Increased Antibody Production Research Articles

In silico designing of multi-epitope vaccine against canine parvovirus using reverse vaccinology.

Canine parvovirus (CPV-2) is a highly contagious virus affecting dogs worldwide, posing a significant threat. The VP2 protein stands out as the predominant and highly immunogenic structural component of CPV-2. Soon after its emergence, CPV-2 was replaced by variants known as CPV-2a, 2b and 2c, marked by changes in amino acid residue 426 of VP2. Additional amino acid alterations have been identified within VP2, with certain modifications serving as signatures of emerging variants. In Brazil, CPV-2 outbreaks persist with diverse VP2 profiles. Vaccination is the main preventive measure against the virus. However, the emergence of substitutions presents challenges to conventional vaccine methods. Commercial vaccines are formulated with strains that usually do not match those currently circulating in the field. To address this, the study aimed to investigate CPV-2 variants in Brazil, predict epitopes, and design an in silico vaccine tailored to local variants employing reverse vaccinology. The methodology involved data collection, genetic sequence analysis, and amino acid comparison between field strains and vaccines, followed by the prediction of B and T cell epitope regions. The predicted epitopes were evaluated for antigenicity, allergenicity and toxicity. The final vaccine construct consisted of selected epitopes linked to an adjuvant and optimized for expression in Escherichia coli. Structural predictions confirmed the stability and antigenicity of the vaccine, while molecular docking demonstrated interaction with the canine toll-like receptor 4. Molecular dynamics simulations indicated a stable complex formation. In silico immune simulations demonstrated a progressive immune response post-vaccination, including increased antibody production and T-helper cell activity. The multi-epitope vaccine design targeted prevalent CPV-2 variants in Brazil and potentially other regions globally. However, experimental validation is essential to confirm our in silico findings.

Physical Activity at Different Life Stages and Its Consequence on the Initial Immunization and Inflammatory Response Against COVID-19.

To evaluate the influence of previous physical activity (PA) during childhood, adolescence, and current PA practice on the production of antibodies and inflammatory response between the first and second doses of the COVID-19 vaccine. Fifty-nine men and 56 women were evaluated before the first vaccine, and 12weeks later, blood samples were taken to quantify production of anti-severe acute respiratory syndrome coronavirus-2 immunoglobulin G antibodies and cytokines. Previous PA during childhood and adolescence was self-referred, and current PA was assessed using the International Physical Activity Questionnaire. A positive and significant association was observed only between PA practice during adolescence and an increase in antibody production in adulthood (β = 2012.077, 95% confidence interval, 257.7953-3766.358, P = .025). Individuals who practiced PA during adolescence showed higher production of antibodies between the first and second vaccine dose compared to nonpractitioners (P = .025) and those that accumulated ≥150minutes per week of current moderate-vigorous PA (MVPA), and presented higher antibody production in relation to who did <150minutes per week of MVPA (P = .046). Individuals that were practitioners during childhood produced higher G-CSF (P = .047), and those that accumulated ≥150minutes per week of current MVPA demonstrated lower IP-10 levels (P = .033). However, PA practitioners during adolescence presented higher G-CSF (P = .025), IL-17 (P = .038), IL-1RA (P = .005), IL-1β (P = .020), and IL-2 (P = .026) levels. Our results suggest that adults that accumulated at least 150minutes of MVPA per week or practiced PA during adolescence developed an improved immune and inflammatory response against COVID-19 vaccination.

Abstract 493: Unlocking solid tumors to nano-immunotherapy

Abstract Despite the remarkable efficiency of cancer immunotherapies, only a low percentage of patients achieve long-lasting clinical responses. Non-tumor cells within the tumor microenvironment (TME), including tumor vasculature and immune stromal cells, dictate therapeutic efficacy. The presence of germinal centers (GC) within the TME of cancer patients, including infiltrating T follicular helper (Tfh) cells and B cells, has been considered predictive of response to immunotherapies. We are developing nano-immunotherapies to induce immunological memory to control tumor relapse without any follow-up treatment.Nanomaterials co-incorporated tumor-associated antigens, clinically relevant toll-like receptor ligands, and regulators of tumor progression, namely the PD-L1/PD-1 expression and the secretion of TGF-β. Nanoparticle (NP) physicochemical properties were fully addressed. The immunotherapeutic potential of this nano-immunotherapy was addressed in melanoma, colorectal cancer (CRC), pancreatic cancer, and triple-negative breast cancer (TNBC) 3D models. These were created using patient-derived tumor cells, cancer-associated fibroblasts, and endothelial cells, to which paired patients' peripheral blood mononuclear cells were added to assess T-cell infiltration and tumor sprouting to identify the best nano-immunotherapy dosage/schedule. Our in vivo studies evaluated tumor volume, and animals’ survival, and characterized the tumor-infiltrating immune cells within TME, including the differentiation of Tfh cells and primary GC by flow cytometry.Our nano-immunotherapy remodeled the TME of B16F10 melanoma, MC38 CRC, 4T1 and E0771 TNBC, and KPC PDAC. Different TME subpopulations were identified as major blockers of anti-tumor immunity, and this knowledge guided the selection of combination approaches using modulators of those tumor immune evasion-related pathways (e.g., PD-L1, FAK). Our combination nano-immunotherapies tailored to address the tumor immune suppression profile found in vaccinated animals, significantly delayed tumor development, and increased disease-free survival rates. We found that the adjuvants delivered by our NP led to a ~4-fold increase in antibody production, being far more effective in generating GC responses. Thus, the effectiveness of combinational immunotherapy is at least partially related to the modulation of Tfh cells driving the formation of GC responses.Our nano-immunotherapy is a promising clinically translatable approach to defeating solid tumors. Acknowledgments: This work was supported by PTDC/BTM-SAL/4350/2021 and LCF/PR/HR22/52420016. Citation Format: Barbara Carreira, Rita C. Acúrcio, Ana I. Matos, Liane M. Moura, Ana C. Santos, Raquel Gouveia, Jéssica Cordeiro, Carina Peres, Daniela Vaskovich-Koubi, Ron Kleiner, Sabina Pozzi, Ronit Satchi-Fainaro, Helena F. Florindo. Unlocking solid tumors to nano-immunotherapy [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 493.

IMPACT OF A GEL COMPOSITION CONTAINING VARIOUS SUBSTANCES ON INDICES OF IMMUNITY AND TISSUE INFLAMMATION IN PALATINE TONSILS OF PATIENTS WITH CATARRHAL GINGIVITIS DURING CHRONIC TONSILLITIS

The study of pharmacotherapeutic (immunomodulating) action in conditions of in vitro cell cultures is currently considered appropriate and justified for determining the action of drugs at the preclinical level. It is also important to address the pathogenetic nature in using such agents, especially fro local application. This study investigated the efficacy of a multicomponent gel containing decamethoxine and hyaluronic acid in treating chronic catarrhal gingivitis among patients with chronic tonsillitis. The purpose of the work is to assess the efficacy of a gel containing decamethoxine and hyaluronic acid on the tissue of the palatine tonsils in the therapy of chronic catarrhal gingivitis in patients with chronic tonsillitis.&#x0D; Materials and methods. To investigate the effects of the main active components in the gel, we followed the recommendations of I.P. Kaidashev et al. for testing pharmacological preparations in in vitro cultures. Tissue samples from the palatine tonsils were obtained from 20 patients with chronic tonsillitis and chronic catarrhal gingivitis undergoing tonsillectomy. All procedures adhered to the guidelines set by the Laboratory of Pathophysiology and Immunology at Prof. O.S. Kolomiichenko Institute of Otolaryngology, National Academy of Sciences of Ukraine. Palatine tonsil tissue was incubated in 199 medium (Serva, Germany) containing gentamicin sulfate (Darnytsa, Ukraine) at a concentration of 120 μg/ml for 20 minutes at 4-8°C. After that, the hemorrhagic parts were removed from the whole tonsil and placed into Eagle's medium (Sigma, USA) and rinsed three to four times. Subsequently, the prepared tissue was placed in sterile vials containing enriched Eagle's medium supplemented with L-glutamine, sodium bicarbonate, 100x vitamin concentrate, 5% fetal calf serum, and 60 μg/mL gentamicin. Tonsil tissue was dissected using scissors and then washed repeatedly (5-7 times) with fresh medium to remove loosely attached cells, then, the resulting cell suspension was filtered. All procedures were conducted within a sterile laminar flow cabinet. Cell viability was assessed using light microscopy (Olympus-23, Japan) and a hemocytometer. A final cell suspension containing 2.5 million lymphocytes per milliliter of medium was prepared. Suspensions with a viability of less than 90% (blue, "dead" cells) were excluded from further experiments.&#x0D; Results. Treatment of in vitro palatine tonsil cells from patients with chronic catarrhal gingivitis and recurrent tonsillitis with the main components of the developed gel (decamethoxine and hyaluronic acid) did not induce significant changes in the concentration of α and γ-interferons. Our findings suggest that the gel composition reduces the levels of pro-inflammatory factors: interleukin-1β and immune complexes. Additionally, it appears to stimulate the production of the antimicrobial factor antistreptolysin-O by tonsil cells, potentially leading to increased antibody production against hemolytic streptococcus antigens.&#x0D; Conclusion. Based on the in vitro findings, the investigated gel composition containing decamethoxine and hyaluronic acid demonstrates potential anti-inflammatory and antimicrobial properties that stimulate the production of the antimicrobial factor antistreptolysin-O by tonsil cells, which might lead to increased antibody production against hemolytic streptococcus antigens.

Evaluation of immunomodulatory effect of aqueous extract of aloe vera in Wistar albino rat models

Aim of the study wasto evaluate the immunomodulatory effects of Aqueous extracts of Aloe vera in Wistar albino rats using humoral immune response (antibody titre), a cellular immune response, and a neutrophil adhesion test after oral administration. : 24 healthy Wistar albino rats of either sex were divided into 4 different groups containing 6 rats for each immunomodulatory model. Group I ,the control group received gum acacia suspended in normal saline; Group II rats were treated with dexamethasone (1 mg/kg bw)whereas Groups III &amp; IV received AloeVera aqueous extract at a dose of 125 mg/kg and 250 mg/kg, respectively. Each rat was antigenically challenged by injecting 0.1 ml of 0.5 × 10 SRBCs (suspended in normal saline) intraperitoneally. The study of humoral immune response was seen by measurement of antibody titre obtained on 20 day (7 day of Ag challenge) and 27 day (14 day of challenge) with sRBC considered the primary and secondary humoral immune response, respectively. For the cellular immune response, foot pad edema was calculated due to a hypersensitivity reaction after injection of sRBC into the .rat hind paw. A test of neutrophil adhesion is used to evaluate immunomodulatory activity. Aloe vera aqueous extracts at 250 mg/kg significantly improved a significant increase in paw edema volume indicated increased cell-mediated immunity, and elevated Ab titre on the 20th and 27th days served as a marker of increased humoral immune response. Additionally, AVE 250 mg/kg caused an increase in neutrophil adhesion, demonstrating its immunomodulatory effects. Aloe vera aqueous extracts at a dose of 250 mg/kg demonstrated immunomodulatory activity in a model using Wistar albino rats.Aloe vera extract at a dose of 250 mg/kg significantly increased hemagglutination antibody titers compared to the control group, indicating enhanced humoral immunity. This study demonstrates the immunostimulant properties of orally administered Aloe vera aqueous extract in Wistar albino rats. The extract increased antibody production, enhanced cell-mediated immunity, and improved neutrophil function. These findings support the potential of Aloe vera as a natural immunomodulator and warrant further exploration of its therapeutic applications.

Effect of Toxoplasma Infection Dosage on Igg, Igm, Fetus Weight and Body Length, and Necrosis of Placenta and Fetal Heart

One of the most prevalent zoonotic illnesses in the world, toxoplasmosis, affects both humans and animals and is caused by the parasite Toxoplasma gondii. The infection will trigger the immune system to increase antibody production. This study aims to determine the dose of toxoplasma that causes necrosis in rats placental and fetal hearts. This study was laboratory experimental research with a Randomized Control Trial (RCT). The study design used a post-test only with a control group design. The Ig G variable obtained from the control group (CG) and treatment group 3 (TG3) is the most significant because the mean value difference was the largest (176.56). The Ig M variable obtained from the control group with treatment group 3 (TG3) is the most significant because the mean value difference is the largest (33.47). The fetus weight variable obtained from the control group with treatment group 3 (TG3) is the most significant because the mean value difference is the largest (2.6). The body length variable obtained from the control group between treatment group 3 (TG3) is the most significant because the mean value difference is the largest (1.26). There was a significant difference in placental tissue necrosis (p = 0.034) and heart (p = 0.025) between the control group (CG) and treatment group 3 (TG3). Therefore, there was a significant difference in Ig G, Ig M, fetus weight, body length, placental tissue necrosis, and fetal heart at the 10³ dose compared to the 102, 101, and normal doses.

Rosmarinic acid enhances CHO cell productivity and proliferation through activation of the unfolded protein response and the mTOR pathway.

Rosmarinic acid (RA) has gained attraction in bioprocessing as a media supplement to improve cellular proliferation and protein production. Here, we observe up to a two-fold increase in antibody production with RA-supplementation, and a concentration-dependent effect of RA on cell proliferation for fed-batch Chinese hamster ovary (CHO) cell cultures. Contrary to previously reported antioxidant activity, RA increased the reactive oxygen species (ROS) levels, stimulated endoplasmic reticulum (ER) stress, activated the unfolded protein response (UPR), and elicited DNA damage. Despite such stressful events, RA appeared to maintained cell health via mammalian target of rapamycin (mTOR) pathway activation; both mTOR complex 1 (mTORC1) and mTOR complex 2(mTORC2) were stimulated in RA-supplemented cultures. By reversing such mTOR pathway activity through either chemical inhibitor addition or siRNA knockdown of genes regulating the mTORC1 and mTORC2 complexes, antibody production, UPR signaling, and stress-induced DNA damage were reduced. Further, the proliferative effect of RA appeared to be regulated selectively by mTORC2 activation and have reproduced this observation by using the mTORC2 stimulator SC-79. Analogously, knockdown of mTORC2 strongly reduced X-box binding protein 1 (XBP1) splicing, which would be expected to reduce antibody folding and secretion, sugging that reduced mTORC2 would correlate with reduced antibody levels. The crosstalk between mTOR activation and UPR upregulation may thus be related directly to the enhanced productivity. Our results show the importance of the mTOR and UPR pathways in increasing antibody productivity, and suggest that RA supplementation may obviate the need for labor-intensive genetic engineering by directly activating pathways favorable to cell culture performance.

Antibody response to 1.0 and 0.5 mL doses of an inactivated bacterial vaccine against bovine respiratory disease in young Holstein calves: a field trial.

Early vaccination of cattle with an inactivated commercial bacterial vaccine against bovine respiratory disease has been reported to increase antibody production and can alleviate the disease. However, its dosage has been little investigated in young Holstein calves. This study addresses the need to establish guide values for vaccine dosage in these animals. Healthy calves received an inactivated vaccine for Histophilus somni, Pasteurella multocida and Mannheimia haemolytica intramuscularly at the ages of 1 and 4 weeks. Administered vaccine doses were 1.0 mL for the primary and booster vaccinations (1.0 + 1.0 group), 0.5 mL for the primary and 1.0 mL for the booster vaccination (0.5 + 1.0 group), or 0.5 mL for both vaccinations (0.5 + 0.5 group). Differences in the vaccine responses between the 1.0 + 1.0 group and 0.5 + 1.0 group were minor. However, the number of calves with a positive vaccine response to H. somni in the 0.5 + 0.5 group was less than half of that in the 1.0 + 1.0 and 0.5 + 1.0 groups. In logistic regression analysis, although the booster vaccination dose was positively correlated with seropositivity for H. somni, the primary vaccination dose was not correlated with vaccine response. The number of calves with positive vaccine responses to M. haemolytica was low even after booster vaccination regardless of the dose. The dose of 0.5 mL can be used for primary vaccinations in newborn Holstein calves, but 1.0 mL may be required for booster vaccinations.

The mTORC1 pathway participate in hyper-function of B cells in immune thrombocytopenia.

B cell hyper-function plays an important role in the pathogenesis of immune thrombocytopenia (ITP), but the molecular mechanisms underlying such changes remain unclear. We sought to identify regulators of B cell dysfunction in ITP patients through transcriptome sequencing and the use of inhibitors. B cells were isolated from PBMC of 25 ITP patients for B cell function test and transcriptome sequencing. For the potential regulatory factors identified by transcriptome sequencing, the corresponding protein inhibitors were used to explore the regulatory effect of the regulatory factors on B cell dysfunction in vitro. In this study, increased antibody production, enhanced terminal differentiation and highly expressed costimulatory molecules CD80 and CD86 were found in B cells of patients with ITP. In addition, RNA sequencing revealed highly activated mTOR pathway in these pathogenic B cells, indicating that the mTOR pathway may be involved in B cell hyper-function. Furthermore, mTOR inhibitors rapamycin or Torin1 effectively blocked the activation of mTORC1 in B cells, resulting in reduce antibody secretion, impaired differentiation of B cells into plasmablasts and downregulation of costimulatory molecules. Interestingly, as an unspecific inhibitor of mTORC2 besides mTORC1, Torin1 did not show a stronger capacity to modulate B cell function than rapamycin, suggesting that the regulation of B cells by Torin1 may depend on blockade of mTORC1 rather than mTORC2 pathway. These results indicated that the activation of mTORC1 pathway is involved in B cell dysfunction in patients with ITP, and inhibition of mTORC1 pathway might be a potential therapeutic approach for ITP.

THE USE OF IMMUNOSTIMULANTS FROM PAPAYA LEAVES TO TREAT DISEASE AND INCREASE NON-SPECIFIC IMMUNITY IN FISH AND SHRIMP

The use of immunostimulants from papaya leaves as a treatment strategy for fish diseases has gained attention in the field of aquaculture. Initial studies have shown that the active compounds in papaya leaves have the potential as immunostimulants to enhance the fish immune system and combat disease infections. Previous studies have revealed that the administration of papaya leaf extracts in fish feed can stimulate immune responses, including activating immune cells such as macrophages and increasing antibody production. The compounds in papaya leaves also exhibit antimicrobial effects that help fight against pathogens causing diseases in fish. Although research findings indicate the potential use of papaya leaf immunostimulants, further studies are needed to understand their mechanisms of action comprehensively. Factors such as effective dosage, optimal administration methods, and their effects on various diseases must be clarified. Safety aspects should also be considered, including potential side effects and residues in fish intended for human consumption. Consideration should also be given to sustainable fish farming practices and the potential environmental impacts of the widespread use of papaya leaf immunostimulants. In conclusion, using immunostimulants from papaya leaves to treat fish diseases shows promising potential. However, further research is required to understand their effects thoroughly, determine the appropriate dosage, evaluate the safety, and consider sustainable aquaculture aspects before their use can be widely recommended in aquaculture practices.

An inter-species amino acid variation modulates signaling strength and function of CD28 in vitro and in vivo

Abstract Animal models do not always reflect the human condition. One such example was a phase one clinical trial of a CD28 super agonist antibody (CD28SA). In mice, CD28SA treatment expanded Tregs and reduced autoimmune disease; yet when human volunteers received CD28SA, they experienced life-threatening cytokine storm and multi-organ failure. CD28 is constitutively expressed on T cells and provides the canonical co-stimulatory “signal 2” needed for T cell activation. The proline residues in the CD28 PYAP domain are required for downstream signaling and this motif is conserved across species. However, the human PYAP domain is adjacent to an additional proline, while murine PYAP is followed by an inactive alanine. Previous in vitro studies have suggested this single amino acid variation modulates downstream signaling. We have developed a “humanized” mouse with a CD28 A to P substitution at residue 210 adjacent to the PYAP domain (CD28 A210P). In vitro, CD28 A210PT cells had increased p-Akt, JunB abundance, and produced more IL-2 compared to WT T cells when stimulated in vitro. In vivo, immunization with antigen/CFA emulsion, CD28 A210Pmice display increased antibody production, suggestive of enhanced CD28-mediated Tfh activity. In addition, we assessed the response of the “humanized” CD28 mice to the CD28 super agonist antibody. After injection with CD28 super agonist, CD28 A210Pmice had significantly increased weight loss, elevated and sustained pro-inflammatory cytokine production, and less Treg expansion compared to WT mice. This study suggests interspecies variation in CD28 signaling due to differences outside of the well-studied signaling domains can alter outcomes of CD28 ligation and promote divergent outcomes when targeted in vivo.

Exosome-Based Multivalent Vaccine: Achieving Potent Immunization, Broadened Reactivity, and Strong T-Cell Responses with Nanograms of Proteins.

Currently approved vaccines against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) have focused solely on the spike protein to provide immunity. The first vaccines were developed rapidly using spike mRNA delivered by lipid nanoparticles but required ultralow-temperature storage and have had limited immunity against variations in spike. Subsequently, protein-based vaccines were developed, which offer broader immunity but require significant time for development and the use of an adjuvant to boost the immune response. Here, exosomes were used to deliver a bivalent protein-based vaccine in which two independent viral proteins were used. Exosomes were engineered to express either SARS-CoV-2 delta spike (Stealth X-Spike [STX-S]) or the more conserved nucleocapsid (Stealth X-Nucleocapsid [STX-N]) protein on the surface. When administered as a single product (STX-S or STX-N) or in combination (STX-S+N), both STX-S and STX-N induced strong immunization with the production of potent humoral and cellular immune responses. Interestingly, these results were obtained with the administration of only nanograms of protein and without an adjuvant. In two independent animal models (mouse and rabbit), the administration of nanograms of the STX-S+N vaccine resulted in increased antibody production, potent neutralizing antibodies with cross-reactivity to other variants of spike, and strong T-cell responses. Importantly, no competition of immune responses was observed, allowing the delivery of nucleocapsid with spike to offer improved SARS-CoV-2 immunity. These data show that the StealthX exosome platform has the enormous potential to revolutionize vaccinology by combining the advantages of mRNA and recombinant protein vaccines into a superior, rapidly generated, low-dose vaccine resulting in potent, broader immunity. IMPORTANCE The pandemic emergency has brought to light the need for a new generation of rapidly developed vaccines that induce longer-lasting, potent, and broader immune responses. While the mRNA vaccines played a critical role during the emergency in reducing SARS-CoV-2 hospitalization rates and deaths, more efficient approaches are needed. A multivalent, protein-based vaccine delivered by exosomes could meet this urgent need due to the high speed of development, manufacturability, and the ability to produce a strong antibody response, with neutralizing antibodies and a strong T-cell response able to broadly combat viral infection with a minimum number of injections.

M6A methyltransferase METTL3 programs CD4+ T-cell activation and effector T-cell differentiation in systemic lupus erythematosus

BackgroundSystemic lupus erythematosus (SLE) is an autoimmune disorder in which excessive CD4+ T-cell activation and imbalanced effector T-cell differentiation play critical roles. Recent studies have implied a potential association between posttranscriptional N6-methyladenosine (m6A) modification and CD4+ T-cell-mediated humoral immunity. However, how this biological process contributes to lupus is not well understood. In this work, we investigated the role of the m6A methyltransferase like 3 (METTL3) in CD4+ T-cell activation, differentiation, and SLE pathogenesis both in vitro and in vivo.MethodsThe expression of METTL3 was knocked down and METTL3 enzyme activity was inhibited using siRNA and catalytic inhibitor, respectively. In vivo evaluation of METTL3 inhibition on CD4+ T-cell activation, effector T-cell differentiation, and SLE pathogenesis was achieved using a sheep red blood cell (SRBC)-immunized mouse model and a chronic graft versus host disease (cGVHD) mouse model. RNA-seq was performed to identify pathways and gene signatures targeted by METTL3. m6A RNA-immunoprecipitation qPCR was applied to confirm the m6A modification of METTL3 targets.ResultsMETTL3 was defective in the CD4+ T cells of SLE patients. METTL3 expression varied following CD4+ T-cell activation and effector T-cell differentiation in vitro. Pharmacological inhibition of METTL3 promoted the activation of CD4+ T cells and influenced the differentiation of effector T cells, predominantly Treg cells, in vivo. Moreover, METTL3 inhibition increased antibody production and aggravated the lupus-like phenotype in cGVHD mice. Further investigation revealed that catalytic inhibition of METTL3 reduced Foxp3 expression by enhancing Foxp3 mRNA decay in a m6A-dependent manner, hence suppressing Treg cell differentiation.ConclusionIn summary, our findings demonstrated that METTL3 was required for stabilizing Foxp3 mRNA via m6A modification to maintain the Treg differentiation program. METTL3 inhibition contributed to the pathogenesis of SLE by participating in the activation of CD4+ T cells and imbalance of effector T-cell differentiation, which could serve as a potential target for therapeutic intervention in SLE.

The role of bee venom on immunological and hematological parameters in albino rats

Bee venom (BV) showed therapeutical effects to treat various diseases as it contains at least 18 pharmacologically active components including various enzymes, peptides, and amines. This study aimed to evaluate the action of BV on some hematological parameters, humoral and cellular immunity, and the determination of antioxidant levels in male albino rats. The study included 40 male albino rats (190-210 g), divided into four groups. Three groups were injected subcutaneously with three different doses of BV (2.5, 5, and 10 mg/kg, respectively). The control group was injected with saline solution. Blood samples were obtained to measure total leucocytes count (TLC), differential leukocytes count, hematological parameters (hemoglobin (Hb), hematocrit (HCT), red blood cells (RBCs), mean cell volume (MCV), mean cell hemoglobin (MCH), mean cell hemoglobin concentration (MCHC) and Platelets. Sera were used to assess immunoglobulins (IgM, IgG, IgA, and IgE), some cytokines e.g., tumor necrosis factor-alpha (TNF-α), tumor growth factor beta (TGF-β), interleukins 6 and 10 (IL-6, IL-10), and some antioxidant levels malondialdehyde (MDA), super oxide dismutase (SOD), and glutathione (GSH). Data showed that BV therapy increased antibody production levels (IgM, IgG, and IgA) while decreasing IgE levels. Hematological markers (Hb and lymphocytes) were increased. BV increased total TGF- β and IL-10 but decreased total TNF- α and IL-6. On the antioxidant scale, an increase in SOD, CAT, and GSH levels was observed, accompanied by a decrease in MDA levels. However, the BV treatment led to a significant reduction in the number of eosinophils, monocytes, and neutrophils (p < 0.05). In conclusion, our findings suggested that BV may be utilized to increase the effectiveness of various immunological and hematological parameters.

The Oral Inactivated Porcine Epidemic Diarrhea Virus Presenting in the Intestine Induces Mucosal Immunity in Mice with Alginate–Chitosan Microcapsules

The porcine epidemic diarrhea virus, PEDV, which causes diarrhea, vomiting and death in piglets, causes huge economic losses. Therefore, understanding how to induce mucosal immune responses in piglets is essential in the mechanism and application against PEDV infection with mucosal immunity. A method of treatment in our research was used to make an oral vaccine that packaged the inactive PEDV with microencapsulation, which consisted of sodium alginate and chitosan, and adapted the condition of the gut in mice. The in vitro release experiment of microcapsules showed that inactive PEDV was not only easily released in saline and acid solutions but also had an excellent storage tolerance, and was suitable for use as an oral vaccine. Interestingly, both experimental groups with different doses of inactive virus enhanced the secretion of specific antibodies in the serum and intestinal mucus, which caused the effective neutralization against PEDV in the Vero cell by both IgG and IgA, respectively. Moreover, the microencapsulation could stimulate the differentiation of CD11b+ and CD11c+ dendritic cells, which means that the microencapsulation was also identified as an oral adjuvant to help phagocytosis of dendritic cells in mice. Flow cytometry revealed that the B220+ and CD23+ of the B cells could significantly increase antibody production with the stimulation from the antigens' PEDV groups, and the microencapsulation could also increase the cell viability of B cells, stimulating the secretion of antibodies such as IgG and IgA in mice. In addition, the microencapsulation promoted the expression of anti-inflammatory cytokines, such as IL-10 and TGF-β. Moreover, proinflammatory cytokines, such as IL-1, TNF-α, and IL-17, were inhibited by alginate and chitosan in the microencapsulation groups compared with the inactivated PEDV group. Taken together, our results demonstrate that the microparticle could play the role of mucosal adjuvant, and release inactivated PEDV in the gut, which can effectively stimulate mucosal and systemic immune responses in mice.

Chimeric Hepatitis B core virus-like particles harboring SARS-CoV2 epitope elicit a humoral immune response in mice

BackgroundVirus-like particles are an interesting vector platform for vaccine development. Particularly, Hepatitis B virus core antigen has been used as a promising VLP platform. It is highly expressed in different recombinant expression systems, such as E. coli, and self-assembled in vitro. It effectively improves the immunogenicity of foreign antigenic epitopes on its surface. Various foreign antigens from bacteria, viruses, and protozoa can be genetically inserted into such nanoparticles. The effective immunogenicity due to VLP vaccines has been reported. However, no research has been performed on the SARS-CoV2 vaccine within this unique platform through genetic engineering. Considering the high yield of target proteins, low cost of production, and feasibility of scaling up, E. coli is an outstanding expression platform to develop such vaccines. Therefore, in this investigation, we planned to study and develop a unique HBc VLP-based vaccine against SARS-Cov2 utilizing the E. coli expression system due to its importance.ResultsInsertion of the selected epitope was done into the major immunodominant region (MIR) of truncated (149 residues) hepatitis B core capsid protein. The chimeric protein was constructed in PET28a+ and expressed through the bacterial E. coli BL21 expression system. However, the protein was expressed in inclusion body forms and extracted following urea denaturation from the insoluble phase. Following the extraction, the vaccine protein was purified using Ni2 + iminodiacetic acid (IDA) affinity chromatography. SDS-PAGE and western blotting were used to confirm the protein expression. Regarding the denaturation step, the unavoidable refolding process was carried out, so that the chimeric VLP reassembled in native conformation. Based on the transmission electron microscopy (TEM) analysis, the HBC VLP was successfully assembled. Confirming the assembled chimeric VLP, we explored the immunogenic effectivity of the vaccine through mice immunization with two-dose vaccination with and without adjuvant. The utilization of adjuvant was suggested to assess the effect of adjuvant on improving the immune elicitation of chimeric VLP-based vaccine. Immunization analysis based on anti-spike specific IgG antibody showed a significant increase in antibody production in harvested serum from immunized mice with HBc-VLP harboring antigenic epitope compared to HBc-VLP- and PBS-injected mice.ConclusionsThe results approved the successful production and the effectiveness of the vaccine in terms of humoral IgG antibody production. Therefore, this platform can be considered a promising strategy for developing safe and reasonable vaccines; however, more complementary immunological evaluations are needed.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E)protein-encoding sequenceand luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Recombinant pseudorabies virus (PRV) expressing stabilized E2 of classical swine fever virus (CSFV) protects against both PRV and CSFV

Pseudorabies (PR) and classical swine fever (CSF) are economically important infectious diseases of pigs. Most pig farms in China are immunized against these two diseases. Here, we describe a stabilized E2 protein as an immunogen inserted into the PRV genome as a bivalent live virus-vectored vaccine. The E2 protein has 48 variant sites, there are 2–5 candidate amino acids per variant site, and the relative energy contribution of each amino acid to E2 energy was calculated. Combined substitutions of amino acids at the neighbor variant site (neighbor substitution) were performed to obtain the E2 protein sequence with the lowest energy (stabilized E2). Multiple amino acid substitutions at 48 variant sites were performed, and the results were consistent with neighbor substitutions. The stabilized E2 sequence was obtained, and its energy decreased by 22 Rosetta Energy Units (REUs) compared with the original sequence. After the recombinant PRV expressing stabilized E2 of CSFV was constructed, the secretion efficiency of stabilized E2 was increased by 2.97 times, and the thermal stability was increased by 10.5 times. Immunization of mice resulted in a 2-fold increase in antibody production, and a balanced antibody level against subtype 1.1 and subtype 2.1d E2 was achieved. In rabbits immunized, the lethal challenge of PRV-ZJ and the fever response induced by CSFV could be prevented simultaneously. These findings suggest that rPRV-muta/287aaE2 is a promising bivalent vaccine against CSFV and PRV infections.

Evaluation of Antibody Responses in Patients with B-Cell Malignancies after Two and Three Doses of Anti-SARS-CoV-2 S Vaccination-A Retrospective Cohort Study.

Patients with B-cell malignancies are at a higher risk of severe SARS-CoV-2 infections. Nevertheless, extensive data on the immune responses of hematological patients and the efficacy of the third dose of the vaccine are scarce. The goal of this study was to determine standardized anti-SARS-CoV-2 S antibody levels and to evaluate differences between treatment modalities in response to the second and third vaccines among patients with B-cell malignancies treated at the University Hospital Krems and the University Hospital of Vienna. The antibody levels of a total of 80 patients were retrospectively analyzed. The results indicate a significant increase in antibody production in response to the third vaccination. The highest increases could be observed in patients in a "watchful-waiting" and "off-therapy" setting. Encouragingly, approximately one-third of patients who did not develop antibodies in response to two vaccinations achieved seroconversion after the third vaccination. "Watchful-waiting", "off-therapy" and treatment with BTK inhibitors were indicative for increased antibody response after the third dose compared to anti-CD19 CAR T-cell and anti-CD-20 antibody treatment. In summary, the results of this study underline the pre-eminent role of the need for complete vaccination with three doses for the development of protective immunity in patients with B-cell malignancies.

The effect of probiotic use on ABO antibody titers.

The use of probiotics brings numerous benefits to the immune system, including an increase in antibody production. The development of ABO antibodies may occur naturally due to the bacteria of the intestinal microbiota. However, high titers of ABO antibodies can lead to hemolytic disease of the fetus and newborn and can cause immune transfusion reactions. In this context, this study aimed to evaluate the effect of probiotic consumption on ABO antibody titers in humans. ABO blood group, ABO antibody titer, and fecal pH and Bifidobacteria concentration were determined for 126 healthy individuals before and after daily consumption of yogurt containing Lactobacillus acidophilus and Bifidobacterium lactis over a 1-month period. No changes in fecal pH were observed after probiotic consumption, regardless of ABO blood group. There was, however, an increase in the fecal concentration of Bifidobacteria in individuals with blood group A but not for those with group B or O. A decrease in the titer of anti-B was observed, despite the increase in the concentration of Bifidobacteria in feces being unrelated to fecal pH, in blood group A individuals. Our study, therefore, sought to understand the relationship between probiotics and the antibody titer of the ABO blood system. Despite our findings, further human studies are needed with other probiotic strains and molecular analyses of the intestinal microbiota.