Infected Foliage Research Articles

First Report of Black Leaf Spot Caused by Epicoccum latusicollum on Chinese Yam in China.

Chinese yam (Dioscorea polystachya Turczaninow cv. Tiegun), which belongs to the family Dioscoreaceae, is widely cultivated throughout China due to its high economic and medicinal value. In June 2023, black leaf spots on Chinese yam (cv. Purple 1) were observed in Nanchang city (28.45° N, 115.49° E) of Jiangxi province, southeastern China. The incidence of the disease ranged between 70 and 85% of plants, and up to 30% of the leaves per plant were affected in the field over a 2-week period of study. Infected foliage displayed brown necrotic lesions, elliptical or irregular, with yellow halo at the edge of the lesion (0.5 to 3 cm diam.). To identify the causal agent, 32 symptomatic leaves of eight symptomatic plants were collected. Small pieces from the margin of necrotic leaf tissue (about 3 x 3 mm) were surface sterilized in 75% ethanol for 30 s followed in 0.1% HgCl2 for 1 min, and washed three times with ddH2O. Then, the pieces were transferred onto potato dextrose agar (PDA) plates and incubated at 26°C for 3 days with a 12-h light-dark cycle. From the 32 isolates, 21 exhibited similar morphology after hyphal tipping resulting in an isolation frequency of 65.6%. Colonies on PDA were initially white aerial hyphae but became grayish with age, and a reddish orange pigment on the underside. After 16 days of incubation, pycnidia were observed, which were dark, spherical or flat spherical, and 64.1 to 172.5 µm (n = 25) in diameter. Conidia were ellipsoidal, aseptate, hyaline, and 4.1 to 5.6 × 1.8 to 2.7 µm (n = 80). In addition, a blackish green discoloration was produced on malt extract agar (MEA) using the NaOH spot test. The isolates were tentatively identified as Epicoccum spp. based on morphological characteristics (Chen et al. 2017). Isolate AYZ-1 was randomly selected for identification and pathogenicity testing. Genomic DNA of the isolate (AYZ-1) was extracted and amplified by polymerase chain reaction (PCR) using ITS1/ITS4 for the internal transcribed spacer (ITS) region (White et al. 1990), Btub2Fd/Btub4Rd for the β-tubulin (TUB) region (Woudenberg et al. 2009), LROR/LR7 for the large ribosomal RNA gene (LSU) region (Rehner and Samuels 1994), and RPB2-5F2/fRPB2-7cR for RNA polymerase II second largest subunit (RPB2) region(Liu et al. 1999), respectively. The concatenated sequences (GenBank Accession No. OR574165, OR567827, OR574166, OR567828, respectively) shared 99.8 to 100% identity withEpicoccum latusicollum(OP788080, MN329871, OR428532, and OL422485, respectively). A neighbor-joining phylogenetic tree was generated based on the concatenated sequences in MEGA7, placed isolate (AYZ-1) within E. latusicollum. To fulfill Koch's postulates, healthy leaflets from three one-year-old Chinese yam (cv. Purple 1) were used as inoculation materials, using isolate AYZ-1. Two sites of each leaf were wounded with a sterile needle and covered with a piece of cotton drenched with 200 µL spore suspension (106 conidia/mL) on the left sides, while sterilized water served as the control on the right sides of leaves. All inoculated leaves were covered with clear polyethylene bags for 24 h. Plants were grown outdoors at a daily average temperature of 26°C with relative humidity over 45%. After 7 days of incubation, the leaves showed the same symptoms as the original diseased leaves. The E.latusicollumisolate was re-isolated from diseased leaves and confirmed by morphology and sequencing analysis, fulfilling Koch's postulates. E.latusicollumhas beenpreviously reportedtocauseblack root on yam inChina'ssouth-westernprovince ofSichuan(Han et al. 2019). Meanwhile,leafspothave been reportedon many plants by this genus, such astobacco(Guo et al. 2020) andbanana(Liu et al. 2023). According to our knowledge, this is thefirstreportofE.latusicollumcausingblack leafspoton Chinese yam inChina. This finding will provide an important reference for understanding the biology of E. latusicollum and the distribution of the disease, but more research is needed to determine if management is warranted.

PHYTOPHTHORA RAMORUM FOLIAR INFECTION REDUCES LEAF-LEVEL PRODUCTIVITY IN TANOAK AND CALIFORNIA BAY: A PILOT STUDY FROM REDWOOD NATIONAL PARK

Woody plant infections of the pathogenic oomycete Phytophthora ramorum Werres, DeCock, & Manin'tVeld have brought an uncertainty to the future of western forests. Two understory hardwoods, tanoak (Notholithocarpus densiflorus (Hook. and Arn.) Manos, C.H.Cannon, and S.Oh) and California bay (Umbellularia californica (Hook. & Arn.) Nutt.), are commonly infected with P. ramorum leaf infection, the nonfatal foliar form of this pathogen. As the fatal bole infection form of this pathogen is most commonly studied, comparatively little research has been conducted on the nonfatal foliar infection form. This study measured physiological characteristics (midday water potential, stomatal conductance, net photosynthesis, and water-use efficiency) of healthy and infected foliage from tanoak and California bay trees in Redwood National Park to determine the effects P. ramorum foliar infection on leaf-level productivity. For both species, midday water potential, stomatal conductance, and net photosynthesis were all lower in infected samples compared to healthy samples. There was no significant difference in instantaneous water-use efficiency between infected and healthy foliage. Results suggest that P. ramorum leaf infection can lower leaf-level productivity and water status. Further research on the subject is still needed to better support informed management decisions in infected forests and to predict the long-term effects of P. ramorum leaf infections across a diverse suite of host species in the Pacific Northwest.

First Report of Myrothecium Leaf Spot Caused by Myrothecium roridum on Pepper in the United States

In September, 2015, an outbreak of leaf spot on pepper (Capsicum annuum) on variety cv. 9325 under conventional production (Pernezny et al. 2003) was reported from the Colquitt County, Georgia (approximately 5% of a 0.5 ha field was symptomatic). Infected foliage displayed round to oblong, dark brown lesions with distinct concentric rings (8-10 mm in diameter). Discoloration of the stem was also observed. Ten symptomatic leaves were collected and a section of each symptomatic leaf tissue was placed onto potato dextrose agar (PDA) media amended with 35 mg/L streptomycin. After incubation at 25o C for four days, floccose buff colonies with black-colored sporodochia in concentric rings were observed, similar to the genus Myrothecium (Seebold et al. 2005) were observed. Smooth, hyaline, and narrowly ellipsoid conidia (dimension: 7.5-8.8µm×2.1-2.7µm) with rounded ends were observed through light/compound microscope. To confirm the iIdentity of isolated pathogen was confirmed after DNA extraction and amplificat...

Sporulation potential, symptom expression and detection of Phytophthora ramorum on larch needles and other foliar hosts

Phytophthora ramorum has caused extensive dieback and mortality of commercially grown Japanese larch (Larix kaempferi) in many parts of the UK, as infected foliage generates spores that then cause bark lesions and girdling cankers on trees. Following inoculation, individual needles of Japanese, European (L. decidua) and hybrid (L. × eurolepis) larch infected with P. ramorum can produce thousands of sporangia. Mean numbers of sporangia ranged from 806 to 1778 per cm2 (hybrid larch and Japanese larch, respectively), surpassing mean sporulation levels on foliar hosts previously associated with P. ramorum outbreaks in Britain, namely Rhododendron ponticum, Castanea sativa and Vaccinium myrtillus. Sporulation on larch even exceeded that of California bay laurel (Umbellularia californica), which drives the sudden oak death epidemic in California. Inoculation of foliage selected at different times of year revealed that foliage age significantly affected sporulation levels, but this varied with host species. However, symptom development and sporulation were often not correlated. Symptoms on larch were frequently insignificant or even absent at certain times of year, with sometimes the only evidence of infection being the emergence of sporangia from needles, without any sign of discolouration or necrosis. Plating infected but symptomless needles onto Phytophthora selective medium also often failed to yield the pathogen. Symptomless infection of larch needles apparently occurs, but is only detectable with microscopy. More generally, it is suggested that diagnosis of Phytophthora infection in conifers is often underestimated due to isolation difficulties and delayed symptom expression.

First Report of Late Blight Caused by Phytophthora infestans Clonal Lineage US-23 on Potato in Idaho.

Late blight, caused by Phytophthora infestans (Mont.) de Bary, is a destructive disease of potato (Solanum tuberosum) and tomato (S. lycopersicum) in the United States. Prior to 2007, the US-8 clonal lineage was the predominant genotype in the United States (4). Since 2007, a significant genetic change in the population of P. infestans occurred in the eastern United States with the appearance of new isolates with unique genotypes and epidemiological characteristics (3). These new genotypes US-22, US-23, and US-24 are sensitive to metalaxyl and represent mating types A2, A1, and A1, respectively (1,2). Prior to 2012, only US-8 had been documented in Idaho (5). In 2013, late blight was discovered in late August on potato crops (cv. Russet Norkotah) in Bingham and Madison counties, ID. Infected foliage (four samples from Bingham County and five from Madison) was sent to Michigan State University and the University of Wisconsin for confirmation of P. infestans and characterization of the isolates. Five sections from the leading edge of lesions were excised with a sterilized scalpel and placed on potato tuber slices ('Dark Red Norkotah'). Pathogen sporulation on the excised lesions was enhanced by incubation in plastic boxes lined with moistened paper towels for 5 days at 18°C in the dark. The sporulating lesions were transferred onto pea agar medium (160 g peas, 5 g sucrose, 15 g agar, 700 ml distilled water) amended with 50 mg/ml vancomycin. Ten pure cultures were obtained for each of 4 isolates per county by hyphal tipping. Cellulose acetate electrophoresis was conducted to determine Gpi allozyme genotype of the 4 isolates (4). The allozyme banding patterns were 100/100 at the Gpi locus, consistent with previously reported analyses of the US-23 genotype (1,2). Genomic DNA was extracted from 10 pure cultures using the DNeasy Plant Mini Kit (Qiagen, Germantown, MD), and SSR analyses were performed. Microsatellite markers Pi02, Pi4B, Pi63, PiG11, and D13 were used in SSR analyses. Pi02, Pi4B, and Pi63 had alleles of 162/164, 213/217, and 270/279 bp in size, respectively which is consistent with the reference US-23 genotype (1). However, heterozygosity was detected at locus D13 in the Idaho genotype with allele size of 134/210 bp and an additional allele of 140/155/176 bp at locus PiG11. This is different from the standard US-23 genotype (homozygous alleles 134/134 at locus D13 and two alleles 140/155 at locus PiG11). These allele changes indicate the isolates may be variants of US-23 isolates as all other phenotypic characteristics were similar to those of reference US-23 isolates. The Idaho genotypes were sensitive to metalaxyl both in vitro on rye A agar medium amended with metalaxyl at <0.1 ppm, and in vivo on Ridomil treated foliage tests at <0.1 ppm (1,2). Mating type assays confirmed the pathogen to be the A1 mating type. In the 2009 and 2010 late blight epidemics in the eastern United States, US-23 was the predominant genotype, but to our knowledge this genotype has never been reported previously in Idaho. Thus, this is the first known report of P. infestans genotype US-23 causing late blight on potato in Idaho, indicating a change in the population of P. infestans. In Idaho, the source of this genotype remains unknown, although infected tomatoes have been implicated in the widespread dissemination of this genotype of P. infestans in the eastern United States.

First Report of Cladosporium Leaf Spot of Spinach Caused by Cladosporium variabile in North Carolina.

Cladosporium leaf spot of spinach, caused by Cladosporium variabile, can result in significant economic losses in the United States (2). In March 2014, symptoms consistent with Cladosporium leaf spot (4) appeared on the spinach cultivar Tyee in a greenhouse located in Rowan County, NC. Of 1,080 spinach plants, 90 to 100% were infected. Symptoms consisted of small (1 to 3 mm in diameter), circular, tan lesions each outlined with a dark margin on the adaxial surface of the leaf. On severely infected foliage, lesions coalesced to produce relatively large necrotic regions. Profuse fungal sporulation was observed on the lesion surface with a dissecting microscope at 40× magnification. Using a dissecting microscope, conidia were collected with a sterile needle and transferred to petri plates containing potato dextrose agar. Plates were then incubated at 23 ± 2°C under continuous fluorescent light, and fungal growth was apparent after 24 h. Isolations from leaves of six infected plants produced slow-growing, dark green to brown fungal colonies that reached only 31 mm in diameter after 14 days, which is characteristic of C. variabile (4). Colonies contained dense masses of dematiaceous, septate, unbranched conidiophores with conidial chains, each containing up to five conidia. Conidia were ovate to elongate, with some being septate. The length of individual conidia ranged from 10 to 19 μm. Conidial septa were distinctly dark when observed at 100× magnification, which is a defining feature of C. variabile vs. the conidia of C. macrocarpum (4). The surface of the conidia appeared verrucose at 100× magnification, and conidia were each distinctly darkened toward the base. A single isolate obtained through single-spore transfer was used for DNA extraction, and the histone 3 (H3) gene sequence was amplified using the primers CYLH3F and CYLH3R (1). Sequence analysis of the amplified product using BLAST analysis indicated that the H3 sequences had 100% identity to that of a C. variabile isolate (GenBank Accession No. EF679710.1), and 99% identity to a C. macrocarpum isolate (EF679687.1). The H3 sequence from a representative isolate was deposited in GenBank (KJ769146). To our knowledge, this is the first report of Cladosporium leaf spot on spinach in North Carolina based on morphological evaluation and H3 sequencing results. C. variabile is a seedborne pathogen, so it is possible inoculum was introduced into the greenhouses in North Carolina on infected seed (3). Seeds can be treated with hot water or chlorine to reduce the risk of disease outbreaks caused by infected seed (2). Furthermore, Cladosporium leaf spot may be controlled with the use of fungicides (3).

Infection by a foliar endophyte elicits novel arabidopside-based plant defence reactions in its host, Cirsium arvense.

Endophytic fungi live asymptomatically within plants. They are usually regarded as nonpathogenic or even mutualistic, but whether plants respond antagonistically to their presence remains unclear, particularly in the little-studied associations between endophytes and nongraminoid herbaceous plants. We investigated the effects of the endophyte Chaetomium cochlioides on leaf chemistry in Cirsium arvense. Plants were sprayed with spores; leaf material from both subsequent new growth and the sprayed leaves was analysed 2 wk later. Infection frequency was 91% and 63% for sprayed and new growth, respectively, indicating that C. cochlioides rapidly infects new foliage. Metabolomic analyses revealed marked changes in leaf chemistry with infection, especially in new growth. Changes in several novel oxylipin metabolites were detected, including arabidopsides reported here for the first time in a plant species other than Arabidopsis thaliana, and a jasmonate-containing galactolipid. The production of these metabolites in response to endophyte presence, particularly in newly infected foliage, suggests that endophytes elicit similar chemical responses in plants to those usually produced following wounding, herbivory and pathogen invasion. Whether endophytes benefit their hosts may depend on a complex series of chemically mediated interactions between the plant, the endophyte, other microbial colonists and natural enemies.

First Report of Phoma glomerata Associated with the Ascochyta Blight Complex on Field Pea (Pisum sativum) in Australia.

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as "black spot disease" in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5'GTTTCCGTAGGTGAACCTGC 3') and AB28 (5'ATATGCTTAAGTTCAGCGGGT 3') were used to amplify extracted DNA from the 3' end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5' end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml-1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species.

Growth-inhibiting Fungicides Affect Detection of Phytophthora ramorum from Infected Foliage and Roots

Growth-inhibiting fungicides are used routinely to control common and regulated Oomycete pathogens. This study investigated whether such fungicides could affect detection of Phytophthora ramorum from plant tissue, both foliage and roots. Whole plants of Rhododendron × ‘Cunningham's White’ were inoculated with P. ramorum and treated 3 days later with fosetyl-Al, mefenoxam, or propamocarb. The foliage was sampled over time to see if fungicides prevented successful culturing of the pathogen from infected leaf tissue or interfered with detection using real-time PCR or ELISA. Mefenoxam significantly reduced the ability to culture the pathogen from leaves for the first 6 weeks while recovery from leaves treated with other fungicides did not differ from water-treated controls; detection using PCR or ELISA was not affected by fungicide application. The roots of Viburnum cuttings were inoculated with P. ramorum and then treated 4 days later with fosetyl-Al, mefenoxam, or propamocarb. The amount of inoculum in flow through water samples taken weekly for 5 weeks was quantified and percent root colonization determined at the end of the experiment. Propamocarb had no effect on inoculum production or root infection, while viable inoculum production was significantly decreased in fosetyl-Al- or mefenoxam-treated plants over 5 weeks, and root colonization was significantly decreased. Accepted for publication 23 January 2014. Published 18 March 2014.

Growth-inhibiting Fungicides Affect Detection of Phytophthora ramorum from Infected Foliage and Roots

Growth-inhibiting Fungicides Affect Detection of Phytophthora ramorum from Infected Foliage and Roots

Resveratrol stimulates phenolic metabolism and PSII efficiency in wheat infected with powdery mildew

The beneficial effects of trans-resveratrol on pathogen-response and its physiological mechanisms were studied in two wheat cultivars differing in the level of resistance against powdery mildew (Blumeria graminis (DC.) Speer). Resveratrol induced phenolics metabolism in a manner that lead to increased phenylalanine ammonia-lyase (PAL) and β-D-glucosidase activity in leaf regions showing no symptoms of pathogen infection. In less-resistant cultivar, similar alterations were additionally observed in regions invaded by the pathogen. Resveratrol also stimulated photosynthetic efficiency during pathogenesis and this effect was more prominent in the resistant cultivar. Regulatory function of resveratrol on wheat growth and development was also observed (stimulation of generative induction). High performance liquid chromatography (HPLC) analysis detected a low amount of compound with retention time corresponding to trans-resveratrol in healthy leaves and increased the content of this compound in infected foliage. The multidirectional properties of resveratrol activity in wheat plants are discussed.

Two Cycles of Recurrent Maternal Half-Sib Selection Reduce Foliar Late Blight in a Diploid Hybrid Solanum phureja-S. stenotomum Population by Two-thirds

Foliar late blight, caused by Phytophthora infestans, is an important disease problem worldwide. Foliar resistance to late blight was found in a hybrid population of the cultivated diploid species Solanum phureja-S. stenotomum (phu-stn). The objective of this study was to determine if resistance to late blight could be improved by recurrent maternal half-sib selection in the phu-stn population. Four clones from each of 72 maternal half-sib families plus the check cultivar ‘Atlantic’ were evaluated for late blight resistance in replicated field trials in Pennsylvania. The most late blight resistant clone from each of the 72 families was randomly intermated to advance the population. The cycle 1, 2, and 3 populations were evaluated in 1996–1997, 2003–2004, and 2009–2010, respectively. Percent infected foliage was recorded several times towards the end of the growing season and used to compute area under the disease progress curve (AUDPC). Mean AUDPC was 652 (cycle 1), 556 (cycle 2), and 276 (cycle 3), whereas the mean AUDPC of ‘Atlantic’ ranged from 775 to 863 each cycle. Narrow-sense heritability for resistance was estimated as 0.78, 0.77, and 0.80 in cycles 1, 2, and 3, respectively. Recurrent maternal half-sib selection continues to improve the levels of resistance to late blight in this diploid population with no adverse effect on the amount of additive genetic variance. Additional improvements for late blight resistance are likely to occur if this approach is continued.

Determination of Resistance to Phytophthora infestans on Potato Plants in Field, Laboratory and Greenhouse Conditions

An experiment was conducted to determine the host resistance of potato against Phytophthora infestans for twenty-five potato genotypes in 2010 and 2011 at Khumaltar, Lalitpur, Nepal using four assays: three for foliage resistance (field, whole-plant and detached leaf) and one for tuber resistance (tuber slice). An isolate of P. infestans collected from Lalitpur (LPR-1) was used for inoculation at a concentration of 3 x 103 sporangia ml-1 in all assays. Infected foliage area in the field and whole-plant assays, lesion size on detached leaves, and colony growth on tuber slice were all individually converted to 0-9 interval scale for susceptibility. Field assessment, considering the most robust measure of resistance, was used as benchmark for comparing the other assays. Sixteen of the genotypes had very little disease in the field (scale value <1) indicating they were probably expressing race-specific resistance, which has historically been short lived. Susceptibility levels measured in the whole-pant assay were highly correlated (r = 0.90) with converted field scale values, although the correlation was lower for the detached leaf assay (r = 0.63) and least for tuber-slice assay (r = 0.46). Low correlation in the detached leaf assay was assumed to represent lower resolution of the single-cycle assay. Low correlation in the tuber assay may have also reflected genetic differences as foliage and tuber blight resistance are not always correlated. Genotypes with extreme resistance in the field were frequently identified as having partial resistance in the other assays, which could mistakenly be interpreted as more durable field resistance. The consequences for selecting durable resistance are discussed.

Genetic Structure of Clavibacter michiganensis subsp. michiganensis Populations in Michigan Commercial Tomato Fields.

Clavibacter michiganensis subsp. michiganensis, causal agent of bacterial canker of tomato, is distinguished into four fingerprint types (A, B, C, and D) using BOX-polymerase chain reaction (PCR). To characterize the variation within the C. michiganensis subsp. michiganensis population in Michigan, 718 strains of C. michiganensis subsp. michiganensis were isolated from infected foliage and fruit collected from 14 and 9 Michigan commercial tomato fields in 1997 and 1998, respectively. The frequency of PCR types detected with BOX-PCR in all strains, and Bayesian cluster analysis, pairwise differentiation index comparisons, and genetic diversity estimates of 96 strains genotyped for six virulence-related genes revealed that C. michiganensis subsp. michiganensis populations in Michigan tomato fields are geographically structured. A multilocus haplotype cladogram was also consistent with geographic stratification in C. michiganensis subsp. Michiganensis populations. Some regions had strains predominantly of only one PCR type or belonging mostly to one genetic cluster, while other regions presented more diversity of occurrence of PCR types and genetic clusters. Results derived from this study provide information about the genetic structure of C. michiganensis subsp. michiganensis populations in Michigan and genetic diversity of C. michiganensis subsp. michiganensis inocula, which is key in developing disease management strategies.

First Report of Phoma herbarum on Tedera (Bituminaria bituminosa var. albomarginata) in Australia.

Tedera (Bituminaria bituminosa (L.) C.H. Stirton var. albomarginata) has been successfully established across the mixed-farming (wheat-sheep) region of Western Australia because this species has remarkable drought tolerance and can survive the dry-summer period with strong retention of green leaf. A leaf spot symptom involving pale brown lesions with distinct dark brown margins had been observed in genetic evaluation plots of tedera at Medina and Mount Barker, Western Australia, and a Phoma sp. was isolated. Single-spore isolations of a typical Phoma sp. isolate were made onto potato dextrose agar and maintained at 20°C, and a representative culture has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13435). Amplification of the internal transcribed spacer (ITS) 1 and ITS2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 according to published protocol (3). The DNA PCR products were sequenced and BLAST analyses was used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Phoma herbarum. Isolates also showed morphological (e.g., 1) and molecular (e.g., 2) similarities with P. herbarum as described in other reports. The relevant sequence information for a representative isolate has been lodged in GenBank (Accession No. JQ282910). A conidial suspension of 107 conidia ml-1 from a single-spore culture was spray inoculated onto foliage of 6-week-old tedera plants maintained under >90% relative humidity conditions for 72-h postinoculation. Symptoms evident by 10 days postinoculation consisted of pale brown lesions, mostly 1.5 to 4 mm in diameter, which developed a distinct, dark brown margin. Occasional lesions also showed a distinct chlorotic halo extending 1 to 1.5 mm outside the boundary of the lesion. Infection studies were successfully repeated twice and P. herbarum was readily reisolated from infected foliage. No disease was observed on and no P. herbarum were isolated from water-inoculated control plants. Except for a recent published report of P. herbarum on field pea (Pisum sativum L.) (2), this pathogen has only been noted in the Australian Plant Pest Database as occurring on lucerne (Medicago sativa L.) and soybean (Glycine max (L.) Merr.) in Western Australia in 1985 and on a Protea sp. in 1991. To our knowledge, this is the first published report of P. herbarum as a pathogen on tedera in Australia or elsewhere. That P. herbarum occurs on other hosts in Australia and has a wide host range elsewhere together suggest its potential to be a pathogen on a wider range of host genera and species.

First Report of Phoma herbarum on Field Pea (Pisum sativum) in Australia.

Black spot disease on field pea (Pisum sativum) in Australia is generally caused by one or more of the four fungi: Mycosphaerella pinodes (anamorph Ascochyta pinodes), Phoma medicaginis var. pinodella (synonym Phoma pinodella), Ascochyta pisi, and Phoma koolunga (1,2,4). However, in 2010 from a field pea blackspot disease screening nursery at Medina, Western Australia, approximately 25% of isolates were a Phoma sp. that was morphologically different to Phoma spp. previously reported on field pea in Western Australia, while the remaining 75% of isolates were either M. pinodes or P. medicaginis var. pinodella. Single-spore isolations of 23 isolates of this Phoma sp. were made onto potato dextrose agar. A PCR-based assay with the TW81 and AB28 primers was used to amplify from the 3' end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5' end of the 28S rDNA. The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank for P. herbarum. Isolates also showed morphological similarities to P. herbarum as described in other reports (e.g., 3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. JN247437). The same primers were used by Davidson et al. (2) to identify P. koolunga, but none of our 23 isolates were P. koolunga. A conidial suspension of 107 conidia ml-1 from a single-spore culture was spray inoculated onto foliage of 10-day-old Pisum sativum cv. Dundale plants maintained under >90% relative humidity conditions for 72 h postinoculation. Symptoms evident by 11 days postinoculation consisted of pale brown lesions that were mostly 1.5 to 2 mm long and 1 to 1.5 mm wide. Approximately 50% of lesions showed a distinct chlorotic halo extending 1 to 2 mm outside the boundary of the lesion. P. herbarum was readily reisolated from infected foliage. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13499). Outside of Australia, P. herbarum, while generally considered a soilborne opportunistic pathogen, has been reported on a wide range of species, including field pea (3). Molecular analysis of historical isolates collected from field pea in Western Australia, mostly in the late 1980s, did not show any incidence of P. herbarum, despite this fungus being reported on alfalfa (Medicago sativa) and soybean (Glycine max) in Western Australia in 1985 (Australian Plant Pest Database). In Western Australia, this fungus has also been recorded on a Protea sp. in 1991 and on Arabian pea (Bituminaria bituminosa) in 2010 (Australian Plant Pest Database). To our knowledge, this is the first report of P. herbarum as a pathogen on field pea in Australia. These previous reports of P. herbarum on other hosts in Western Australia and the wide host range of P. herbarum together suggest the potential for this fungus to be a pathogen on a wider range of genera/species than field pea.

First Report of Brown Ring Patch Caused by Waitea circinata var. circinata on Poa annua and Agrostis stolonifera in New Jersey.

Waitea circinata var. circinata was first reported as the causal agent of brown ring patch on annual bluegrass (Poa annua L.) in the United States in 2007 (2). In early April to mid-June of 2009, circular to irregularly shaped yellow rings resembling symptoms of this disease were observed on an annual bluegrass putting green at Rutgers University in North Brunswick, NJ. Severely infected foliage eventually turned brown as the disease progressed. During the same time period, similar disease symptoms were observed on creeping bentgrass (Agrostis stolonifera L.) from a golf course in Bedminster Township, NJ. The disease reappeared in both locations in April of 2010. Five additional samples with similar symptoms on creeping bentgrass and annual bluegrass were received at Rutgers Diagnostic Laboratory from Paramus, Madison, Allamuchy, and Farmingdale, NJ between late April and early May of 2010. Portions of diseased leaf and sheath tissue that displayed symptoms of the disease were disinfested for 1 min in 0.5% NaOCl, rinsed with sterile distilled water, and plated on potato dextrose agar (PDA) amended with 50 mg/liter of streptomycin sulfate. At the first sign of fungal growth, single hyphal tips were transferred to PDA. After 1 week at 25°C, white-to-orange mycelial colonies formed in culture and eventually turned brown with age. Minute sclerotia (≤3 mm), which followed the same color development pattern, formed within 10 days. These features are consistent with those described of W. circinata var. circinata (2,3). The internal transcribed spacer (ITS) region of the ribosomal RNA gene was amplified using primer pair ITS1/ITS4 and sequenced with ITS4 (GenBank Accession Nos. HQ166065 to HQ166071). BLASTn analysis of the ITS sequences showed a 99 to 100% similarity to W. circinata var. circinata sequences deposited in GenBank (1,2). Pathogenicity tests were conducted in 2010 using 6-week-old creeping bentgrass seedlings cv. Declaration inoculated with colonized oat grain that had been autoclaved and then infested with the Bedminster Township isolate. Eight colonized oat grains were uniformly spread around the crowns of seedlings grown in 10-cm-diameter pots. Control plants were treated with autoclaved grain. Plants were incubated at 25°C and high humidity maintained by misting the plants three times per day. Within 3 days postinoculation, foliage near infested grain turned chlorotic. All foliage in pots became completely blighted and spherical orange-brown sclerotia were observed on leaf sheaths by the eighth day. W. circinata var. circinata was consistently reisolated from inoculated plants (as confirmed by isolate morphology and ITS sequencing) but not from control plants. The ITS sequence data, morphological characters of the isolates, and pathogenicity tests demonstrate that W. circinata var. circinata is present in New Jersey. To our knowledge, this is the first report of W. circinata var. circinata infecting turfgrass in New Jersey.

Parasitoids aid dispersal of a nonpersistently transmitted plant virus by disturbing the aphid vector

1 Aphids are the major group of insects that vector plant viruses, and they often display a preference for foliage showing disease symptoms. Although this behaviour will increase the numbers of vectors acquiring the pathogen, it will not in itself result in a greater spread of the disease. 2 The present study examined how infection of Vicia faba by the nonpersistently transmitted virus bean yellow mosaic virus (BYMV) affected colonization by pea aphids Acyrthosiphon pisum. We then examined how foraging by the hymenopterous parasitoid Aphidius ervi affected aphid settling/movement behaviour and the consequences for dissemination of the virus. 3 In Petri dish arenas, aphids colonized discs from BYMV-infected leaves more rapidly than discs from uninfected plants. Reflectance from infected foliage was approximately 20% higher than from uninfected leaves in the green–yellow wavelengths, indicating that aphids might be responding to visual cues from the brighter foliage. Settling was reduced by A. ervi, with the foraging wasps preventing the aphids reaching and/or remaining on the leaf tissue. 4 In multiple plant arenas, A. ervi caused a reduction in aphid numbers but also a nine-fold increase in BYMV infection. It is hypothesized that disturbance by the parasitoids resulted in more aphid movement as well as more cases of aphids probing on a BYMV-infected plant and then a new host within the critical time period for successful inoculation to occur. This effect of parasitoids on virus dispersal should be considered in epidemiological models of insect-vectored plant diseases, and also when evaluating the use of natural enemies in biocontrol strategies of insect herbivore/vector pests.

Puccinia hemerocallidis

<i>Puccinia hemerocallidis</i>

First Report of Downy Mildew on Nursery-Grown Hellebore Caused by Peronospora pulveracea in California.

Hellebore or Lenten rose (Helleborus × hybridus) is an evergreen, herbaceous perennial in the family Ranunculaceae. Hellebores are sold as decorative, potted plants and as shade-loving landscape plants favored for their attractive and prolonged blooms in late winter or early spring. In April of 2008, downy mildew-like growth was observed on the foliage of approximately 60 containerized plants of Helleborus 'Blue Lady', 'Pink Lady', 'White Lady', and 'Royal Heritage' grown outdoors in a retail nursery in coastal San Mateo County, California. Infected foliage had angular, vein-delimited, dark brown-to-black speckled lesions on adaxial leaf surfaces turning dry and necrotic with age. Young leaves were small and distorted. Affected flowers were spotted and brown. The abaxial sides of affected leaves had light brown-to-purplish downy mildew-like growth. Subhyaline conidia, globose to ellipsoid in shape, ranged from 25 to 31 × 17 to 24 μm (average 28 × 21 μm). Conidiophores ranged from 265 to 375 × 5 to 11.5 μm (average 333 × 8.9 μm), branching dichotomously four to five times in the upper half. Morphological measurements fell within the range previously described for Peronospora pulveracea and P. alpicola, which were reported on Helleborus spp. and Ranunculus aconitifolius, respectively (1,2). DNA sequence of the internal transcribed spacer region of rDNA of our isolate (Genbank Accession No. FJ384778) matched sequences of P. pulveracea (Genbank Accession No. AY198270) and P. alpicola (Genbank Accession No. AY198271) with 100% identity. These two organisms are taxonomically indistinguishable by rDNA sequences and are likely to be the same species (3). To our knowledge, this is the first report of P. pulveracea on Helleborus × hybridus in California and the United States. Lenten rose is commercially propagated by seed, which is a potential pathway for introduction of this pathogen. Mature plants are sold and shipped intra- and interstate as decorative flowering plants or nursery stock. The importance and economic impact of this disease is limited, but significant economic losses could occur during production.