruses, but is distinct from all and represents a sister lineage to all others described so far.

Analysis of ascorbate peroxidase genes expressed in resistant and susceptible wheat lines infected by the cereal cyst nematode, Heterodera avenae

Changes in ascorbate peroxidase (APX) enzyme activity in response to nematode (Heterodera avenae) attack were studied in roots of three hexaploid wheat lines carrying Cre2, Cre5, or Cre7 nematode resistance genes and the susceptible Triticum aestivum cv. Anza. A spectrophotometric analysis was carried out with root extracts of infected plants 4, 7, 11, and 14 days after nematode inoculation using uninfected plant as control. APX induction in infected resistant genotypes was similar and higher than in the susceptible control. The introgression wheat/Aegilops ventricosa H-93-8 line, carrying the Cre2 gene, and its parental line H-10-15 as susceptible control were used to analyze whether this increase of activity was correlated with the induction of APX gene expression. Genes encoding cytosolic forms of APX were induced in roots of both lines in response to nematode infection. This induction took place both earlier and with greater intensity in the resistant line than in the susceptible one, and it was also higher in the root area at the site of nematode attachment.

First Report of Seedborne Cherry leaf roll virus in Wild Potato, Solanum acaule, from South America

A virus, designated JCM-79, was isolated from wild potato (Solanum acaule Bitt.) plants grown from true seed received at USDA-APHIS Potato Quarantine Program from Peru. JCM-79 was mechanically transmissible to Nicotiana clevelandii and N. tabacum cv. Samsun NN. Symptoms in the original S. acaule were general chlorosis and spreading necrotic lesions. Symptoms in N. tabacum and N. clevelandii included necrotic ringspots on inoculated leaves and oak-leaf patterns or necrotic spots, respectively, on upper leaves. Cultivated potatoes (S. tuberosum) infected with JCM-79 by grafting from N. clevelandii were symptomless but virus was detected by back-inoculation to N. clevelandii. Viral nucleoproteins were purified by differential centrifugation and sucrose density gradient fractionation from N. clevelandii and N. tabacum. Transmission electron microscopy of nucleoproteins revealed isometric particles approximately 25 nm in diameter. Two RNA species of approximately 8,000 and 6,500 nucleotides were obtained from nucleoproteins digested with sodium dodecyl sulfate and Proteinase K. The above characteristics suggested JCM-79 was a nepovirus or nepovirus-like in nature. Reverse transcription (RT)-PCR tests for Cherry rasp leaf virus, genus Cheravirus, which was reported from potato (3), were negative. An approximately 1,600-bp cDNA clone was obtained from RNA of JCM-79 by oligo dT primed reverse transcription and second strand cDNA synthesis. Sequence analysis (GenBank No. GU321989) revealed the closest homology (82%) to nucleotides 327 to 1801 of Accession No. S84125 Cherry leaf roll virus (CLRV), genus Nepovirus. Subsequent RT-PCR tests with CLRV-specific primers (4) resulted in amplification of a 417-bp product from nucleic acid extracts of infected N. clevelandii and N. tabacum. The amplified product from N. clevelandii was cloned and three clones were sequenced in both directions. The consensus sequence (GenBank No. GU321988) showed approximately 90% homology to the 3' untranslated region of isolates of CLRV including those from birch, walnut, and sweet cherry (GenBank Nos. S84124, Z34265, and AJ877128, respectively). JCM-79 was also detected in extracts of infected plants by ELISA using CLRV-cherry reagents (Bioreba AG, Reinach, Switzerland). These results indicate JCM-79 represents a new variant of CLRV. To our knowledge, this is the first report of CLRV naturally infecting S. acaule. S. acaule is common in the Andean regions of South America and has been used for crosses with S. tuberosum because of its pathogen resistance (1). The fact that JCM-79 is seed transmitted in S. acaule suggests that this virus could be a threat to potato-breeding programs. Another nepo-like virus with properties similar to JCM-79, designated Potato virus U (PVU), was reported from South America, but PVU was not serologically related to CLRV (2).

First Report of Tomato torrado virus in Tomato Crops in France

In June 2008, tomato (Solanum lycopersicum L.) plants cv. Fer De Lance (De Ruiter Seeds, Bergschenhoek, the Netherlands) grown in greenhouses near Perpignan (southern France) showed growth reduction and necrotic lesions on fruits, stems, and basal parts of the leaves. Tomato torrado virus (ToTV) was suspected on the basis of symptoms and its recent description in Spain (4). Primer set A (3), designed to ToTV RNA-2, was used for reverse transcription (RT)-PCR experiments on RNA extracted from four infected plants and allowed the amplification of a 493-bp fragment. No amplification was observed from healthy plant extracts. The RT-PCR product was directly sequenced (GQ303330) and a BLAST search in GenBank revealed 99.8- and 99.5%-nt identity with Polish (EU563947) and Spanish type strain (DQ388880) isolates of ToTV, respectively. Double-antibody sandwich-ELISA tests were conducted on these four samples to check for the presence of other viruses commonly found in tomato crops in France. Tomato spotted wilt virus, Parietaria mottle virus, Cucumber mosaic virus, Tomato mosaic virus, and Potato virus Y were not detected but Pepino mosaic virus (PepMV) was detected in all samples. ToTV was mechanically transmitted to Physalis floridana but PepMV was not. This plant was used to inoculate healthy tomatoes that served as a ToTV source for further experiments. Mechanical inoculation to test plants showed that Nicotiana benthamiana, N. clevelandii, N. debneyi, N. glutinosa, Capsicum annuum, Solanum melongena, and some tomato cultivars (including Fer De Lance), in which typical necrotic symptoms were observed, were systemically infected by the virus. Isometric particles ~28 nm in diameter were observed by electron microscopy in crude extracts of infected plants negatively stained with 1% ammonium molybdate, pH 7. To confirm ToTV identification, whitefly transmission experiments were performed with Trialeurodes vaporariorum and Bemisia tabaci. Adult whiteflies were placed in cages with infected tomato plants for 1-, 24-, or 48-h acquisition access periods (AAP) before transferring them by groups of ~50 on susceptible tomato plantlets placed under small containers (six plants per AAP). Forty-eight hours later, plants were treated with an insecticide and transferred to an insect-proof containment growth room. Ten days later, RNA preparation from all plants was tested by RT-PCR for the presence of ToTV. No transmission was observed with a 1-h AAP. With a 24-h AAP, transmission to four of six test plants was observed with both whitefly species, while at 48 h, AAP transmission to three and four plants of six was observed with T. vaporariorum and B. tabaci, respectively. Noninoculated control plants were all negative by RT-PCR. These experiments confirm T. vaporariorum and B. tabaci as natural vectors of ToTV as previously described (1,2). ToTV has been already reported in Spain, Poland, Hungary, and Australia, but to our knowledge, this is the first report of ToTV in France. Our detection of ToTV in April 2009 from the same area revealed 7 positive tomato plants of 17 tested. This observation suggests the persistence of the disease in the Perpignan Region.

Identification and characterization of a novel Tritimovirus species isolated from wild Trisetum flavescens L., family Poaceae

Yellow oat-grass plants (Trisetum flavescens L.) with mild mosaic and pronounced dwarfing symptoms were observed at different locations in the Czech Republic. Electron microscope observations of symptomatic plants revealed the presence of filamentous particles and inclusion bodies characteristic of the family Potyviridae. The virus was readily mechanically transmitted to its original host plus a narrow host range of monocot species. Serological assays of infected plant extracts using antiserum specific to the closest species in the family Potyviridae were negative. The 3' end of the viral genome was cloned, sequenced and compared to sequences of species in the family Potyviridae. The virus is more closely related to viruses in the genus Tritimovirus than to other genera within the Potyviridae. Based on phylogenetic analyses of the coat protein cistron and flanking genomic regions, we propose this is a distinct viral species of the genus Tritimovirus, tentatively named Yellow oat-grass mosaic virus (YOgMV).

Detection of Bittergourd Yellow Mosaic Virus (BGYMV) in bitter gourd (Momordica charantia) through Triple Antibody Sandwitch (TAS) ELISA and Polymerase Chain Reaction (PCR)

Serodiagnosis of BGYMV revealed that ACMV polyclonal antibody and ICMV monoclonal antibody trapped the particles from the extracts of BGYMV infected bitter gourd plants. Optimum antigen and ICMV monoclonal antibody dilution to detect BGYMV was 1:10 and 1:1, respectively. A405 value at 1.10 and 1:100 antigen dilution for BGYMV infected sample was 0.949 and 0.544, respectively. A405 value at 1:1 and 1:5 ICMV monoclonal antibody dilution was 0.993 and 0.696, respectively. Polymerase chain reaction technique using Deng's degenerate primer for gemini virus amplified 560 bp fragment from BGYMV infected bitter gourd plants.

Development of immunochromatographic test systems for express detection of plant viruses

Express immunochromatographic test-strip assays were developed for detection of five plant viruses varying in shape and size of virions: spherical carnation mottle virus, bean mild mosaic virus, rod-shaped tobacco mosaic virus, and filamentous potato viruses X and Y. Multimembrane composites (test strips) with immobilized polyclonal antibodies against viruses and colloidal gold-conjugated antibodies were used for the analysis. The immunochromatographic test strips were shown to enable the detection of viruses both in purified preparations and in leaf extracts of infected plants with a sensitivity from 0.08 to 0.5 microg/ml for 10 min. The test strips may be used for express diagnostics of plant virus diseases in field conditions.

First Report of Cucumber mosaic virus and Turnip vein-clearing virus in Dichondra repens in France, Italy, and China.

During surveys of Dichondra repens (kidneyweed, family Convolvulaceae) turfs in public gardens of the Franco-Italian Riviera from 1993 to 2003, leaf mosaic and yellow ringspot symptoms have been observed in Antibes, Menton, Nice, and Vallauris (France) and San Remo and La Mortola (Italy). Isolates from these six locations and from two locations in China (Shanghai and Kunming) have revealed the presence of Cucumber mosaic virus (CMV) based on the behavior of a range of manually inoculated plants (1), the observation of 30 nm isometric particles in semipurified extracts of inoculated Nicotiana tabacum 'Xanthi' plants with the electron microscope, and positive reactions in double antibody sandwich (DAS)-ELISAs with specific polyclonal antibodies. All isolates were shown to belong to group II of CMV isolates (3) by double-immunodiffusion analysis. CMV was previously identified in D. repens in California in 1972 (4). Following isolation from local lesions on Vigna unguiculata and multiplication in 'Xanthi' tobacco plants, two of the isolates were used to inoculate seedlings of D. repens manually or by Aphis gossypii aphids. Two months later, all inoculated plants showed symptoms similar to those previously observed and were positive in DAS-ELISA. In 2000, a D. repens sample collected in Antibes showing similar symptoms as above, induced necrotic local lesions in inoculated 'Xanthi' plants in 48 h, followed by systemic mosaic symptoms typical of CMV, therefore revealing the presence of a second virus. That virus was separated from CMV in apical, noninoculated leaves of Chenopodium quinoa and then used to inoculate a range of test plants. It was infectious in most plants of the families Solanaceae (including Cyphomandra betacea) and Brassicaceae, together with in Chenopodium amaranticolor, C. quinoa, Claytonia perfoliata, Convolvulus spp. 'Belle de jour', Digitalis purpurea, Gomphrena globosa, Ocimum basilicum, Plantago lanceolata, and Valerianella olitoria. It induced asymptomatic systemic infections in D. repens. Numerous, rod-shaped, 300 nm long particles were observed in sap extracts of infected plants with the electron microscope, suggesting the presence of a tobamovirus. A set of primers polyvalent for tobamoviruses (2) allowed the amplification of a DNA product of approximately 800 bp through reverse transcription-PCR performed with total RNA extracts from inoculated 'Xanthi' plants. The DNA product was cloned and sequenced (GenBank Accession No. EU927306) revealing that the virus belonged to a tobamovirus lineage including Ribgrass mosaic virus and viruses infecting cruciferous plants (Turnip vein-clearing virus [TVCV] and Youcai mosaic virus) and was closest to TVCV (95% amino acid identity; GenBank Accession No. NC_001873). To our knowledge, this is the first report of TVCV in D. repens.

An RNA Probe for the Detection of Grapevine virus A

AbstractA specific dot‐blot hybridization assay was developed using an in vitro‐transcribed non‐radioactive RNA probe for the routine detection of Grapevine virus A (GVA) for use as an alternative diagnostic tool for large‐scale surveys. GVA was detected in RNA isolated from infected vine plants, plant extracts and tissue prints using this probe however no reaction was observed with healthy plants of genus Vitis.

Nucleotide sequence analysis and detection of a Greek isolate of Tomato chlorosis virus

Tomato chlorosis virus (ToCV) is a whitefly‐transmitted crinivirus with a bipartite RNA genome inducing yellowing diseases in greenhouse and outdoor tomato plants. In this study, both genomic RNA components of a Greek isolate (Gr‐535) of ToCV were sequenced. They contained 8594 nucleotides (nt) and 8242 nt and shared 97% and 99% sequence identity with Spanish and American isolates, respectively. Phylogenetic analysis and pairwise nucleotide and amino acid sequence comparisons showed that the Greek isolate clustered together with the American ToCV isolate. Nevertheless, the Greek and Spanish isolates shared several common deletions and extra stretches of nucleotides in the untranslated regions of their genomes when compared to the American isolate, suggesting genetic recombination. Prediction of putative structures of the 3′‐terminus of ToCV RNA 1 showed the presence of four stem loops and a pseudo‐knot, while the putative structure of the 3′‐terminus of ToCV RNA 2 varied between the three sequenced isolates. Diagnostic dot‐blot hybridization and reverse transcription–polymerase chain reaction (RT‐PCR) assays indicated that ToCV could easily be detected in 20 ng of total RNA extracts from infected plants. Dot‐blot hybridization could also be performed for virus diagnosis using infected crude plant extracts.

Moroccan watermelon mosaic virusnewly reported on zucchini squash in France

During the autumn of 2002, zucchini squash (Cucurbita pepo) plants showing severe mosaic and blisters on leaves, as well as fruit deformations, were observed near Agen, France. DAS-ELISA tests gave positive reactions for Moroccan watermelon mosaic virus (MWMV; genus Potyvirus), a virus not previously reported in France. Sample SO-06 was positive for MWMV but also for Cucurbit aphid borne yellows virus (CABYV; genus Polerovirus) and Watermelon mosaic virus (WMV; genus Potyvirus). MWMV was separated by non-persistent transmission using a single aphid (Myzus persicae) per test plant. A pure MWMV subculture was thus obtained (MWMV-Fr) and used for mechanical inoculation to differential hosts. Severe mosaic and leaf deformations were observed in zucchini squash, watermelon and cucumber, while top necrosis was observed in melon cv. Védrantais. In non-cucurbit hosts, symptomless systemic infections were detected in Ranunculus sardous and Lavatera trimestris, while only local lesions were observed in Chenopodium amaranticolor. To confirm the identification of MWMV, total RNA was extracted from infected plants using Tri-Reagent (Molecular Research Center) and tested using Takara One-Step RNA PCR kit with specific primers MWMV-5¢: AGCAAGCGCCATACTCTGA and MWMV-3¢: CAAACTCCATTAACATTCGG, designed to amplify a region of the polymerase (NIb) and coat protein (CP). RT-PCR products of the expected size of 627 bp were generated from infected plant extracts. No amplicon was produced from healthy plant extracts. An RT-PCR product amplified from isolate MWMV-Fr was directly sequenced (GenBank EF579942). This nucleotide sequence showed 97% identity to the corresponding region of the MWMV type strain from Morocco (GenBank AF305545; Lecoq et al., 2001). MWMV has been reported in Africa, Spain (Lecoq et al., 2001) and more recently in Italy (Roggero et al., 1998). MWMV could be an emerging threat for southern Europe. However, MWMV has not been detected again during intensive surveys conducted in southern France since 2004. This suggests that MWMV has not become established in France.

Induction of cinnamate 4-hydroxylase and phenylpropanoids in virus-infected cucumber and melon plants

In the present work, we have looked for the nature of the phenylpropanoids biosynthesized during the plant–pathogen reaction of two systems, Cucumis sativus and Cucumis melo infected with either prunus necrotic ringspot virus (PNRSV) or melon necrotic spot virus (MNSV), respectively. An accumulation of p-coumaric, caffeic and/or ferulic acids was observed in infected plant extracts hydrolysed with β-glucosidase or esterase. Analysis of undigested samples by HPLC/ESI revealed that these compounds are mainly forming esters with glucose: 1- O-coumaroyl-β-glucose, 1- O-caffeoyl-β-glucose, and 1- O-feruloyl-β-glucose. Cinnamic acid 4-hydroxylase (C4H, EC 1.14.13.11), the second enzyme of the plant phenylpropanoid pathway, plays a pivotal role in the synthesis of these hydroxycinnamic acids. Thus, we have isolated and characterised a cDNA clone encoding this enzyme from PNRSV-infected cucumber, and a partial cDNA from MNSV-infected melon leaves. The deduced amino acid sequence revealed a notable degree of identity with homologous C4H enzymes from other plant species. In agreement with the induction of the phenylpropanoids presently described, it is reported that in cucumber and melon leaves, both viral infections studied induced C4H mRNA expression. A similar induction was observed for the first phenylpropanoid biosynthetic enzyme, phyenylalanine ammonia-lyase (PAL, EC 4.3.1.5), and for chitinase and peroxidase defence-related genes.

First Report of Cucumber vein yellowing virus in Melon in France.

During the fall of 2003, mild mosaic symptoms were observed in melon (Cucumis melo L.) plants grown in glasshouses near Eyragues (southeastern France) resembling those caused by the Bemisia tabaci transmitted Cucumber vein yellowing virus (CVYV, genus Ipomovirus, family Potyviridae). In addition, large numbers of B. tabaci were observed to be colonizing these crops. The identification of CVYV was established through differential host range reaction, immunosorbent electron microscopy (IEM), and reverse transcription (RT)-PCR experiments. Crude sap from symptomatic leaves was used to inoculate differential host plants. Mild mosaic symptoms were observed on melon, and cucumber developed vein-clearing symptoms typical of CVYV. No symptoms were observed in Chenopodium quinoa, C. amaranticolor, Nicotiana benthamiana, N. tabacum, and Vigna sinensis. Numerous, slightly flexuous, elongated virus particles were observed in infected plant extracts; these particles were decorated by a polyclonal antiserum raised against a Sudanese CVYV isolate. To confirm CVYV identification, total RNA extracts (TRI-Reagent, Sigma Chemical, St. Louis, MO) were obtained from the original symptomatic melon tissues. RT-PCR was carried out using CVYV-specific primers CVYV-CP-5': 5'-GCTTCTGGTTCTCAAGTGGA-3' and CVYV-CP- 3': 5'-GATGCATCAGTTGTCAGATG-3' designed according to the partial sequence of the coat protein gene of CVYV-Isr (GenBank Accession No. AF233429) (2). A 540-bp fragment corresponding to the central region of CVYV coat protein was amplified from total RNA extracted from symptomatic but not from asymptomatic melon tissue. Direct sequencing was done on RT-PCR products (GenBank Accession No. EF441272). The sequence was 95 and 99% identical to that reported for CVYV isolates from Israel and Spain, respectively. CVYV was first described in Israel and has recently emerged as the cause of important diseases in Spain and Portugal (1,3). Shortly after detecting CVYV during 2003, efforts were made to eradicate the virus in susceptible crops. CVYV was not detected again during intensive surveys conducted in southeastern France during 2004, 2005, and 2006, suggesting that the CVYV detected during 2003 resulted from an accidental introduction and that the virus has not become established in France.