Important Traditional Chinese Medicine Research Articles

In Vitro In Silico Screening Strategy and Mechanism of Novel Tyrosinase Inhibitory Peptides from Nacre of Hyriopsis cumingii.

For thousands of years, pearl and nacre powders have been important traditional Chinese medicines known for their skin whitening effects. To prepare the enzymatic hydrolysates of Hyriopsis cumingii nacre powder (NP-HCH), complex enzymatic hydrolysis by pineapple protease and of neutral protease was carried out after the powder was pre-treated with a high-temperature and high-pressure method. The peptides were identified using LC-MS/MS and picked out through molecular docking and molecular dynamics simulations. Subsequently, the tyrosinase inhibitory and antioxidant properties of novel tyrosinase inhibitory peptides were investigated in vitro. In addition, the enzymatic activity of tyrosinase in B16F10 cells as well as melanin content and antioxidant enzyme levels were also examined. The results showed that a tyosinase inhibitory peptide (Tyr-Pro-Asn-Pro-Tyr, YPNPY) with an efficient IC50 value of 0.545 ± 0.028 mM was identified. The in vitro interaction results showed that YPNPY is a reversible competitive inhibitor of tyrosinase, suggesting that it binds to the free enzyme. The B16F10 cell whitening test revealed that YPNPY can reduce the melanin content of B16F10 cells by directly inhibiting the activity of intracellular tyrosinase. Additionally, it indirectly affects melanin production by acting as an antioxidant. These results suggest that YPNPY could be widely used as a tyrosinase inhibitor in whitening foods and drugs.

Elucidating the interaction of rhizosphere microorganisms and environmental factors influencing the quality of Polygonatum kingianum Coll. et Hemsl.

Polygonatum kingianum Collett & Hemsl., is one of the most important traditional Chinese medicines in China. The purpose of this study is to investigate the relationship between herb quality and microbial-soil variables, while also examining the composition and structure of the rhizosphere microbial community in Polygonatum kingianum, the ultimate goal is to provide a scientific approach to enhancing the quality of P. kingianum. Illumina NovaSeq technology unlocks comprehensive genetic variation and biological functionality through high-throughput sequencing. And in this study it was used to analyze the rhizosphere microbial communities in the soils of five P. kingianum planting areas. Conventional techniques were used to measure the organic elements, pH, and organic matter content. The active ingredient content of P. kingianum was identified by High Performance Liquid Chromatography (HPLC) and Colorimetry. A total of 12,715 bacterial and 5487 fungal Operational Taxonomic Units (OTU) were obtained and taxonomically categorized into 81 and 7 different phyla. Proteobacteria, Bacteroidetes, and Acidobacteriae were the dominant bacterial phyla Ascomycota and Basidiomycota were the dominat fungal phyla. The key predictors for bacterial community structure included hydrolysable nitrogen and available potassium, while for altering fungal community structure, soil organic carbon content (OCC), total nitrogen content (TNC), and total potassium content (TPOC) were the main influencing factors. Bryobacter and Candidatus Solibacter may indirectly increase the polysaccharide content of P. kingianum, and can be developed as potential Plant Growth Promoting Rhizobacteria (PGPR). This study has confirmed the differences in the soil and microorganisms of different origins of P. kingianum, and their close association with its active ingredients. And it also broadens the idea of studying the link between plants and microorganisms.

Chromosome-Level Assembly Reveals a Fifteen-Chromosome Aneuploid Genome and Environmental Adaptation Strategy of Chinese Traditional Medical Fungus Wolfiporia hoelen.

The sclerotia of Wolfiporia hoelen are one of the most important traditional Chinese medicines and foods commonly used in China, Japan, Korea, and other Asian countries. To provide a high-quality reference genome and deepen our understanding of the genome of W. hoelen to elucidate various biological phenomena. In this study, we assembled three genomes of W. hoelen using a combination of Nanopore and Illumina sequencing strategies. The fifteen-chromosome genome L7 of W. hoelen was assembled with two-sided telomere and rDNA sequences for the first time. The chromosome count was subsequently confirmed through collinearity analysis, correcting the previous belief that W. hoelen had only fourteen chromosomes. Moreover, the aneuploid genome was discovered in W. hoelen for the first time through sequencing depth analysis of different chromosomes, and only some strains of W. hoelen exhibit aneuploid genomes. According to the genome analysis of homokaryotic offspring and protoplast-isolated strains, a potential variation in chromosome allocation patterns was revealed. Moreover, the gene function enrichment analysis of genes on reduplicated chromosomes demonstrated that aneuploidy in the genome may be the result of environmental adaptation for W. hoelen. The discovery of an aneuploid genome also provides new ideas for genetic improvement of W. hoelen.

An integrated approach for discrimination of Magnoliae officinalis cortex before and after being processed by ginger juice combining LC/MS, GC/MS, intelligent sensors, and chemometrics.

Magnoliae officinalis cortex (MOC) is an important traditional Chinese medicine (TCM), and both raw and stir-fried MOC were commonly used in clinic. This study aimed to discriminate MOC and MOC stir-fried with ginger juice (MOCG) using an integrated approach combining liquid chromatography/mass spectrometry (LC/MS), gas chromatography/mass spectrometry (GC/MS), intelligent sensors, and chemometrics. The sensory characters of the samples were digitalized using intelligent sensors, i.e., colorimeter, electronic nose, and electronic tongue. Meanwhile, the chemical profiles of the samples were analyzed using LC/MS and GC/MS methods. Chemometric models were constructed to discriminate samples of MOC and MOCG based on not only the sensory data but also the chemical data. The differential sensory characters (L* and b* from colorimeter, ANS from electronic tongue, W1S and W2S from electronic nose) and the differential chemical compounds (26 and 11 compounds from LC/MS and GC/MS, respectively) were discovered between MOC and MOCG. Furthermore, twelve differential compounds showed good relations with differential sensory characters. Finally, artificial neural network models were established to discriminate samples of MOC and MOCG, in which W1S, W2S, ANS, b*, and 10 differential compounds were among the top 10 important variables, respectively. Samples of MOC and MOCG can be discriminated not only by the digitalized data of color, taste, and scent detected by intelligent sensors but also by chemical information obtained from LC/MS and GC/MS using chemometrics. The variations in sensory characters and chemical compounds between MOC and MOCG partially resulted from the Maillard reaction products and the oxidation of some compounds in the stir-frying process.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Chromosome-Scale Genome Assembly Provides Insights into Fresh Pine Wood Decay Strategies of the Wolfiporia hoelen

The sclerotia of Wolfiporia hoelen (Fr.) Y.C. Dai & V. Papp is an important traditional Chinese medicine with diverse pharmacological properties. This study utilized a combination of PacBio Long-Read Sequencing, Illumina Short-Read Sequencing, and Hi-C Sequencing to generate a high-quality chromosome-level genome assembly of a W. hoelen strain Minling A5. There were 112 contigs in the genome, with 62.95 Mb in total length and 4.21 Mb in length for the contig N50. The average GC content was 51.89%. Based on Hi-C data, we corrected the CCS data and scaffolded them into 14 pseudo-chromosomes. The genome contained 44.37% repetitive sequences and 12,670 protein-coding genes, 86.53% (10,963) of which could be functionally annotated in at least one of the KOG, GO, Pfam, Swissprot, TrEMBL, NR, and KEGG databases. In addition, 240 transfer RNAs, 97 ribosomal RNAs, and 103 other non-coding RNAs were identified in the W. hoelen genome. A total of 755 pseudogenes were also identified, with an average length of 2665.51 bp. Further, there were 398, 100, 2837, 519, and 2068 genes annotated by CAZymes, TCDB, PHI, P450, and DFVF databases, respectively. One notable attribute of W. hoelen is its capacity to thrive in a substrate of fresh pine sawdust. Through an analysis of the growth on various pure wood sawdust culture media, we found that the growth of W. hoelen and Sparassis latifolia on pine sawdust was similar to that on broad-leaved wood sawdust, while the growth of Pleurotus ostreatus, P. eryngii, and Cyclocybe aegerita was slower than that on broad-leaved wood sawdust. By the functional annotation analysis of orthogroups in these five mushroom-forming fungi, it was determined that 645 orthogroups were specifically common in W. hoelen and S. latifolia. The genes in these specific orthogroups were significantly enriched in 12 pathways, including steroid biosynthesis, biosynthesis of antibiotics, and tyrosine metabolism. The high-quality genome and comparative genome analysis results significantly contribute to advancing our foundational knowledge of W. hoelen biology, while also offering valuable insights for the development of innovative biotechnological approaches aimed at enhancing the efficient and sustainable utilization of Pinus.

Characterization and phylogenetic analysis of the complete chloroplast genome of Carpesium lipskyi (Asteraceae, Inuleae)

The species of Carpesium lipskyi C.Winkl. 1998 is an important traditional Chinese medicine in China. In this study, the complete chloroplast (cp) genome of C. lipskyi was determined and analyzed. The result showed that the complete cp genome of C. lipskyi was 151,244 bp in length, consisting of a large single-copy (LSC) region of 82,908 bp, a small single-copy (SSC) region of 18,430 bp, and a pair of inverted repeats (IRs) of 24,953 bp. The overall GC content of the C. lipskyi is 37.68%. The species of C. lipskyi possessed 127 genes, including 83 protein-coding genes, 36 transfer RNA genes, and eight ribosomal RNA genes. The present study found that Inula is sister groups with the closest genetic relationship. The obtained knowledge could provide useful information for future phylogenetic, taxonomic, and evolutionary studies on Inuleae.

Genome-Wide Identification and Characterization of miRNAs and Natural Antisense Transcripts Show the Complexity of Gene Regulatory Networks for Secondary Metabolism in Aristolochia contorta.

Aristolochia contorta Bunge is an academically and medicinally important plant species. It belongs to the magnoliids, with an uncertain phylogenetic position, and is one of the few plant species lacking a whole-genome duplication (WGD) event after the angiosperm-wide WGD. A. contorta has been an important traditional Chinese medicine material. Since it contains aristolochic acids (AAs), chemical compounds with nephrotoxity and carcinogenicity, the utilization of this plant has attracted widespread attention. Great efforts are being made to increase its bioactive compounds and reduce or completely remove toxic compounds. MicroRNAs (miRNAs) and natural antisense transcripts (NATs) are two classes of regulators potentially involved in metabolism regulation. Here, we report the identification and characterization of 223 miRNAs and 363 miRNA targets. The identified miRNAs include 51 known miRNAs belonging to 20 families and 172 novel miRNAs belonging to 107 families. A negative correlation between the expression of miRNAs and their targets was observed. In addition, we identified 441 A. contorta NATs and 560 NAT-sense transcript (ST) pairs, of which 12 NATs were targets of 13 miRNAs, forming 18 miRNA-NAT-ST modules. Various miRNAs and NATs potentially regulated secondary metabolism through the modes of miRNA-target gene-enzyme genes, NAT-STs, and NAT-miRNA-target gene-enzyme genes, suggesting the complexity of gene regulatory networks in A. contorta. The results lay a solid foundation for further manipulating the production of its bioactive and toxic compounds.

Cytochemical localization and synthesis mechanism of the glucomannan in pseudobulbs of Bletilla striata Reichb. f.

The dried pseudobulbs of Bletilla striata, an important traditional Chinese medicine named BaiJi, have an extraordinary polysaccharide content and excellent prospects for medicinal effects. However, the distribution and molecular mechanism underlying biosynthesis are poorly understood. In this study, chemical and immunologic analyses were performed in representative tissues of B. striata, and the results showed that what are conventionally termed Bletilla striata polysaccharides (BSPs) are water-soluble polysaccharides deposited only in pseudobulbs. The structural component of BSPs is glucomannan, with a mannose:glucose mass ratio of ~3:2. BSPs are present in the parenchyma of the pseudobulbs in cells known as glucomannan idioblasts and distributed in the cytoplasm within cellular membranes, but are not contained in the vacuole. Comparative transcriptomics and bioinformatics analyses mapped the pathway from sucrose to BSP and identified BsGPI, BsmanA, and BsCSLAs as the key genes of BSP biosynthesis, suggesting that the functional differentiation of the cellulose synthase-like family A (CSLA) may be critical for the flow of glucomannan to the BSP or cell wall. Subsequently, virus-mediated gene silencing showed that silencing of two CSLAs (Bs03G11846 and Bs03G11849) led to a decrease in BSP content, and yeast two-hybrid and luciferase complementation experiments confirmed that four CSLAs (Bs03G11846, Bs03G11847, Bs03G11848, and Bs03G11849) can form homo- or heterodimers, suggesting that multiple CSLAs may form a large complex that functions in BSP synthesis. Our results provide cytological evidence of BSP and describe the isolation and characterization of candidate genes involved in BSP synthesis, laying a solid foundation for further research on its regulation mechanisms and the genetic engineering breeding of B. striata.

Biology of Callistethus plagiicollis (Coleoptera: Scarabaeoidea: Rutelinae) and comparative morphology of its larvae.

Larvae of the beetle subfamily Rutelinae are poorly described in the literature. Notably, the morphology of the larvae of Callistethus plagiicollis Fairmaire has not previously been analyzed. Here, we report for the first time that these larvae feed on the tubers and roots of Gastrodia elata Blume, an important traditional Chinese herbal medicine, which causes a reduction in the yield and economic value of G. elata. We employed scanning electron microscopy and light microscopy to investigate the morphology and occurrence regularity of egg, larvae, pupae, and adult specimens of C. plagiicollis collected from the G. elata planting base in Guizhou Province, China, with a focus on the ultrastructure of mature larvae. The results revealed one generation of C. plagiicollis per year in the study area and three instar stages of larvae. Mature larvae were identified by the following characteristics: raster without palidia with a large number of hamate setae, antennal apex containing seven sensilla basiconica, larval haptomerum containing eight sensilla styloconica and four enlarged heli, and seven longitudinally arranged stridulatory teeth on the stipes of the maxilla. The combination of scanning electron and light microscopy effectively revealed the difference between membranous and sclerotized structures, ensuring accurate identification of C. plagiicollis larvae. By determining the feeding characteristics and occurrence regularity of C. plagiicollis, this study has implications for improved pest management in G. elata crops. RESEARCH HIGHLIGHTS: We identified C. plagiicollis as a new pest of G. elata, a traditional Chinese medicine Scanning electron and light microscopy were combined to analyze the morphology of the mature larvae of C. plagiicollis for the first time We determined the feeding characteristics and occurrence regularity of C. plagiicollis, which can be used to develop effective pest management strategies.

Elucidating the distinctive regulatory effects and mechanisms of active compounds in Salvia miltiorrhiza Bunge via network pharmacology: Unveiling their roles in the modulation of platelet activation and thrombus formation

Salvia miltiorrhiza Bunge. (DS), as an important traditional Chinese medicine (TCM), has a long history of usage for promoting blood circulation and removing blood stasis. Modern studies have shown that the chemical components of DS have many biological activities such as cardiovascular protection, anti-arrhythmia, anti-atherosclerosis, improvement of microcirculation, protection of myocardium, inhibition and removal of platelet aggregation. Nevertheless, the action mechanism of DS as well its active compounds on platelet activation has not been fully uncovered. This study aimed to find out the potential targets and mechanisms of DS in the modulation of platelet activation and thrombosis, using network pharmacology and biological experimental. These compounds with anti-thrombotic activity in DS, cryptotanshinone (CPT), isoeugenol (ISO) and tanshinone IIA (TSA), together with the corresponding targets being Src, Akt and RhoA are screened by network pharmacology. We confirmed that ISO, CPT and TSA dose-dependently inhibited platelet activation in vitro, mainly by inhibiting agonist-induced clot retraction, aggregation and P-selectin and ATP release. The western blot findings indicated that ISO, CPT, and TSA led to reduced levels of p-Akt and p-ERK in activated platelets. Additionally, ISO and TSA were observed to decrease p-cSrc expression while increasing RhoA expression. ISO, CPT, and TSA demonstrated a potential to restrict the advancement of carotid arterial thrombosis in vivo. We confirm that ISO, CPT and TSA are the key anti-thrombotic active compounds in DS. These active compounds exhibit unique inhibitory effects on platelet activation and thrombus formation by modulating the Akt/ERK and cSrc/RhoA signaling pathways.

Predicting the Pharmacological Targets of Astragalus membranaceus against Hypertensive Nephropathy

Objective: Hypertension is one of the main causes of chronic kidney disease. Astragalus membranaceus (AM), an important traditional Chinese medicine for treating hypertensive nephropathy, has a complex composition that makes it challenging to explore its mechanism of action and limits its clinical application. This study aims to investigate the underlying mechanism of AM in treating hypertensive nephropathy. Methods: We retrieved all the compound data of AM from the Traditional Chinese Medicine Systems Pharmacology database and screened out the active compounds and their target proteins. Then, a network of candidate compounds and target compounds of AM was constructed using Cytoscape software. Furthermore, hypertensive nephropathy-related genes from the DisGeNET and GeneCards databases were intersected with AM target proteins and hypertensive nephropathy-related genes to determine the potential targets of AM in treating hypertensive nephropathy. Finally, after performing Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses, we conducted molecular docking to verify the interaction between the main active ingredients of AM and the core targets. Results: A total of 87 effective components of AM were obtained from the Traditional Chinese Medicine Systems Pharmacology (TCMSP) database. According to the network of active compounds and their target proteins, 18 of the 20 effective compounds in AM could act on 210 proteins. Taking the intersection of 274 hypertensive nephropathy-related genes and AM target proteins, 49 potential targets of AM in treating hypertensive nephropathy were identified. Using the median degree value, we determined 25 core targets of AM in treating hypertensive nephropathy. GO enrichment analysis showed that the biological processes of AM on hypertensive nephropathy mainly focused on the inflammatory response, hypoxia response, angiogenesis, cell proliferation, and cell migration. KEGG pathway enrichment analysis mainly involved cancer pathways, the AGE-RAGE signaling pathway in diabetic complications, blood flow shear stress, and atherosclerosis. Molecular docking results showed that quercetin, kaempferol, and 7-O-methylisomucronulatol had strong binding activity with several target proteins and may exert protective effects by stabilizing the interaction between molecules through the intermolecular forces of hydrogen bonds. Conclusion: This study reveals the targets of AM in treating hypertensive nephropathy using network pharmacology and molecular docking, providing new clues for developing novel drugs for hypertensive nephropathy and basic research development.

Ridge planting increases the rhizosphere microbiome diversity and improves the yield of Pinellia ternata (Thunb.) Breit in North China.

Pinellia ternata (Thunb.) Breit is an important traditional Chinese medicine. In North China, conventional flat planting of P. ternate is prone to root rot during the rainy season, leading to severe yield loss. Variations in planting patterns (e.g., ridge planting) can effectively alleviate this situation. However, the relationship between planting patterns and the changes induced by rhizosphere microbiome still needs to be determined. In this study, we clarified the effect of ridge planting on the yield of P. ternata and rhizosphere microbial community using high-throughput amplicon sequencing of 16S rRNA. Field experiments showed that ridge planting could increase the yield of P. ternata by 72.69% compared with flat planting. The high-throughput sequencing results demonstrated that fungal and bacterial communities in rhizosphere siols of flat and ridge planting showed obvious difference in diversity, structure, relative abundance, and community composition. The fungal phyla Zygomycota, Basidiomycota, Glomeromycota, and the bacterial phyla Chlamydiae, Tenericutes, and Hydrogenedentes were present in a higher relative abundance in the rhizosphere of ridge planting. Adonis multivariate analysis of variance results showed that 29 bacterial genera were significantly up/down-regulated, and only 4 fungal genera were changed considerably in ridge planting soil, indicating that the bacterial community composition varied significantly between the two treatments. Correlation analysis revealed that the yield of P. ternata was positively correlated with fungal genera Emericellopsis while negatively correlated with bacterial genera Acetobacter, Iamia, and fungal genera Thielavia. Overall, this study showed that ridge cropping significantly impacts the diversity and composition of the rhizosphere microbiome. It creates an environment favorable for crop growth and can be an effective planting strategy for P. ternata in areas with irrigation and high monsoon rainfall in North China.

Characterization of the metabolites of Eucommiae Cortex in rats provides a further insight into its estrogen-like effective substances

Eucommiae Cortex is one of important traditional Chinese medicines (TCMs) used in Asia for preventing and treating osteoporosis induced by estrogen deficiency. However, the low exposure of prototype components in Eucommiae Cortex in vivo is difficult to interpret its efficacy. Under the guidance of UPLC-Q/TOF-MS, 42 metabolites including 32 lignans and 10 phenolics, 21 of which were new compounds, were isolated from rat urine and feces after oral administration of aqueous extract of E. ulmoides Oliv. by various chromatographic techniques. Their structures were determined based on extensive physicochemical analyses and spectral data. Their absolute configurations were determined by experimental and calculated ECD spectra, along with the calculated NMR with DP4 evaluation. Additionally, all isolated metabolites were evaluated for their estrogen-like activities, and there are 15 metabolites having estrogen-like effects after assessing influences in MCF-7 cells. Further, Dual Luciferase Reporter Gene Assay was used to determine their activation with estrogen receptor, M10 and M11 mixtures, M14, M19, M33, M27, M31, M38-M41 could activate ERα, and M19 and M41 could activate ERβ. These results not only clarify the pharmacological substances of Eucommiae Cortex, but also provide a basis for guiding its clinical application.

Role of plant metabolites in the formation of bacterial communities in the rhizosphere of Tetrastigma hemsleyanum.

Tetrastigma hemsleyanum Diels et Gilg, commonly known as Sanyeqing (SYQ), is an important traditional Chinese medicine. The content of bioactive constituents varies in different cultivars of SYQ. In the plant growth related researches, rhizosphere microbiome has gained significant attention. However, the role of bacterial communities in the accumulation of metabolites in plants have not been investigated. Herein, the composition of bacterial communities in the rhizosphere soils and the metabolites profile of different SYQ cultivars' roots were analyzed. It was found that the composition of microbial communities varied in the rhizosphere soils of different SYQ cultivars. The high abundance of Actinomadura, Streptomyces and other bacteria was found to be associated with the metabolites profile of SYQ roots. The findings suggest that the upregulation of rutin and hesperetin may contribute to the high bioactive constituent in SYQ roots. These results provide better understanding of the metabolite accumulation pattern in SYQ, and also provide a solution for enhancing the quality of SYQ by application of suitable microbial consortia.

Poria cocos Lanostane Triterpenoids Extract Promotes Collagen and Hyaluronic Acid Production in D-Galactose-Induced Aging Rats.

The global aging population is expanding at an increasingly rapid pace, with approximately one-fourth of the world's population expected to be composed of elderly individuals by 2050. Aging skin is one of the major characteristics expressed in the elderly. The study comprehensively utilizes both cell and animal experiments to confirm the skin anti-aging effects of Poria cocos (P. cocos), which is one of the most important traditional Chinese medicines classified as tonic Chinese medicine, commonly used to treat physical weakness and aging-associated diseases. We demonstrate in this study that P. cocos lanostane triterpenoids extract (Lipucan®) ameliorates aging skin and promotes collagen accumulation and hyaluronic acid production in galactose-induced aging rats. Purified lanostane triterpenoids were initially identified as active components in P. cocos, which significantly increased collagen and hyaluronic acid levels in cultured human skin cells.

Dendrobium huoshanense Polysaccharide Improves High-Fat Diet Induced Liver Injury by Regulating the Gut-Liver Axis.

Dendrobium huoshanense is an important Traditional Chinese medicine that thickens the stomach and intestines. Its active ingredient Dendrobium huoshanense polysaccharide (DHP), was revealed to relieve the symptoms of liver injury. However, its mechanism of action remains poorly understood. This study aimed to investigate the mechanism of DHP in protecting the liver. The effects of DHP on lipid levels, liver function, and intestinal barrier function were investigated in mice with high-fat diet-induced liver damage. Changes in the gut flora and their metabolites were analyzed using 16S rRNA sequencing and metabolomics. The results showed that DHP reduced lipid levels, liver injury, and intestinal permeability. DHP altered the intestinal flora structure and increased the relative abundance of Bifidobacterium animalis and Clostridium disporicum. Furthermore, fecal metabolomics revealed that DHP altered fecal metabolites and significantly increased levels of gut-derived metabolites, spermidine, and indole, which have been reported to inhibit liver injury and improve lipid metabolism and the intestinal barrier. Correlation analysis showed that spermidine and indole levels were significantly negatively correlated with liver injury-related parameters and positively correlated with the intestinal species B. animalis enriched by DHP. Overall, this study confirmed that DHP prevented liver injury by regulating intestinal microbiota dysbiosis and fecal metabolites.

Wunorlactones A−G, seven undescribed 7/8/5 and 7/8/3 carbon skeleton schinortriterpenoids from the stems and leaves of Schisandra chinensis, and their neuroprotective activities

Schisandra chinensis is an important traditional Chinese medicine and its main bioactive components are lignans and schinortriterpenoids (SNTs). The aim of this study was to explore the biologically rich SNTs from the stem and leaves of S. chinensis (SCSL). Here, seven previously undescribed 7/8/5 and 7/8/3 carbon skeleton SNTs (1−7) were reported. Their structures were determined by NMR, UV, MS, ECD, and X-ray diffraction analyses, and the neuroprotective activities of these compounds on corticosterone-induced PC12 cell injury were evaluated. The results showed that 1, 5, and 7 (25 μM) had neuroprotective effects, and the cell viability was increased by 20.07%, 14.24%, and 15.14% (positive control: 30.64%), respectively. These findings increased the number of described SNTs in SCSL, and the neuroprotective activities of all compounds indicated their potential application in neurodegenerative diseases.

Schisandrin protects against ulcerative colitis by inhibiting the SGK1/NLRP3 signaling pathway and reshaping gut microbiota in mice

BackgroundAccording to the Chinese Pharmacopoeia, the fruit of Schisandra chinensis (Turcz.) Baill. (SC) is an important traditional Chinese medicine that can be used to treat diarrhea. Despite the increasing research on the anti-inflammatory and anti-oxidant aspects of SC, the studies on the anti-ulcerative colitis of Schisandrin (SCH), the main constituent of SC, are relatively few.MethodsThe mice used in the study were randomly distributed into 6 groups: control, model, 5-ASA, and SCH (20, 40, 80 mg/kg/d). The mice in the model group were administered 3% (w/v) dextran sulfate sodium (DSS) through drinking water for 7 days, and the various parameters of disease activity index (DAI) such as body weight loss, stool consistency, and gross blood were measured. ELISA was used to detect inflammatory factors, and bioinformatics combined with transcriptome analysis was done to screen and verify relevant targets. 16S rDNA high-throughput sequencing was used to analyze the composition of the gut microbiota(GM), while mass spectrometry was done to analyze the changes in the content of bile acids (BAs) in the intestine.ResultsMice treated with SCH experienced significant weight gain, effectively alleviating the severity of colitis, and decreasing the levels of inflammatory factors such as TNF-α, IL-1β, IL-18, IL-6, and other related proteins (NLRP3, Caspase-1, SGK1) in UC mice. Furthermore, the analysis of GM and BAs in mice revealed that SCH increased the relative abundance of Lactobacilli spp, reduced the relative abundance of Bacteroides, and promoted the conversion of primary BAs to secondary BAs. These effects contributed to a significant improvement in the DSS-induced GM imbalance and the maintenance of intestinal homeostasis.ConclusionIt seems that there is a close relationship between the SCH mechanism and the regulation of SGK1/NLRP3 pathway and the restoration of GM balance. Therefore, it can be concluded that SCH could be a potential drug for the treatment of UC.

First Report of 16SrI-B Subgroup Related Phytoplasma Associated with Yellows Symptoms of Rubus cochinchinensis in China.

Rubus cochinchinensis, an important traditional Chinese medicine in China is used to treat rheumatic arthralgia, bruises and lumbocrural pain (He et al.2005). In January 2022, yellow leaves of R. cochinchinensis were found in Tunchang City, Hainan Province, a tropical island in China. Chlorosis spread along the direction of vascular tissue while the leaf veins remain green (Fig. 1). In addition, the leaves were slightly shrunken and the growth vigor is poor (Fig. 1). By survey, we found the incidence of this disease was about 30%. Three etiolated samples and three healthy samples (0.1g each) were used to extract total DNA (TIANGEN plant genomic DNA extraction kit). Using nested PCR method, phytoplasma universal primers P1 / P7 (Schneider et al., 1995) and R16F2n / R16R2 (Lee et al. 1993) were used to amplified phytoplasma 16S rDNA gene. Primers rp F1 / R1 (Lee et al. 1998) and rp F2 / R2 (Martini et al. 2007) were used to amplified rp gene. 16S rDNA gene and rp gene fragments were amplified from three leaf etiolated samples, but not from healthy samples. The amplified fragments were cloned and sequenced, and the sequences were assembled by DNASTAR11. By sequence alignment, we found the obtained 16S rDNA and rp gene sequences of three leaf etiolated samples were same. The length of 16S rDNA fragment was 1237 bp (accession number: ON944105) and the length of rp gene fragment was 1212 bp (accession number: ON960069). The phytoplasma strain was named as 'R. cochinchinensis' yellows leaf phytoplasma (RcT), RcT-HN1 strain. The 16S rDNA gene sequence of RcT-HN1is 99.8% consistent with 16SrI-B subgroup members such as the 'Brassica napus' dwarf phytoplasma strain WH3 (MG599470.1), Chinaberry yellows phytoplasma strain LJM-1(KX683297.1) and Arecanut yellow leaf disease phytoplasma strain B165 (FJ694685.1). The rp gene sequence of RcT-HN1 is 100% consistent with rpI-B subgroup members such as the 'Salix tetradenia' witches'-broom phytoplasma strain YM-1 (KC117314.1) and Chinaberry witches'-broom phytoplasma strain Hainan (EU348781.1). The phylogenetic tree analysis, based on concatenated 16S rDNA-rp gene sequence of same group phytoplasma by MEGA 7.0 employing neighbor-joining (NJ) method with 1000 bootstrap value, were performed (Kumar et al., 2016). The results showed that RcT-HN1 phytoplasma strain formed a subclade in aster yellows group B subgroup (Fig. 2). The virtual RFLP analysis based on the 16S rRNA gene fragment of RcT-HN1 phytoplasma strain was performed by the interactive online phytoplasma classification tool iPhyClassifier (Zhao et al., 2009). The results showed that the phytoplasma strain was same as the reference pattern of the onion yellows phytoplasma of 16SrI-B (GenBank accession: AP006628), and the similarity coefficient was 1.00. This is the first report that 16SrI-B subgroup related phytoplasma infected R. cochinchinensis and caused yellows symptoms in China. The discovery of the disease is helpful to the study of the spread of phytoplasma-related diseases and protect R. cochinchinensis resources.