infB Gene Research Articles

Proteus mirabilis and Klebsiella variicola associated with onion bacterial streak and bulb rot

The bulb onion (Allium cepa) is second only to tomatoes in value of vegetable crops cultivated worldwide. Water-soaked lesions, bleaching and blight on leaves and slippery skin, sour skin, soft rot near the neck and centre rot on onion bulbs were observed in surveys of the onion fields, storage as well as fruit and vegetable markets of northwestern provinces of Iran in 2020. Thirty-four samples were collected from onion fields of East Azerbaijan, West Azerbaijan and Zanjan provinces and the central storage of Bonab city. Fifty bacterial strains were isolated from symptomatic samples. Pathogenicity of the strains was confirmed by inoculating on onion bulb cultivars Azarshahr and Ghermez Anari. Twenty-eight strains were able to induce soft rot on the inoculated sites of cut onion bulbs. Onion bulbs turned dark brown at lesion sites and became odorous over time. All pathogenic strains were Gram-negative, facultative aerobic and catalase positive. Strains mainly varied in starch and aesculin hydrolysis, potato rot and hypersensitive reaction. Pathogenic strains separated into four groups based on phenotypic assays. In the phylogenetic tree based on concatenated sequences of gyrB and infB genes, the strains were divided into four clusters containing the type strains of Enterobacter ludwigii, Klebsiella variicola, Proteus mirabilis and Pantoea agglomerans, confirming their identity as belonging to these four species. This is the first report of P. mirabilis as a plant pathogen and of K. variicola as a causal agent of onion bulb rot. Moreover, this is the first report of E. ludwigii and P. agglomerans associated with onion bulb rot in Iran.

Oriental beech decline caused by Brenneria alni

AbstractHyrcanian forests comprise a long strip along the southern coast of the Caspian Sea in northern Iran. Oriental beech (Fagus orientalis) is one of the most valuable forest tree species in the Hyrcanian forests. Bark necrosis and bleeding spots of oriental beech were observed in Savadkuh forests in Mazandaran province during summer 2021. Ten samples were collected from symptomatic oriental beech trees. The bark canker symptoms included stem tissue necrosis, dark brown to black spots on the trunk, bleeding with dark exudates and dark lesions in the inner bark. Twenty‐six strains of culturable bacteria were isolated from the samples which in culture were predominantly round, convex, smooth with entire margins on nutrient agar and a metallic green sheen pigment on eosin‐methylene blue (EMB) agar. Fourteen strains induced necrosis and browning of the tissues around the inoculation sites on acorns after 2 weeks. Five representative strains also caused dieback in twigs of oriental beech 3 weeks after inoculation. These bacteria were Gram‐negative, catalase positive and oxidase negative. All strains produced colonies with a green metallic sheen on EMB agar. Strains were negative in tests for starch and gelatine hydrolysis or production of levan. A phylogenetic tree based on concatenated sequences of gyrB and infB genes, of representative strains well as in each of the single gene‐based phylogenetic trees, indicated that these strains clustered with Brenneria alni NCPPB 3934T with high bootstrap values. To the best of our knowledge, this is the first report of B. alni associated with bark necrosis and bleeding spots on oriental beech.

First Report of Bulb Rot Disease of Banana Caused by Klebsiella variicola in China.

Banana (Musa spp.) is an economically important fruit and food crop globally as well as in China. In March 2023, a bulb rot disease was observed on more than 20% of cultivated dwarf bananas in a plantation in Wuming County of Guangxi Province, a major hub of banana production in China. Infected plants showed crackles at the basal part of stem and were relatively dwarf, while yellowing of the leaves was not observed. When the rhizomes were cut open, water-soaked lesions with a yellow or black margin can be seen in the bulb. In severe infections, the internal tissue became dry or wet rot, and there was typical dark-brown cavity formation in the bulb. The rot was limited to the bulb. To isolate the causal agent, dissected diseased tissues (5×5 mm) were surface sterilized with 75% ethanol (30 s) and 2% NaClO (3 min), followed by three rinses with sterile water. The sterilized sections were soaked in 2 mL of sterile water and shaken for 5 min in a vortex oscillator. The suspension was streaked on Luria-Bertani (LB) agar medium, and incubated at 28℃ for 24 h. Single colonies were re-streaked three times to obtain purified isolation. Twelve pure bacterial cultures with similar morphology were isolated from three plants taken from the field. The bacterial colonies were yellowish white, mucoid, round, and raised with translucent surfaces on the LB agar plate. Three strains Gxkv1, Gxkv2 and Gxkv3 were selected for further analyses. The 16S rDNA gene (GenBank Accession OR461756, PP094726 and PP109349) were amplified using primer pair 27F/1492R (Frank et al. 2008). Comparing 16S sequences against GenBank showed 99.86%-100% sequence identity to Klebsiella variicola strain (MZ475068) for the three isolates Gxkv1 (1,398/1,398 bp), Gxkv2 (1,398/1,396 bp) and Gxkv3 (1,398/1,398 bp). A multilocus phylogenetic analysis was conducted by neighbor-joining method (1,000 bootstrap values) based on three housekeeping gene sequences of gyrA (GenBank Accession No. OR515493, PP105747, PP105748), rpoB (OR515494, PP105751, PP105752 ) and infB (OR515495, PP105749, PP105750) genes which were amplified by gyrA-A/gyrA-C, CM31b/CM7 and infB867F/infB1819R primer sets, respectively (Rosenblueth et al. 2004). The results of phylogenetic analysis showed the three strains belong to the K. variicola clade. A pathogenicity test was conducted on six healthy 3-month-old dwarf banana plants by spraying 10 mL of bacterial suspensions of Gxkv1 (108 CFU/mL) into the rhizome which wounded with a sterilized needle; another six healthy control plants were sprayed with 10 mL of sterile water. Following inoculation, the plants were placed in a greenhouse at 28-32°C. After 30 days, all inoculated plants showed symptoms similar to those observed in the field, while the control plants remained healthy. Bacteria were successfully reisolated from the symptomatic tissues and identified to be K. variicola by PCR mentioned above. K. variicola has been reported to cause rhizome rot of banana in India (Loganathan et al. 2021), and to cause plantain soft rot in Haiti (Fulton et al. 2021). Besides, previous reports from China only showed K. variicola causing banana sheath rot (Fan et al. 2015, Sun et al. 2023). To our knowledge, this is the first report of bulb rot disease of banana caused by K. variicola in Guangxi Province, China. This finding will provide important information for studying the epidemiology and management of this pathogen.

First Report of Pantoea anthophila Causing Shoot Dieback Disease of Ceylon Ironwood (Mesua ferrea) in Malaysia

Ceylon ironwood (Mesua ferrea Linn.) or Penaga lilin is one of Asia's most popular tropical herbal plants, including Malaysia (Sharma et al., 2017). The trees are cultivated for their aesthetic value and pharmacological properties, especially as traditional remedies for asthma, dermatopathy, inflammation, and rheumatic conditions (Adib et al., 2019). In August 2022, a disease survey was conducted on Ceylon ironwood trees ranging from 5 to 12 years old in Botanical Park, Putrajaya, Malaysia, with 80% exhibiting shoot dieback disease of the 15 trees exhibiting shoot dieback disease. Symptoms include irregular, water-soaked with brown lesions on young leaves and shoots, where the small lesion coalesced and formed broad necrotic regions, subsequently causing dieback and gradual defoliation. Three infected shoots were collected from each tree, excised into small pieces (10 to 20 mm), immersed with 75% ethanol for 3 min, washed with 2% NaOCl solution for 1 min, and rinsed twice for 1 min in sterilized distilled water. A 10 µl aliquot of the sample suspension was streaked onto nutrient agar (NA) and incubated for 24 h to 48 h at 35 °C. A total of 15 isolates with similar morphology were obtained, and each isolate was re-streaked three times to obtain pure colonies that were round, smooth, with irregular edges, and produced yellow pigment in culture. All isolates were Gram-negative, negative for indole production, and utilized glucose, maltose, trehalose, sucrose, D-lactose, and pectin. Three representative isolates (C001, C002, and C003) with similar morphology were selected for further characterization. The total genomic DNA of all isolates was extracted from overnight cultures using Geneaid™ DNA Isolation Kit (Geneaid Biotech Ltd., Taiwan). PCR amplification of 16S rDNA (Zhou et al., 2015) and species-specific infB (Brady et al., 2008) genes was performed, and each of the ~1500 bp and ~900 bp amplicons were sequenced. BLASTn and phylogenetic analyses revealed all isolates were 100% identical to Pantoea anthophila (P. anthophila) LGM 2558 strains (Accession Nos. NR_116749 and NR_116113) for the 16S rDNA gene. They were 99% identical to P. anthophila CL1 strain (Accession Number CP110473) for infB gene. These sequences were later deposited in the GenBank (Accession Nos. OQ772233, OQ772234, and OQ772235 for 16S rDNA gene, and OQ803527, OQ803528, and OQ803529 for infB gene). For the pathogenicity test, healthy Ceylon ironwood seedlings' shoots were inoculated with 10 mL of each isolate suspension (1 x 108 CFU/ml) by spraying the inoculum on the young shoots using a sterilized spray bottle. Control seedlings were inoculated with sterile water. The inoculated shoots were covered with a sealed plastic bag to maintain the moisture and were kept in the greenhouse with temperatures ranging from 26 to 35 °C. The experiments were repeated twice, with three replicates for each treatment. Inoculated shoots showed dieback symptoms like natural infection, including irregular, water-soaked, and brown lesions on leaves and young shoots at 10 days post-inoculation. Control seedlings remained asymptomatic. The pathogen was re-isolated and identified via sequencing of the 16S rDNA and infB genes, thus fulfilling Koch’s postulates. Previously, P. anthophila has been reported to cause soft rot in wampee plants in China (Zhou et al., 2015) and leaf blight of cotton in Pakistan (Tufail et al., 2020). To our knowledge, this is the first report of P. anthophila causing shoot dieback disease of Ceylon ironwood trees in Malaysia. Plant disease management strategies need to be established to reduce losses due to P. anthophila infection since the pathogen could limit Ceylon ironwood tree production in Malaysia.

Rapid Visual Detection of Glaesserella parasuis with a Real-Time Recombinase-Aided Amplification Assay

Glaesserella parasuis is a specific bacterial pathogen of Glässer’s disease which causes significant economic losses to the swine industry. Dependable and rapid detection of G. parasuis is crucial to prevent and control Glässer’s disease outbreaks. In this study, a recombinase-aided amplification (RAA) assay based on the infB gene was developed to rapid detect G. parasuis. The novel method performs isothermal detection at 42°C for real-time analysis or visualization and data analysis (RAA-VDA). The developed assay showed high specificity for G. parasuis detection without cross-reactions to other clinically important swine pathogens. The analytical sensitivity of real-time RAA was 67.17 copies per reaction with 95% reliability, which was comparable to the G. parasuis quantitative real-time PCR (qPCR). However, the detection limit of RAA-VDA was 142.43 copies per reaction with 95% reliability. The coefficient of variation analysis of the intrabatch and interbatch experimental replicate results were less than 4.30% and 6.74%, respectively, indicating the real-time RAA assay had high repeatability and reproducibility. A total of 108 clinical tissue samples were used to evaluate the clinical diagnostic performance. The diagnostic accordance rates of qPCR with real-time RAA and RAA-VDA were 100% and 98.15% (106/108), respectively. This system combined instrumental analysis and visualized analysis to accomplish a new try for rapid detection of G. parasuis in clinical practice.

Comparative genomic analysis of Mycoplasma related to cell culture for infB gene-based loop-mediated isothermal amplification.

Mycoplasma contamination in cell culture affects the properties of cell lines. Gold standard detection by microbiological culture takes days and requires specialists. The polymerase chain reaction and loop-mediated isothermal amplification (LAMP) are fast molecular options, but LAMP only requires one heating block for DNA amplification. This study presents a comparative genomic analysis of Mycoplasma species to identify common target genes different from the rrsA gene, which encodes 16S rRNA. The aim is to implement a LAMP assay to detect Mycoplasma species, reducing the time and specialized equipment required for detection. We performed a comparative genomic analysis through Mauve software and the GView server and selected infB and clpB genes as target candidates for designing LAMP primers. We evaluated both genes by multiple sequence alignment (MSA). The infB gene presented the best score MSA assessment with lower odd-log values (5,480,281) than other genes. We selected the infB gene to design LAMP primers specific to Mycoplasma spp. We used these primers to implement LAMP at 63°C for 30min, which showed 100% positive amplifications for detecting Mycoplasma spp. In conclusion, we present a methodology utilizing the infB gene-based LAMP assay to detect three of the six most prevalent Mycoplasma species in cell culture.

Isolation and Identification of Multidrug-Resistant Klebsiella pneumoniae Clones from the Hospital Environment.

Global dispersion, hospital outbreaks, and lineage relationships between emerging antibiotic-resistant strains such as Klebsiella pneumoniae are of public health interest. This study aimed to isolate and identify K. pneumoniae clones from third-level healthcare hospitals in Mexico to establish their multidrug-resistant phenotype, phylogeny, and prevalence. Biological and abiotic surface samples were used to isolate K. pneumoniae strains and to test their antibiotic susceptibility to classify them. The housekeeping genes: gapA, InfB, mdh, pgi, phoE, ropB, and tonB were used for multilocus sequence typing (MLST). Phylogenetic networks were constructed with 48 strains. Isolated strains (93) were mainly from urine and blood, 96% were resistant to ampicillin as expected, 60% were extended-spectrum β-lactamases (ESBL), 98% were susceptible to ertapenem and meropenem and 99% were susceptible to imipenem, 46% were multi-drug resistant (MDR), 17% were extensively-drug resistant (XDR), 1% were pan-drug resistant (PDR), and 36% were not classified. The tonB, mdh, and phoE genes were the most variable, and the InfB gene showed positive selection. The most prevalent sequence types (STs) were ST551 (six clones), ST405 (six clones), ST1088 (four clones), ST25 (four clones), ST392 (three clones), and ST36 (two clones). ST706 was PDR, and ST1088 clones were MDR; neither of these STs has been reported in Mexico. The strains analyzed were from different hospitals and locations; thus, it is important to maintain antibiotic surveillance and avoid clone dissemination to prevent outbreaks, adaptation to antibiotics, and the transmission of antibiotic resistance.

First Report of radish tubers rot caused by Enterobacter asburiae in China.

Radish (Raphanus sativus L.) is a widely consumed vegetable in China. However, radish is susceptible to diseases, which limits its yield and development in Harbin, China. In September 2021, rotten white radish tubers were observed in the field. The incidence of this disease reached 70% in October 2021, which led to huge economic losses (i.e., 30%-40%). Water-soaked lesions appeared on the radish tubers and appeared brown-yellow, which looked similar to ginger tuber rot caused by Enterobacter asburiae (Zhang et al. 2020). The interior was rotten with no considerable smell. Over time, the lesions gradually spread into all tubers of radish. Small square pieces of radish (0.5 cm × 0.5 cm) were excised from the junction of diseased and healthy tuber, disinfected with 75% alcohol, and washed three times with distilled water then ground to prepare tissue suspensions for plating. Under 28 ℃ for 16h, single colonies were isolated from the beef extract culture medium. Single colonies appeared oval, white, and smooth, with bright and slightly raised surfaces, and with moist neat edges. Gram-negative bacterial strain CCGL 988 was obtained, with an average size of 1-2 µm × 0.5-1 µm, and 3-4 flagella. Physiological and biological test results showed that strain CCGL 988 produced acid utilizing sucrose, glucose, maltobiose, D-Sorbitol, and mannitol; negative for Voges-Proskauer, methyl red, malanate, ornithine decarboxylase, arginine decarboxylase, and lysine decarboxylase. According to the results, strain CCGL 988 was identified as Enterobacter asburiae (Hoffmann et al. 2005). The 16S rDNA region of the strain was amplified using PCR with 27F/1492R primers (López et al. 2019), and partial gyrB, atpD, rpoB genes were amplified according to Zhang et al. (2020), infB gene was amplified with primers (F:TCAATGCGTGCTCGTGGTGCTC; R: TCGATACAGTGCCACTTCACG). The 16S rDNA, gyrB, atpD, rpoB and infB sequences were deposited in GenBank under accession numbers: ON999069, OP006448, OP006449, OP006450, and OP542231, respectively. These five sequences shared 99.80%, 100%, 100%, 100% and 100% of identity with E. asburiae (GenBank Accession: NO. CP011863). Maximum-likelihood phylogenetic tree clustered CCGL 988 with E. asburiae (MEGA7, bootstrap n = 1,000). Strain CCGL 988 was able to produce pectate lyases, polygalacturonases, cellulases, proteases, and extracellular polysaccharide using the methods described by Hugouviex-Cotte-Pattat et al. (2014), and Condemine et al. (1999). Koch's postulates were conducted by inoculating 20 µl of the bacterial suspension (108 CFU/ml) on the needle wound on the surface of six healthy radish tubers; six radish tubers incubated with sterile water were negative controls. Radish tubers were incubated at 28 ℃ with 80% humidity. The inoculated radish was slightly rotten after 7 days. Water-soaked lesions with light yellow were initially observed; after 12 days, the lesions expanded gradually and appeared deep yellow. No symptoms were found in the control radish. This experiment was carried out three times, each time with three replications. The bacterium was reisolated from infected radish tuber and was confirmed to be E. asburiae by the same molecular and morphological characterization as described above. This study is the first report of E. asburiae causing radish tuber rot in China. It serves as a basis for future studies to develop management strategies for the disease to prevent radish yield loss.

Distribution of Bacterial Endosymbionts of the Cardinium Clade in Plant-Parasitic Nematodes.

Bacteria of the genus "Candidatus Cardinium" and related organisms composing the Cardinium clade are intracellular endosymbionts frequently occurring in several arthropod groups, freshwater mussels and plant-parasitic nematodes. Phylogenetic analyses based on two gene sequences (16S rRNA and gyrB) showed that the Cardinium clade comprised at least five groups: A, B, C, D and E. In this study, a screening of 142 samples of plant-parasitic nematodes belonging to 93 species from 12 families and two orders using PCR with specific primers and sequencing, revealed bacteria of Cardinium clade in 14 nematode samples belonging to 12 species of cyst nematodes of the family Heteroderidae. Furthermore, in this study, the genome of the Cardinium cHhum from the hop cyst nematode, Heterodera humuli, was also amplified, sequenced and analyzed. The comparisons of the average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) values for the strain Cardinium cHhum with regard to related organisms with available genomes, combined with the data on 16S rRNA and gyrB gene sequence identities, showed that this strain represents a new candidate species within the genus "Candidatus Paenicardinium". The phylogenetic position of endosymbionts of the Cardinium clade detected in nematode hosts was also compared to known representatives of this clade from other metazoans. Phylogenetic reconstructions based on analysis of 16S rRNA, gyrB, sufB, gloEL, fusA, infB genes and genomes and estimates of genetic distances both indicate that the endosymbiont of the root-lesion nematode Pratylenchus penetrans represented a separate lineage and is designated herein as a new group F. The phylogenetic analysis also confirmed that endosymbionts of ostracods represent the novel group G. Evolutionary relationships of bacterial endosymbionts of the Cardinium clade within invertebrates are presented and discussed.

Validation of Species-Specific PCR Assays for the Detection of Pantoea ananatis, P. agglomerans, P. allii, and P. stewartii.

Species of Pantoea represent a group of plant pathogenic bacteria that infect a variety of agro-economically important plant species. Among these, a complex of P. ananatis, P. allii, P. agglomerans, and P. stewartii subsp. indologenes cause center rot in onion, resulting in significant economic losses. As species of Pantoea are phenotypically closely related, identification of Pantoea species relies on the sequencing and phylogenetic analysis of housekeeping genes. To aid in rapid identification of Pantoea species, efforts have been made in developing species-specific primers to be used in PCR assays. In the current study, two P. ananatis, one P. allii, one P. agglomerans, and three P. stewartii published primers as well as newly developed P. agglomerans PagR primers were evaluated for their specificity against 79 Pantoea strains, belonging to 15 different species. To ensure that selected primers were evaluated against accurately identified species, sequencing and phylogenetic analysis of housekeeping gene infB were conducted. Thereafter, PCR assays using selected species-specific primers were performed. The results showed that previously described P. ananatis-specific PANA_1008; P. allii-specific allii-leuS; P. stewartii-specific PANST_rpoB, 3614galE, and DC283galE primers; and one newly designed P. agglomerans-specific PagR primer pair were highly specific for their target Pantoea species. They accurately identified these strains into their species and, in some cases, their subspecies level. The findings of the current study will facilitate rapid and reliable identification of P. ananatis, P. agglomerans, P. allii, and P. stewartii.

Colour of heterorhabditis zealandica-infected-Galleria mellonella dependent on the Photorhabdus symbiont, with two new nematode-symbiotic associations reported

Bacterial symbionts associated with entomopathogenic nematodes (EPNs) play an important role in terms of the insecticidal properties of nematodes in pest control. Galleria mellonella larvae, shortly after being infected with three different strains of Heterorhabditis zealandica, which were isolated from South African soil, changed from pale white to steel grey-blue (blue), bright red, and yellow with a green tint (green), respectively. The genetic relatedness of the bacterial symbionts that were isolated from the three strains of H. zealandica was determined by means of comparing the 16S rRNA, recA, gyrB, dnaN, gltX and infB gene sequences. Subsequently, comparing the concatenated sequences revealed the presence of three distinct Photorhabdus species. The H. zealandica strain SF41, associated with Photorhabdus heterorhabditis, produced ‘blue’ G. mellonella larvae. The H. zealandica strain MJ2C, associated with Photorhabdus thracensis, yielded ‘green’ G. mellonella larvae, while the H. zealandica strain LLM associated with Photorhabdus laumondii subsp. laumondii yielded red larvae. The colour changes in G. mellonella larvae were found to have been instigated by a particular Photorhabdus species associated with H. zealandica. The red and ‘green’ phenotypes of G. mellonella larvae were found to represent new combinations of Heterorhabditis and Photorhabdus. In future studies, the colour of infected G. mellonella larvae needs to be reported as a phenotypic character, as it indicates the different bacterial species associated with the same nematode host, as shown in the case of H. zealandica.

First Report of Bacterial Soft Rot Disease on Taro Caused by Dickeya fangzhongdai in China.

Taro [Colocasia esculenta (L.) Schott.] is an important root crop in the world with great economic value. In recent years, outbreaks of soft rot were observed on taro plants in several plantation areas located in Shaoguan, Guangdong Province, China (25°7'57" N, 113°19'5" E). Root tubers of taro (Paodan variety) infected by soft rot had water-soaked lesions with a dark brown-black margin including a rotten smell, they also had internal rot that was also found in root tubers with no external symptoms. In some areas, the incidence of soft rot can reach up to 30%. To isolate the causal agent, ten pieces of taro root tubers with typical symptoms were surface-sterilized with 75% ethanol and 0.1% HgCl2 solution and then washed thrice with sterile water. The tuber slices were soaked in 50 ml sterile water and shaken at 28°C, 200 rpm for 2 h, and 100 µl was streaked onto the modified Yeast Extract Beef (YEB) agar medium (1% peptone, 0.5% yeast extract, 0.5% sucrose, 0.5% NaCl, 1 Mmol/L MgSO4•7H2O, 1.5% agar, pH 7.0) plates (Zhou et al. 2011) and incubated at 28°C for 24 h. Single colonies grown on YEB were selected for preliminary inoculation onto healthy taro (Paodan variety) slices. Two of the Gram-negative bacteria, named as ZXC1 and MPC2, developed symptoms consistent in rotted decay inside the root tubers after incubation for 24h at 30°C. ZXC1 and MPC2 were biochemically profiled using a Biolog Gen III MicroPlate (Microlog 3, 5.2) (Shen et al. 2019) and resulted Dickeya sp. (SIM 0.856 and 0.704). To determine the species of the Dickeya isolates, 16S rRNA sequences were amplified by primers 27F and 1492R (Hauben et al. 1998). Housekeeping genes including gyrB, atpD, rpoB, and infB were also amplified using degenerate primers (Brady et al. 2008). Results from the BLASTn analysis of the 16S rRNA (GenBank accession numbers MN853405, MN853406), gyrB (GenBank accession numbers MN866299, MN866303), atpD (GenBank accession numbers MN866298, MN866302), rpoB (GenBank accession numbers MN866301, MN866305), and infB (GenBank accession numbers MN866300, MN866304) genes in the isolates ZXC1 and MPC2 showed 99% identities to those of the previously reported D. fangzhongdai isolates from Phalaenopsis (Zhang et al. 2018). Multilocus sequence analysis (MLSA) by MEGA 7.0 performed with four housekeeping genes (gyrB, atpD, rpoB, infB) showed that they clustered with D. fangzhongdai isolates. Analyses using scanning and transmission electron microscopy showed that ZXC1 and MPC2 bacteria were rod-shaped, 0.5-1.0 μm × 1.0-3.0 µm, with peritrichous flagella. Pathogenicity tests were performed thrice using surface-sterilized 2-month-old taro seedlings (Paodan variety). Six individual seedlings were inoculated using a sterile syringe with ten microliters of bacterial suspension (108 CFU/ml) in Tris buffer (0.1 mol/L Tris and 0.1 mol/L HCl, pH 7.4). Taro seedlings injected with sterile Tris buffer were used as the negative control. These taro seedlings were grown in the greenhouse (30 ± 2°C, 90 ± 5% relative humidity). At the 25th day post inoculation, soft rot symptoms were observed in inoculated taro, while all control taro plants remained symptom-free. Small and pale yellow with irregular margins colonies consistent with morphological characteristics of those of D. fangzhongdai were re-isolated from symptomatic taro tubers and the housekeeping genes presence was verified by sequencing as described above, fulfilling Koch's postulates. D. fangzhongdai is a newly emerging bacterial pathogen, which causes bleeding cankers in pear trees (Tian et al. 2016), and soft rot of Phalaenopsis (Zhang et al. 2018). This is the first report of D. fangzhongdai causing soft rot disease in taro. Considering the high incidence of soft rot, this pathogen might pose a significant threat to taro and other economically important crops. Therefore, further researches are needed to investigate host range of the pathogen and develop appropriate integrated management to contain this disease spreading.

Paenibacillus glycanilyticus subsp. hiroshimensis subsp. nov., isolated from leaf soil collected in Japan.

Strain CCI5, an oligotrophic bacterium, was isolated from leaf soil collected in Japan. Strain CCI5 grew at temperatures between 25°C and 43°C (optimum temperature, 40°C) and at pHs between 6.0 and 10.0 (optimum pH, 9.0). Its major fatty acids were anteiso-C15:0 and iso-C16:0, and menaquinone 7 was the only detected quinone system. In a phylogenetic analysis based on 16S rRNA gene sequences, strain CCI5 presented as a member of the genus Paenibacillus. Moreover, multilocus sequence analysis based on partial sequences of the atpD, dnaA, gmk, and infB genes showed thatstrain CCI5 tightly clustered with P. glycanilyticus DS-1T. The draft genome of strain CCI5 consisted of 6,864,972bp with a G+C content of 50.7% and comprised 6,189 predicted coding sequences. The genome average nucleotide identity value (97.8%) between strain CCI5 and P. glycanilyticus DS-1T was below the cut-off value for prokaryotic subspecies delineation. Based on its phenotypic, chemotaxonomic, and phylogenetic features, strain CCI5 (= HUT-8145T = KCTC 43270T) can be considered as a novel subspecies within the genus Paenibacillus with the proposed name Paenibacillus glycanilyticus subsp. hiroshimensis subsp. nov.

Development and Validation of a Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid Detection of Glaesserella (Haemophilus) parasuis.

Glaesserella parasuis is a fastidious pathogen that colonizes the respiratory tract of pigs and can lead to considerable economic losses in pig production. Therefore, a rapid detection assay for the pathogen, preferably applicable in the field, is important. In the current study, we developed a new and improved detection method using loop-mediated isothermal amplification (LAMP). This assay, which targets the infB gene, was tested on a collection of 60 field isolates of G. parasuis comprising 14 different serovars. In addition, 63 isolates from seven different closely related species of the family Pasteurellaceae, including A. indolicus, A. porcinus, and A. minor, and a species frequently found in the respiratory tract of pigs were used for exclusivity experiments. This assay showed an analytical specificity of 100% (both inclusivity and exclusivity) and an analytical sensitivity of 10 fg/µL. In further steps, 36 clinical samples were tested with the LAMP assay. An agreement of 77.1 (95% CI: 59.9, 89.6) and 91.4% (95% CI: 75.9, 98.2) to the culture-based and PCR results was achieved. The mean limit of detection for the spiked bronchoalveolar lavage fluid was 2.58 × 102 CFU/mL. A colorimetric assay with visual detection by the naked eye was tested to provide an alternative method in the field and showed the same sensitivity as the fluorescence-based LAMP assay. Overall, the optimized LAMP assay represents a fast and reliable method and is suitable for detecting G. parasuis in the laboratory environment or in the field.

Glässer’s disease in swine from Northeastern Brazil

ABSTRACT: Glässer’s disease is an important infectious disorder of swine caused by Haemophilus parasuis. Although well recognized in most regions of Brazil, outbreaks of Glässer’s disease have not been described in Northeastern region. For this reason, three municipalities of the Pernambuco State were visited in order to identify histories of high mortality in growing and finishing pigs. The main clinical signs consisted of dry cough, apathy, fever, anorexia, paresis, muscle tremors, motor incoordination, seizures leading to high mortality rates. Nine pigs were necropsied, and fragments of the nervous system, organs of the abdominal and thoracic cavities were collected for histological analysis. In addition, lung and brain fragments were used for DNA extraction and molecular testing by real-time Polymerase Chain Reaction (PCR). Grossly, the main lesions consisted of petechial hemorrhages or ecchymosis on the skin of the face, abdomen, forelimbs, and hind limbs. The main severe lesions consisted of hydropericardium, hemopericardium, fibrinous pericarditis and pleuropneumonia. Microscopically, pericarditis, epicarditis and subepicardial myocarditis, followed by a moderate to severe multifocal pleuropneumonia, fibrinosuppurative and necrotizing were the most frequent lesions observed. Real-time PCR amplified H. parasuis infB gene in all samples analyzed, confirming the presence of this etiologic agent.

Detection of Frederiksenia sp. isolated from a cat with nephritis - Short communication.

In this paper we report the phenotypic and partial genetic characterisation of a novel bacterium strain isolated from a cat with severe nephritis. Multilocus sequence analysis was performed on the 16S rRNA and three housekeeping (recN, rpoB, infB) gene sequences obtained by PCR. In accordance with the results of phenotypic tests, the phylogenetic analyses confirmed the relatedness of the new strain (6036) to the family Pasteurellaceae. On the phylogenetic trees, strain 6036 appeared in a separate branch, closest to that of the type species (Frederiksenia canicola) of the genus Frederiksenia. These two bacteria shared 95.14 and 76.88% identity in their partial 16S rRNA and recN gene sequences, respectively. The rpoB- and infB-based phylogenetic analyses indicated that strain 6036 is most closely related to Bibersteinia trehalosi (with 90.58% identity) and [Haemophilus] felis ATCC 49733 (89.50% identity), respectively. The predicted genome identity values, based on the recN gene sequences, suggested that strain 6036 can be classified into the genus Frederiksenia as a novel species. A PCR method, specific to strain 6036, was developed to allow its rapid and accurate identification and differentiation from F. canicola and other species of Pasteurellaceae. The minimal inhibitory concentrations of 18 antimicrobial agents for strain 6036 were also determined.

First Report of Plantain Soft Rot Caused by Klebsiella variicola in Haiti

Plantain and banana, both Musa spp. hybrids, constitute a major component of domestic food production in Haiti. In response to grower reports (Faculty of Agronomy and Veterinary Medicine, Port-au-Prince, personal communication) of up to 60% incidence of “toppling disease”, we conducted a preliminary study in July 2018 at four plantain farms in Arcahaie, Haiti. Symptoms observed on up to 30% of plants (n = ∼100) included a brown necrotic soft rot lesion on pseudostems extending up to 1 m in length and several centimeters deep. Toppling occurred at fruit onset, with plants folding over at the point of the soft rot. Six plants representing the four farms were sampled: 6-cm² sections were excised from the lesion edge, surface sterilized with 0.6% sodium hypochlorite, rinsed, and macerated with sterile tap water, and then the suspension was streaked onto nutrient agar (NA) and Miller-Schroth medium agar (MSM) plates, yielding six bacterial isolates. Colonies were round, glossy, convex, translucent gray-white on NA, produced a transient red-orange color change on MSM, and were aerobic, gram-negative, oxidase-negative and hypersensitive response negative on ‘Bonnie Best’ tomato and ‘Hicks’ tobacco (Schaad et al. 2001); all the above tests were repeated twice. All six isolates were identical in initial 16S rDNA sequencing, so pathogenicity of two randomly chosen isolates (G18-1365 and G18-1376) was tested on disease‐free ‘Dwarf Cavendish’ banana plantlets by drilling a 2.5-cm hole into the pseudostem, inserting sterile cotton-tipped swabs drawn through 48-h cultures on NA (negative control was dipped in sterile water) into the drilled incision, and sealing with Parafilm. Each plant was wounded once, with five plants per isolate or control. Rotting symptoms consistent with the field observations were observed 4 weeks after inoculation for all isolate inoculations; control plants remained symptomless. Reisolation and identification to fulfill Koch’s postulates were completed with results identical to the first isolations and tests. Genomic DNA was boil-extracted as previously described (Dashti et al. 2009) from the two isolates grown 24 h on NA. The amplification and sequencing of 16S rDNA, rpoB, phoE, and infB gene targets were carried out using primers and protocols previously described (Rosenblueth et al. 2004). One sequence for each isolate’s gene target (eight total) was deposited in NCBI GenBank (accessions MK217521 to MK217522; MK235993 to MK235998). In BLAST searches, sequence fragments of 16S rDNA, rpoB, phoE, and infB from isolates G18-1365 and G18-1376 resulted in 99% identity with Klebsiella variicola strains. Multilocus sequence analysis (MEGA X, Kumar et al. 2018) of those sequences yielded a concatenated phylogenetic tree that placed both isolates within the K. variicola clade. Isolates G18-1365 and G18-1376 have been deposited at the BCCM, Ghent University (accessions LMG 31122 and LMG 31123, respectively). K. variicola has been reported to cause similar bacterial rots in banana and carrot (Chandrashekar et al. 2018; Fan et al. 2016). Before management can be prescribed, further studies are necessary to determine disease incidence and if this species is the sole cause of toppling or is part of a larger disease complex, and to understand the mode of transmission within and among plantain farms. Additionally, similarity to human pathogenic strains should be studied to determine if there is a human health risk posed by K. variicola isolates causing soft rot in plantain.

Actinobacillus vicugnae sp. nov., isolated from alpaca (Vicugna pacos).

Ten strains of an Actinobacillus-like organism were isolated from alpaca (Vicugna pacos) in the UK over a period of 5 years, with no known epidemiological linkages. The isolates are distinct, based on both phenotype and genotype, from any previously described Actinobacillus species. Molecular analysis, based on 16S rRNA, rpoB and infB gene sequences, placed the isolates as a novel, early branching, lineage within the currently recognised Actinobacillus sensu stricto. In agreement with the results of the single-gene analysis, average nucleotide identity values, based on whole genome sequences, showed very similar identities to a number of members of the Actinobacillus sensu stricto notably Actinobacillus equuli, Actinobacillus suis and Actinobacillus ureae. At least two phenotypic characteristics differentiate the alpaca isolates from other Actinobacillus sensu stricto species, and from taxa likely falling within this group but awaiting formal species description, with Actinobacillus anseriformium and A. equulisubsp. haemolyticus being the most closely related phenotypically. The alpaca isolates can be differentiated from A. anseriformium by production of β-galactosidase (ONPG) and acid from raffinose, and from A. equulisubsp. haemolyticus by production of acid from d-sorbitol and failure to produce acid from d-xylose. Isolates were obtained from multiple sites in alpaca including respiratory tract, alimentary tract and internal organs although further evidence is required to understand any pathogenic significance. Based on the results of characterization described here, it is proposed that the isolates constitute a novel species, Actinobacillus vicugnae sp. nov. The type strain is W1618T (LMG30745T NCTC14090T) isolated in the UK in 2012 from oesophageal ulceration in an alpaca (Vicugna pacos).

First Report of Shoot Blight on Fragrant Pear Caused by Pantoea ananatis in China

Fragrant pears are important economic plants in Xinjiang region, a major agricultural production area in China. In March 2017, a strange shoot blight disease on fragrant pear was initially observed in Kolar, Xinjiang. The incidence of the disease was up to 50% in certain orchards, and the total incidence area was approximately 26,000 ha of commercial fields. The disease developed from blossoms to shoots and larger branches. More disease was observed on old and wounded trees. Symptoms included wilted shoot and leaves. When infections spread to larger tree limbs, the bark of branches became darkened and water-soaked. After bark shaving, dark xylem tissue was visible. Shoot samples were collected from diseased plants (Pyrus sinkiangensis Yu) with characteristic symptoms. The shoot samples were surface sterilized with 75% ethanol and 1% sodium hypochlorite, rinsed three times in sterilized water, cut into small pieces, and then soaked in 10 ml of sterile phosphate buffered saline (PBS) for 30 min. The suspension was streaked onto a nutrient agar plate and incubated at 30°C. After 48 h, dominating light yellow, round flat colonies with smooth surfaces were picked and restreaked for purification. The bacteria were identified by polymerase chain reaction amplified 16S rRNA gene and further by multilocus sequence analysis of partial nucleotide sequences of the genes rpoB and infB using rpoB CM7-F/CM31b-R (1,000 bp) and infB 01-F/02-R (1,030 bp) primer pairs, respectively (Brady et al. 2008). BLAST analysis showed that the 16S rRNA (NCBI accession no. MK128507), rpoB (MK135821), and infB (MK135822) gene sequences shared 100, 100, and 99% similarity to that of Pantoea ananatis strains BSP9 (KF360069.1), 15320 (MH015163.1), and BRT98 (MH015108.1), respectively. In April 2018, 3-year-old fragrant pear trees were inoculated with the P. ananatis in a separated garden. The branches of trees were injured with cuts of 2 to 3 cm in the bark. Autoclaved cotton balls were soaked with bacterial suspensions of 10⁸ CFU/ml and attached to the wounds with Parafilm. The bacterial suspensions were inoculated on three trees, and an additional two trees were treated with PBS instead as a negative control. Three shoots were inoculated per tree. The trees were then grown under natural conditions. After 12 weeks, symptoms resembling bacterial shoot blight symptoms had developed on all inoculated shoots. Control trees did not develop symptoms. Reisolations were performed from symptomatic tissues, and isolates were identified as P. ananatis using the techniques for molecular identification as mentioned above. P. ananatis was initially discovered on pineapple causing fruitlet rot in the Philippines in 1928 (Serrano 1928), and it is regarded as an emerging pathogen based on the increasing number of reports of diseases occurring on previously unrecorded hosts in different parts of the world. Coutinho et al. (2002) reported similar symptoms including shoot wilt and die-back after the infection of Eucalyptus trees with P. ananatis. In 2017, isolation and identification of brown rot bacteria P. ananatis was reported on imported succulent plants in China (Li et al. 2017). To our knowledge, this is the first report of P. ananatis causing shoot blight on fragrant pear in China. This study expanded the host range and geographic location of P. ananatis as a plant pathogen and suggests that commercial fragrant pear producers should take early control actions to prevent spread of and reduce losses caused by the disease.

Pectobacterium carotovorum subsp. brasiliense and Pectobacterium carotovorum subsp. carotovorum as causal agents of potato soft rot in Algeria

During surveys carried out in 2014 and 2015 in Algerian potato fields, severe bacterial tuber soft rot was observed. Twenty-one Gram-negative pectinolytic bacterial isolates were obtained from diseased potato tubers. These induced a hypersensitive reaction and soft rot symptoms when inoculated in tobacco leaves and potato tubers, respectively. PCR amplification using the Y1/Y2 primers demonstrated that all of the bacterial isolates belonged to the genus Pectobacterium. Phylogenetic analysis using partial malate dehydrogenase (mdh) gene sequences revealed that six and 15 isolates grouped with Pectobacterium carotovorum subsp. brasiliense and Pectobacterium carotovorum subsp. carotovorum reference strains, respectively. Multilocus sequence analysis of concatenated partial sequences of the acnA, atpD, gyrB and infB genes carried out on selected bacterial isolates confirmed the results obtained with the mdh gene sequences. PCR amplification with the BR1f/L1r primers that are specific for P. carotovorum subsp. brasiliense confirmed that six of the Algerian isolates belonged to this taxon.