Indigenous Soil Microbiota Research Articles

Repercussions of Prolonged Pesticide Use on Natural Soil Microbiome Dynamics Using Metagenomics Approach.

The residual pesticides in soil can affect the natural microbiome composition and genetic profile that drive nutrient cycling and soil fertility. In the present study, metagenomic approach was leveraged to determine modulations in nutrient cycling and microbial composition along with connected nexus of pesticide, antibiotic, and heavy metal resistance in selected crop and fallow soils having history of consistent pesticide applications. GC-MS analysis estimated residuals of chlorpyrifos, hexachlorbenzene, and dieldrin showing persistent nature of pesticides that pose selective pressure for microbial adaptation. Taxonomic profiling showed increased abundance of pesticide degrading Streptomyces, Xanthomonas, Cupriavidus, and Pseudomonas across the selected soils. Genes encoding for pesticide degrading cytochrome p450, organophosphorus hydrolase, aldehyde dehydrogenase, and oxidase were predominant and positively correlated with Bacillus, Sphingobium, and Burkholderia. Nitrogen-fixing genes (nifH, narB, and nir) were relatively less abundant in crop soils, correlating to the decrease in nitrogen-fixing bacteria (Anabaena, Pantoea, and Azotobacter). Microbial enzymes involved in carbon (pfkA, gap, pgi, and tpiA) and phosphorus cycle (gmbh and phnJ) were significantly higher in crop soils indicating extensive utilization of pesticide residuals as a nutrient source by the indigenous soil microbiota. Additionally, presence of antibiotic and heavy metal resistance genes suggested potential cross-resistance under pressure from pesticide residues. The results implied selective increase in pesticide degrading microbes with decrease in beneficial bacteria that resulted in reduced soil health and fertility. The assessment of agricultural soil microbial profile will provide a framework to develop sustainable agriculture practices to conserve soil health and fertility.

Advancements in Biofertilizers for Pulse Crops: From Single-Strain Inoculants to Microbiome-Based Technologies

The application of biofertilizers in pulse crop agriculture has garnered significant attention as an eco-friendly and sustainable alternative to conventional chemical fertilizers. This comprehensive review aims to elucidate the progression of biofertilizer technologies from traditional single-strain inoculants to contemporary microbiome-based strategies. Pulse crops, such as beans, lentils, chickpeas, and peas, are pivotal in global agriculture due to their high protein content, nitrogen-fixing ability, and role in improving soil health. However, optimizing their productivity necessitates effective nutrient management, where biofertilizers play a crucial role. Initially, biofertilizer development concentrated on single-strain inoculants, predominantly Rhizobium species, which establish symbiotic relationships with leguminous plants to enhance nitrogen fixation and improve crop yields. Despite their proven benefits, single-strain inoculants often exhibit variable performance influenced by soil conditions, climatic factors, and interactions with indigenous soil microbiota. This variability highlights the need for more consistent and resilient biofertilizer solutions. Recent advances in microbiome research have paved the way for the development of microbiome-based biofertilizers. These advanced formulations leverage the synergistic interactions among diverse microbial communities, including bacteria, fungi, and archaea, to provide a more comprehensive and stable enhancement of soil fertility and plant growth. Microbiome-based approaches recognize the complexity of plant-microbe-soil interactions, offering improved nutrient cycling, increased plant stress resilience, and better adaptation to various environmental conditions. The benefits of microbiome-based biofertilizers are manifold, encompassing enhanced nutrient availability, improved plant health, and sustainable soil management. However, their development and application pose several challenges, including understanding the intricate dynamics of microbiome interactions, developing precise formulation and application methods, and navigating regulatory landscapes. Addressing these challenges requires multidisciplinary research and innovation, integrating genomics, metagenomics, and advanced data analytics to unravel the complexities of soil microbiomes. This includes the potential for personalized biofertilizer formulations tailored to specific soil and crop conditions, enhancing the efficacy and scalability of biofertilizer technologies.

Killed fungal pathogen triggers antifungal metabolites in Alcaligenes faecalis for plant defense

Sclerotium rolfsii is a broad host necrotrophic pathogen causing serious damages in crop yields. Apart from chemical fungicides being used to control this pathogen, no bio-fungicides have been reported till date. In this study, we have tried to utilize heat killed S. rolfsii hyphae for triggering biosynthesis of antifungal compounds in the endophytic bacterium Alcaligenes faecalis BHU 12. The endophytic bacterial cell free supernatant (CFS) obtained by growing BHU 12 in presence of freeze-crushed and autoclaved S. rolfsii hyphae caused prominent S. rolfsii hyphal degeneration and inhibition of sclerotial germination under in vitro conditions. This result was further corroborated under in planta conditions wherein spraying of the CFS at the point of infection inhibited further pathogen ingress. This observation was justified by the presence of gallic and shikimic acid in the CFS which served as antifungal agent and augmentor of plant defense system respectively. Infected plants sprayed with the CFS were found to display a prominent increase in phenylalanine ammonia lyase activity and a corresponding increase in total phenolics. In this context, our results described the possible alternative of using endophytic bacterial metabolite compounds as biofungicides. A simultaneous augmentation in seed germination upon treatment with the CFS suggests a possibility of using endophytic bacterial supernatants as biocontrol and biofertilizer alternative instead of whole bacterial cell since indigenous soil microbiota combined with cumbersome inoculation techniques prevents successful colonization of endophytic microbes in planta.

Phosphorus availability and planting patterns regulate soil microbial effects on plant performance in a semiarid steppe.

Growing evidence has suggested that plant responses to model soil microorganisms are context dependent; however, few studies have investigated the effects of whole soil microbial communities on plant performance in different abiotic and biotic conditions. To address this, we examined how soil phosphorus (P) availability and different planting patterns regulate soil microbial effects on the growth of two native plant species in a semiarid steppe. We carried out a glasshouse experiment to explore the effects of the whole indigenous soil microbiota on the growth and performance of Leymus chinensis and Cleistogenes squarrosa using soil sterilization with different soil P availabilities and planting patterns (monoculture and mixture). Transcriptome sequencing (RNA-seq) was used to explain the potential molecular mechanisms of the soil microbial effects on C. squarrosa. The soil sterilization treatment significantly increased the biomass of L. chinensis and C. squarrosa in both monoculture and mixture conditions, which indicated that the soil microbiota had negative growth effects on both plants. The addition of P neutralized the negative microbial effects for both L. chinensis and C. squarrosa, whereas the mixture treatment amplified the negative microbial effects on L. chinensis but alleviated them on C. squarrosa. Transcriptomic analysis from C. squarrosa roots underscored that the negative soil microbial effects were induced by the upregulation of defence genes. The P addition treatment resulted in significant decreases in the number of differentially expressed genes attributable to the soil microbiota, and some defence genes were downregulated. Our results underline that indigenous soil microbiota have negative effects on the growth of two dominant plant species from a semiarid steppe, but their effects are highly dependent on the soil P availability and planting patterns. They also indicate that defence genes might play a key role in controlling plant growth responses to the soil microbiota.

Influence of Trichoderma asperellum and Bacillus subtilis as biocontrol and plant growth promoting agents on soil microbiota

PurposeThe manipulation of soil microbiota can involve changes in microbial diversity and microbial activities, and it is carried out for practical purposes. The microbial diversity can be modified by the inoculation of beneficial microorganisms into soil or by agricultural management practices. This study provides information on the influence of introducing beneficial soil microorganisms on soil indigenous microbiota. The aim of this study was to determine how biocontrol and plant growth promoting agents Trichoderma asperellum and Bacillus subtilis and their consortium affect indigenous soil microbiota without placing emphasis on the plant as a determinant of change.MethodsExperimental soil samples were treated with B. subtilis and T. asperellum and their consortium. The shift of number of bacterial and fungal CFUs in soil was determined. Biolog EcoPlate assay demonstrated the metabolic activity of microorganisms in soil. The concentration of Trichoderma genus, Firmicutes, Gammaproteobacteria and Acidobacteria DNA in soil samples was determined by molecular methods. A correlation analysis was performed between microbiological and molecular data.ResultsSoil treatment with T. asperellum, B. subtilis and the plant pathogenic fungus Botrytis cinerea changed the number of CFUs and amplified DNA fragments of certain taxa. The study showed that added microorganisms did not significantly affect the metabolic diversity of the community and Shannon-Wiener biodiversity index but change the utilization of carbohydrates, complex carbon compounds and organic phosphorus compounds.ConclusionIntroduced biocontrol and plant growth promoting agents T. asperellum and B. subtilis survive in soil during a 60-day experiment and influence composition and functionality of indigenous populations. Whereas B. subtilis and T. asperellum and their consortium are inhibitors of the pathogenic fungus B. cinerea, this could further positively affect specific crops.

Response of Barley Plants to Drought Might Be Associated with the Recruiting of Soil-Borne Endophytes.

Mechanisms used by plants to respond to water limitation have been extensively studied. However, even though the inoculation of beneficial microbes has been shown to improve plant performance under drought stress, the inherent role of soil microbes on plant response has been less considered. In the present work, we assessed the importance of the soil microbiome for the growth of barley plants under drought stress. Plant growth was not significantly affected by the disturbance of the soil microbiome under regular watering. However, after drought stress, we observed a significant reduction in plant biomass, particularly of the root system. Plants grown in the soil with disturbed microbiome were significantly more affected by drought and did not recover two weeks after re-watering. These effects were accompanied by changes in the composition of endophytic fungal and bacterial communities. Under natural conditions, soil-derived plant endophytes were major colonizers of plant roots, such as Glycomyces and Fusarium, whereas, for plants grown in the soil with disturbed microbiome seed-born bacterial endophytes, e.g., Pantoea, Erwinia, and unclassified Pseudomonaceae and fungal genera normally associated with pathogenesis, such as Gibberella and Gaeumannomyces were observed. Therefore, the role of the composition of the indigenous soil microbiota should be considered in future approaches to develop management strategies to make plants more resistant towards abiotic stress, such as drought.

Enhancing the plants growth and arsenic uptake from soil using arsenite-oxidizing bacteria

Plants, that naturally inhabit arsenic-contaminated areas may be used for effective arsenic-uptake from soil. The efficiency of this process may be increased by the reducing arsenic phytotoxicity and stimulating the activity of indigenous soil microbiota. As we showed, it can be achieved by the bioaugmenting of soil with arsenite-oxidizing bacteria (AOB). This study aimed to investigate the influence of soil bioaugmentation with AOB on the structure, quantity, and activity of the indigenous soil microbiota as well as to estimate the effect of such changes on the morphology, growth rate, and arsenic-uptake efficiency of plants. Plants-microbes interactions were investigated using the effective arsenites oxidizer Ensifer sp. M14 and the native plant alfalfa. The experiments were performed both in potted garden soil enriched with arsenic and in highly arsenic polluted, natural soil. The presence of M14 strain in soil contributed to the increase both in plants growth intensity and arsenic-uptake efficiency with regard to the soil without M14. After 40 days of plants culture, their average biomass increased by about 60% compared to non-bioaugmented soil, while the arsenic accumulation increased more than two times. The soil bioaugmentation contributed also to the increase in the quantity and activity of soil microorganisms without disturbing the natural microbial community structure. In the bioaugmented soil, the noticable increase in the quantity of heterotrophic, denitrifying, nitrifying and cellulolytic bacteria as well as in the activity of dehydrogenases and cellulases were observed. Soil bioaugmentation with M14 enables the application of native and commonly occurring plant species for enhancing the treatment of arsenic-contaminated soil. This in situ strategy may constitute a valuable alternative both to the chemical and physical methods of arsenic removal from soil and to the biological ways based on the arsenic hyperaccumulating plants and/or the arsenic mobilizing bacteria.

Salmonella persistence in soil depends on reciprocal interactions with indigenous microorganisms.

Fresh fruits and vegetables have numerous benefits to human health. Unfortunately, their consumption is increasingly associated with food-borne diseases, Salmonella enterica being their most frequent cause in Europe. Agricultural soils were postulated as reservoir of human pathogens, contributing to the contamination of crops during the growing period. Since the competition with the indigenous soil microbiota for colonization sites plays a major role in the success of invading species, we hypothesized that reduced diversity will enhance the chance of Salmonella to successfully establish in agricultural environments. We demonstrated that the abundance of Salmonella drastically decreased in soil with highly diverse indigenous prokaryotic community, while in soil with reduced prokaryotic diversity, Salmonella persisted for a long period. Furthermore, in communities with low diversity, Salmonella had an impact on the abundance of other taxa. The high physiological plasticity allows Salmonella to use agricultural soils as alternative habitat which might provide a route of animal/human infections. In addition, adjusted transcriptional profile with amino acid biosynthesis and the glyoxylate cycle most prominently regulated, suggests an adaptation to the soil environment. Our results underline the importance of the maintenance of diverse soil microbiome as a part of strategy aiming at reduced risk of food-borne salmonellosis outbreaks.

Native soil microorganisms hinder the soil enrichment with antibiotic resistance genes following manure applications

Bacterial genes responsible for resistance to antibiotic agents (ARG) are spread from livestock to soil through application of manure, threatening environmental and human health. We investigated the mechanisms of ARG dissemination and persistence to disentangle i) the influence of nutrients and microorganisms on the soil tetracycline (TET) resistome, and ii) the role of indigenous soil microbiota in preventing ARG spread. We analysed short-term (7 days) and persistent (84 days) effects of manure on the resistome of three antibiotic-free pasture soils. Four microcosm treatments were evaluated: control, mineral nutrient fertilization, and deposition of a layer of fresh manure onto soil or γ-irradiated soil. We quantified five TET-resistance genes, isolated 135 TET-resistant bacteria and sequenced both culturable TET-resistant and whole bacterial communities. Manure amendments, but not nutrient addition, increased the abundance of TET-r genes such as tet(Y). Such changes persisted with time, in contrast with the TET-resistant bacterial composition, which partially recovered after manure amendments. Manured γ-irradiated soils showed significantly lower nutrient content and higher TET-r gene abundance than non-irradiated soils, suggesting that native soil bacteria are essential for the fertilization effect of manure on soil as well as control the dissemination of potentially risky TET-r genes.

Rhizosphere Microbial Communities of Spartina alterniflora and Juncus roemerianus From Restored and Natural Tidal Marshes on Deer Island, Mississippi.

The U. S. Gulf of Mexico is experiencing a dramatic increase in tidal marsh restoration actions, which involves planting coastal areas with smooth cordgrass (Spartina alterniflora) and black needlerush (Juncus roemerianus) for erosion control and to provide habitat for fish and wildlife. It can take decades for sedimentary cycles in restored marshes to approach reference conditions, and the contribution of the sediment microbial communities to these processes is poorly elucidated. In this study, we addressed this gap by comparing rhizosphere microbiomes of S. alterniflora and J. roemerianus from two restored marshes and a natural reference marsh located at Deer Island, MS. Our results revealed that plants from the restored and reference areas supported similar microbial diversity indicating the rapid colonization of planted grasses with indigenous soil microbiota. Although close in composition, the microbial communities from the three studied sites differed significantly in the relative abundance of specific taxa. The observed differences are likely driven by the host plant identity and properties of sediment material used for the creation of restored marshes. Some of the differentially distributed groups of bacteria include taxa involved in the cycling of carbon, nitrogen, and sulfur, and may influence the succession of vegetation at the restored sites to climax condition. We also demonstrated that plants from the restored and reference sites vary in the frequency of culturable rhizobacteria that exhibit traits commonly associated with the promotion of plant growth and suppression of phytopathogenic fungi. Our findings will contribute to the establishment of benchmarks for the assessment of the outcome of coastal restoration projects in the Gulf of Mexico and better define factors that affect the long-term resiliency of tidal marshes and their vulnerability to climate change.

Impact of the Fenton-like treatment on the microbial community of a diesel-contaminated soil

Fenton-like treatment (FLT) is an ISCO technique relying on the iron-induced H2O2 activation in the presence of additives aimed at increasing the oxidant lifetime and maximizing iron solubility under natural soil pH conditions. The efficacy of FLT in the clean-up of hydrocarbon-contaminated soils is well established at the field-scale. However, a better assessment of the impact of the FLT on density, diversity and activity of the indigenous soil microbiota, might provide further insights into an optimal combination between FLT and in-situ bioremediation (ISB). The aim of this work was to assess the impacts of FLT on the microbial community of a diesel-contaminated soil collected nearby a gasoline station. Different FLT conditions were tested by varying either the H2O2 concentrations (2 and 6%) or the oxidant application mode (single or double dosage). The impact of these treatments on the indigenous microbial community was assessed immediately after the Fenton-like treatment and after 30, 60 and 90 d and compared with enhanced natural attenuation (ENA). After FLT, a dramatic decrease in bacterial density, diversity and functionality was evident. Although in microcosms with double dosing at 2% H2O2 a delayed recovery of the indigenous microbiota was observed as compared to those subjected to single oxidant dose, after 60 d incubation the respiration rate increased from 0.036 to 0.256 μg CCO2 g−1soil h−1. Irrespective of the oxidant dose, best degradation results after 90 d incubation (around 80%) were observed with combined FLT, relying on double oxidant addition, and bioremediation.

First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

How significant to plant N nutrition is the direct consumption of soil microbes by roots?

Summary–The high degree to which plant roots compete with soil microbes for organic forms of nitrogen (N) is becoming increasingly apparent. This has culminated in the finding that plants may consume soil microbes as a source of N, but the functional significance of this process remains unknown.–We used 15N- and 14C-labelled cultures of soil bacteria to measure rates of acquisition of microbes by sterile wheat roots and plants growing in soil. We compared these rates with acquisition of 15N delivered as nitrate, amino acid monomer (l-alanine) and short peptide (l-tetraalanine), and the rate of decomposition of [14C] microbes by indigenous soil microbiota.–Acquisition of microbe 15N by both sterile roots and roots growing in soil was one to two orders of magnitude slower than acquisition of all other forms of 15N. Decomposition of microbes was fast enough to account for all 15N recovered, but approximately equal recovery of microbe 14C suggests that microbes entered roots intact.–Uptake of soil microbes by wheat (Triticum aestivum) roots appears to take place in soil. If wheat is typical, the importance of this process to terrestrial N cycling is probably minor in comparison with fluxes of other forms of soil inorganic and organic N.

Assessing the chemical and biological accessibility of the herbicide isoproturon in soil amended with biochar

There is considerable current interest in using biochar (BC) as a soil amendment to sequester carbon to mitigate climate change. However, the implications of adding BC to agricultural soil for the environmental fate of pesticides remain unclear. In particular, the effect of biochars on desorption behavior of compounds is poorly understood. This study examined the influence of BC on pesticide chemical and biological accessibility using the herbicide isoproturon (IPU). Soils amended with 1% and 2% BC showed enhanced sorption, slower desorption, and reduced biodegradation of IPU. Addition of 0.1% BC had no effect on sorption, desorption or biodegradation of IPU. However, the mineralization of 14C-IPU was reduced by all BC concentrations, reducing by 13.6%, 40.1% and 49.8% at BC concentrations of 0.1%, 1% and 2% respectively. Further, the ratio of the toxic metabolite 4-isopropyl-aniline to intact IPU was substantially reduced by higher BC concentrations. Hydroxypropyl-β-cyclodextrin (HPCD) extractions were used to estimate the IPU bioaccessibility in the BC-amended soil. Significant correlations were found between HPCD-extracted 14C-IPU and the IPU desorbed (%) (r2=0.8518, p<0.01), and also the 14C-IPU mineralized (%) (r2=0.733; p<0.01) for all BC-amended soils. This study clearly demonstrates how desorption in the presence of BC is intimately related to pesticide biodegradation by the indigenous soil microbiota. BC application to agricultural soils can affect the persistence of pesticides as well as the fate of their degradation products. This has important implications for the effectiveness of pesticides as well as the sequestration of contaminants in soils.

Pathogenic bacteria and mineral N in soils following the land spreading of biogas digestates and fresh manure

The on-farm production of renewable energy from animal manures has rapidly expanded in central and northern Europe, with thousands of anaerobic reactors. This process has increased the land spreading of biogas digestates, replacing the use of fresh manure as a fertiliser. The environmental benefits and risks of such a change still need to be defined. We hypothesised that applying to the soil anaerobically digested instead of fresh manure might control the release of pathogens but increase that of inorganic N. Pots including γ- or non-irradiated soils, either control or amended with digestate or manure (80 kg N ha −1), were incubated for 0, 1 and 3 months. Escherichia coli, Salmonella and Listeria were cultivated and pathogenicity genes invA and hlyA PCR-amplified. Soil ammonium and nitrate concentrations, and their leaching through the upper soil layer was quantified in 20 cm-depth lysimeters for 100 d. Anaerobic digestion significantly sanitised the manure by completely eliminating cultivable E. coli and Salmonella but not Listeria (1.7 × 10 4 CFUs g −1). Thus, manure increased all microbes and invA gene numbers when applied to soils, while the digestate supplied only hlyA-negative Listeria. Potential pathogens were significantly more abundant in γ- than in non-irradiated treatments indicating suppression by indigenous soil microbiota. Control levels of all potential pathogens were recovered after 3 months, which could be thus considered a safe delay between land spreading amendments and harvesting. Concentration of nitrates in soil and their movement through the upper layer in soils amended with digestate were doubled compared to the other treatments. Hence, care should be taken that in the field nitrate liberation does not exceed plant demand.

Non-target effects of the microbial control agents Pseudomonas fluorescens DR54 and Clonostachys rosea IK726 in soils cropped with barley followed by sugar beet: a greenhouse assessment

Non-target effects of a bacterial ( Pseudomonas fluorescens DR54) and a fungal ( Clonostachys rosea IK726) microbial control agent (MCA), on the indigenous microbiota in bulk soil and rhizosphere of barley, and subsequent a sugar beet crop, were studied in a greenhouse experiment. MCAs were introduced by seed and soil inoculation. Bulk and rhizosphere soils were sampled regularly during the growth of barley and sugar beet. The soils were assayed for the fate of MCAs and various features of the indigenous soil microbiota. At the end of the experiment (193 d), DR54 and IK726 had declined by a factor of 10 6 and 20, respectively, and DR54 showed a short-lasting growth increase in the sugar beet rhizosphere. In general, the non-target effects were small and transient. IK726 seemed to have general stimulating effects on soil enzyme activity and the soil microbiota, and resulted in a significant increase in plant dry weight. The plant growth-promoting effect of DR54 was less pronounced and the DR54 displaced indigenous pseudomonads. DR54 stimulated growth of protozoans with a tolerance for the anti-fungal compound viscosinamide produced by DR54. Treatment with the fungicide Fungazil had no effects on plant growth or soil microorganisms. Phospholipid fatty acid (PLFA) analysis detected the perturbations of the soil microbial community structure in the MCA treatments as well as the return to non- perturbed conditions reflecting the decline of inoculant populations. The PLFA technique appears to be suitable for in situ monitoring of MCA non-target effects on the soil microbiota, but should be combined with assays for MCA survival and soil enzyme activity.

Occurrence and diversity of tetracycline resistance genes in lagoons and groundwater underlying two swine production facilities.

In this study, we used PCR typing methods to assess the presence of tetracycline resistance determinants conferring ribosomal protection in waste lagoons and in groundwater underlying two swine farms. All eight classes of genes encoding this mechanism of resistance [tet(O), tet(Q), tet(W), tet(M), tetB(P), tet(S), tet(T), and otrA] were found in total DNA extracted from water of two lagoons. These determinants were found to be seeping into the underlying groundwater and could be detected as far as 250 m downstream from the lagoons. The identities and origin of these genes in groundwater were confirmed by PCR-denaturing gradient gel electrophoresis and sequence analyses. Tetracycline-resistant bacterial isolates from groundwater harbored the tet(M) gene, which was not predominant in the environmental samples and was identical to tet(M) from the lagoons. The presence of this gene in some typical soil inhabitants suggests that the vector of antibiotic resistance gene dissemination is not limited to strains of gastrointestinal origin carrying the gene but can be mobilized into the indigenous soil microbiota. This study demonstrated that tet genes occur in the environment as a direct result of agriculture and suggested that groundwater may be a potential source of antibiotic resistance in the food chain.

Bioavailability and biodegradation kinetics protocol for organic pollutant compounds to achieve environmentally acceptable endpoints during bioremediation.

This paper is an extension of our previous studies on quantitating biodegradation kinetics in soil slurry and compacted soil systems. Previous studies had mainly used phenol as a test contaminant. Phenol represents hydrophilic compounds which exhibit high water solubility and low soil sorption characteristics. This paper extends the experimental protocol using polycyclic aromatic hydrocarbons (PAHs) as the test contaminants. PAHs are hydrophobic compounds with low water solubility and exhibit significant partitioning in soil organic carbon. Degradation rates of PAHs are much slower, thereby requiring acclimation of indigenous soil microbiota using microcosm reactors. The experimental protocol, elaborated in this paper, results in the measurement of biokinetic parameters which can be used to quantitate both ex situ and in situ bioremediation rates and assess the attainable endpoints. Biodegradation studies were conducted for naphthalene using soil slurry, soil wafer, and soil column reactors. Microcosm reactors were set-up to acclimate soil microbiota, and carbon dioxide evolution was used as a measure of acclimation. It was found that reasonable degree of PAH acclimation was achieved after 250 days of microcosm operation. Abiotic adsorption/desorption studies showed that equilibrium was achieved in about 20 hours and approximately 45% of the initial amount of naphthalene is adsorbed by the time equilibrium is attained. Further, desorption was much slower than adsorption with equilibrium being attained in 40 hours. Biokinetic parameters were derived from the cumulative oxygen uptake data of soil slurry, wafer, and column reactors using detailed mathematical models. The cumulative oxygen uptake in all three reactors were almost the same, since naphthalene primarily degraded in the soil phase and the extent of degradation in the aqueous phase was small.

Lignocellulose Decomposition and Production of Ligninolytic Enzymes During Interaction of White Rot Fungi with Soil Microorganisms

Four strains of white rot fungi, including two strains of Pleurotus sp., one Dichomitus squalens, and one Ganoderma applanatum, were grown on milled straw. After colonization of the straw by the fungi, sterile or nonsterile plugs of soil were added to the fungal substrates. The influence of the sterile soil and the indigenous soil microbiota on fungal growth, overall respiration, and production of ligninolytic exoenzymes was assessed. A method for extraction of laccase from soil samples was developed. Lignocellulose decomposition, and enzyme production of D. squalens were enhanced by the presence of sterile soil. The availability of inorganic compounds such as manganese may be a trigger for this stimulation. Neither growth nor the production of laccase and manganese peroxidase (MnP) of the Pleurotus strains was markedly affected by the soil microbiota. These fungi were highly competitive with the soil microbiota. It was demonstrated for the first time that the exoenzymes of such fungi are active in nonsterile soil. Enzyme activity in the aqueous phase of soil was high as in the aqueous phase of the straw substrate. D. squalens and G. applanatum did not withstand the competition with the soil microbiota, but the mycelia associated with straw were overgrown by soil microorganisms. Correspondingly, the fungi did not penetrate the soil, decomposition of lignocellulose was impeded, and the activities of laccase and MnP decreased dramatically.

Mineralization of polycyclic and N‐heterocyclic aromatic compounds in hydrocarbon‐contaminated soils

AbstractThe comparative mineralization of eight polycyclic aromatic compounds in five soils collected from an abandoned coal tar refinery in eastern Ohio was determined. The soils showed differences only in total extractable hydrocarbon content of the soil chemical characteristics measured. The compounds studied included five polycyclic aromatic hydrocarbons (phenanthrene, anthracene, pyrene, and carcinogenic benz[a]anthracene and benzo[a]pyrene) and three N‐heterocyclic aromatics (9H‐carbazole, and carcinogenic 7H‐dibenzo[c,g]carbazole and dibenz[a,j]acridine). Mineralization was measured by serum bottle radiorespirometry. Only phenanthrene, anthracene, pyrene, benz[a]anthracene, and carbazole were mineralized in the soils after 64 d. Two of the soils with eight to 15 times the hexane‐extractable hydrocarbon content consistently showed more rapid initial rates and higher overall extents of mineralization compared to the other three soils. Overall extents of mineralization ranged from 38 to 55% for phenanthrene, 10 to 60% for anthracene, 25 to 70% for pyrene, background to 40% for benz[a]anthracene, and 25 to 50% for carbazole after 64 d. Extents of mineralization by indigenous soil microbiota appear to be more dependent on the chemical characteristics of the soil and not soil total biomass and activity. Cultures capable of degrading phenanthrene, anthracene, and pyrene were obtained following enrichment techniques. A Mycobacterium sp. capable of degrading these three compounds was isolated and reintroduced into two of the soils, resulting in mineralization enhanced above that of the indigenous soil microbial population. These data indicate that the future success of bioremediation methods relies on the characterization of environmental parameters affecting microbial degradation as well as the isolation of microbial populations that can reduce toxicity in the environment.