Impatiens Necrotic Spot Virus Research Articles

Evaluation of lettuce germplasm for resistance to impatiens necrotic spot virus

Recently, impatiens necrotic spot virus (INSV) has emerged as a major pathogen of lettuce in the Salinas Valley of California. The virus is a member of the genus Orthotospovirus, and under natural conditions, is transmitted by the tiny insect, western flower thrips. Due to the high efficiency of virus transmission, chemical management of thrips vectors is often ineffective in preventing the spread of the disease. Utilization of genetic resistance will be a critical component for managing the disease; however, little is known about genetic sources of resistance in lettuce. Here, we evaluated 189 lettuce lines under natural disease pressure in four field experiments to identify INSV resistant germplasm. The stability of resistance was also evaluated using different inoculation methods under controlled conditions. Our results showed a significant variation (p < 0.0001) among lettuce cultivars for both INSV severity and incidence. We identified INSV resistant germplasm that belongs to different horticultural types and leaf color, including a red-leaf cultivar ‘Eruption’ with a high degree of genetic stability. Moreover, we characterized several factors influencing thrips and host plant relationships, including horticultural type, leaf color, and polyphenol concentration. Overall, INSV resistant germplasm identified in this study provide valuable resources for breeding of INSV resistant lettuce cultivars.

Identification and characterization of lettuce cultivars with high inhibitory activity against the human pathogen Escherichia coli O157:H7: Toward a plant-intrinsic hurdle approach to microbial safety

Foodborne illness linked to fruit and vegetables poses a major challenge to public health and horticulture production. Processed lettuce has been implicated in recurrent outbreaks of pathogenic Shiga toxin-producing Escherichia coli (STEC) infection. We hypothesized that plant defenses elicited by mechanical injury may effect STEC inhibition in cut leaves. Intact and cut leaves of 31 lettuce cultivars (Lactuca spp.) selected from >500 accessions based on their resistance to common insect pests and the necrotrophic lettuce drop pathogen were assessed for STEC serovar O157:H7 (EcO157) survival under cold storage conditions. The cultivars were previously ranked also for phenotypes such as resistance to other phytopathogens and physiological traits. Total leaf phenolic compounds, anthocyanins, and reactive oxygen species (ROS); and phenylalanine lyase (PAL), peroxidase (POD), and polyphenol oxidase (PPO) activity were quantified in each cultivar. Principal Component Analysis (PCA) and K-means cluster analysis were applied to group phenotypes and EcO157 population decline on lettuce. In five cultivars, high resistance to herbivorous insects (aphids, leaf miners and thrips), diseases (lettuce drop, downy mildew, and Impatiens Necrotic Spot Virus), and the disorder tipburn was associated with up to 42-fold EcO157 population decline on cold-stored cut (shredded) leaves, and with up to 11-fold difference in decline on cold-stored intact vs cut leaves (ΔD). The decline on these cold-stored cut cultivars also was up to 24-fold greater than on the cultivar with the lowest decline, and up to 8-fold greater than the mean decline for all 31 cultivars (P < 0.01). Resistance to the hemibiotrophic pathogen causing lettuce bacterial leaf spot, Xanthomonas hortorum pv. vitians, was not indicative of high EcO157 inhibition in this system. High PAL activity, and phenolic and anthocyanin content (PPA); and high PAL and POD activity, were associated with high EcO157 population decline (P < 0.05). One cultivar with high susceptibility to herbivorous insects and phytopathogens, and low levels of defense metabolism nevertheless showed high EcO157 inhibition, suggesting other plant inhibitory characteristics at play. Basal plant immunity and pathways associated with a strong wound response may inform about enteric pathogen survival on minimally processed postharvest lettuce. The related traits identified in this study may serve to breed new genotypes with intrinsically enhanced microbial safety.

Molecular and biological detection of impatiens necrotic spot virus (INSV) isolate from ornamental plants in Iran

Impatiens necrotic spot virus (INSV), belong to genus Orthotospovirus, causes severe damage to greenhouse ornamental plants. INSV reported from almost every ornamental screen house in Iran. INSV general symptoms include necrotic leaf spot, chlorosis and stunting in infected ornamental host plants. A total number of 581 ornamental samples of 58 different plant species with symptoms similar to those of INSV infection were collected in 4 provinces of Iran. The results indicated an average of 20.13 per cent virus incidence. INSV infection was recorded to be 28% in Mahallat, 24.5% in Tehran, 22.1% in Mazandaran and 16.4% in Guilan provinces. No record of INSV infection on ornamental samples was obtained from Khouzistan province (Dezful). From the total of 58 ornamental species tested, 33 species recorded positive for INSV. ELISA positive samples were rechecked by RT-PCR using a set of specific primers directed to the N-gene region, which were designed to detect and characterize the virus species. The primers ampl fied a 777 bp product of the nucleoprotein as shown by agarose gel electrophoresis. The nucleotide sequence of amplicons was compared with related sequences, using Blast software available at NCBI GenBank, which showed highest similarity with impatiens necrotic spot virus (INSV) isolates. Accordingly, all genome components of the isolate shared 89-96.5 % nucleotide sequence identities with corresponding sequence of other Iranian and GenBank INSV isolates. The Iranian isolates were all placed in the same group and bore the most similarity to INSV isolates from the Netherlands, Italy and United States. In phylogenetic analysis based on the partial nucleotide and deduced amino acid sequences of N region, INSV from Iran appears to be closely related to the Japanese AB1099100 Verbena spp. isolate.

Phytochemical and Agronomic Characterization of High-Flavonoid Lettuce Lines Grown under Field Conditions.

Flavonoids are antioxidant phytochemicals that confer a beneficial effect on human health. We have previously developed and characterized eight lettuce (Latuca sativa L.) lines that accumulated high levels of diverse flavonoids and their precursors in controlled environment conditions. Three Rutgers Scarlet lettuce (RSL) lines selected in tissue culture for deep-red color (RSL-NAR, RSL-NBR, RSL-NFR) accumulate anthocyanins and quercetin, three lines identified in a chemically mutagenized red lettuce population accumulate kaempferol (KfoA and KfoB) or naringenin chalcone (Nco), and two lines that were spontaneous green mutants derived from the red line RSL-NAR (GSL, GSL-DG) accumulate quercetin. These eight lines were field-grown in the Salinas Valley of California for four years together with seven control accessions of varying colors (light green, dark green, red, and dark red). At market maturity, a substantial variation in plant composition was observed, but the three RSL lines consistently accumulated high levels of cyanidin, GSL and GSL-DG accumulated the highest levels of quercetin, KfoA and KfoB accumulated kaempferol, and Nco amassed naringenin chalcone, confirming that these mutant lines produce high levels of beneficial phytochemicals under field conditions. Mutant lines and control accessions were also assessed for their biomass production (plant weight, height, and width), overall content of pigments (leaf chlorophyll and anthocyanins), resistance to diseases (downy mildew, lettuce drop, and Impatiens necrotic spot virus), postharvest quality of processed tissue (deterioration and enzymatic discoloration), and composition of 23 mineral elements. All but one mutant line had a fresh plant weight at harvest comparable to commercial leaf cultivars; only Nco plants were significantly (p < 0.05) smaller. Therefore, except for Nco, the new, flavonoid hyperaccumulating lines can be considered for field cultivation.

First Report of Tomato spotted wilt virus infecting Helichrysum bracteatum in China.

Strawflower (Helichrysum bracteatum, Asteraceae) , an annual or biennial herb, is one of the most popular flowers in the world because of the colorful flowers and the long flowering period. However, the ornamental plants belonging to Asteraceae are susceptible to numerous viruses such as cucumber mosaic virus (CMV) (Cucumovirus, Bromoviridae) , potato virus Y (Potyvirus, Potyviridae), tomato mosaic virus (ToMV) (Tobamovirus, Virgaviridae), tobacco mosaic virus (TMV) (Tobamovirus, Virgaviridae), chrysanthemum virus B (CVB) (Carlavirus, Betaflexiviridae), tomato aspermy virus (TAV) (Cucumovirus, Bromoviridae), tomato spotted wilt virus (TSWV) (Orthotospovirus tomatomaculae, Tospoviridae), and impatiens necrotic spot virus (INSV) (Orthotospovirus impatiensnecromaculae, Orthotospovirus) resulting in severe yield loss (Verma et al. 2003; Raj et al. 2007; Kondo et al. 2011; Liu et al. 2014; Marys et al. 2014; Min et al. 2020; Gautam et al. 2021; Read et al. 2022; Supakitthanakorn et al. 2022). Among these viruses, the TSWV, a thrips-transmitted negative-stranded RNA virus, is well known to cause viral disease in several plant species while is less reported in Helichrysum, especially in China. In April 2021, viral attack symptoms were detected on the leaves of H. bracteatum during our routine checks in the greenhouse located at Shunyi District, Beijing, China, such as wilting, shrinking, chlorotic blotches, chlorotic ring spots. To investigate the virus infecting H. bracteatum, in total of 25 symptomatic and 5 asymptomatic leaves were sampled and tested by the effective double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using antisera against CMV, PVY/PVX, ToMV, TMV, CVB, TAV, TSWV, INSV, separately (Agdia, USA). Only the TSWV showed positive in symptomatic samples, and asymptomatic samples were all negative, which implied TSWV infection. To further confirm the virus type of TSWV isolated from H. bracteatum samples, the genomic RNA of the virus was isolated using reverse transcription and polymerase chain reaction (RT-PCR), and then was cloned, sequenced and analyzed. Total RNA of five symptomatic leaves (ELISA-positive) were extracted using the FastPure Plant Total RNA Isolation Kit (Vazyme, China), and then were reverse transcribed by HiScript II Reverse Transcriptase (Vazyme, China). Each genome segments were amplified using Phanta Max Super-Fidelity DNA Polymerase (Vazyme, China) with TSWV-specific primers newly designed and listed in Table S1. The PCR setup was as follow: 95°C for 30 s, followed by 35 cycles at 95°C for 30 s, 55°C for 30 s, and 72°C for 1.5 min, with a final extension at 72°C for 10 min. All PCR products were cloned into the TA/Blunt-Zero vector (Vazyme, China) and sequenced (GENEWIZ, Inc.). We assembled and then analyzed the evolutionary relationship of three genomic fragments, that is, TSWV-BJFC-Hb S (2923 bp), M (4785 bp) and L (8971 bp) using the BLAST tools. The results showed high similarity with TSWV-henan isolated from pepper in China (99.6% to TSWV-S (MT799179.1), 99.8 % to TSWV-M (MT799178.1) and 99.8 % TSWV-L (MT799177.1)). These sequences have been submitted to the GenBank (OM982910, OM982911 and OM937131). Taking all of these evidences together, the viral disease observed in H. bracteatum was closely associated with TSWV. TSWV is currently widespread in China, infecting Nasturtium, Chrysanthemum and cowpea (Xiao et al. 2015; Hu et al. 2018; Yu et al. 2021). Epidemics of TSWV have also been reported in several other countries such as Korea, North Carolina, Turkey and India (Renukadevi et al. 2015; Koehler et al. 2016; Kwak et al. 2021; Erilmez, S. 2022). This is the first report of TSWV infection on H. bracteatum in China. Due to the fast spread and serious economic losses of TSWV, the rapid detection may be the essential way to prevent this viral disease among crops (Macharia et al. 2014).

First Report of Tomato Spotted Wilt Virus infecting Lettuce in Yuma, Arizona.

Tomato spotted wilt virus (TSWV, family Tospoviridae, genus Orthotospovirus) is a thrips-vectored pathogen that infects lettuce (Lactuca sativa) and many vegetable crops (Kuo et al. 2014, Hasegawa et al. 2022). Another thrips-borne pathogen of lettuce, impatiens necrotic spot virus (INSV, Tospoviridae, Orthotospovirus), was first reported in 2021 in Yuma, Arizona (Hasegawa et al. 2022). Symptoms of both viruses in lettuce are similar and include necrotic spotting, leaf chlorosis and plant stunting (Kuo et al. 2014). Beginning February through April of 2022, lettuce displaying symptoms of orthotospovirus infection was collected from romaine lettuce (var. longifolia) fields in three regions of Yuma County. A total of 96 plants were collected (5 from Tacna on 2/21, 5 from Wellton on 2/21, 15 from Wellton on 3/23, 30 from Tacna on 4/4, 20 from Wellton on 4/4, and 21 from Yuma Valley on 4/4). The area of the fields ranged from 10 to 18 acres, and the percent disease incidence ranged from 0.8% (Tacna on 4/4) to 2.75% (Tacna on 2/21). Thrips vector were present in all fields were symptomatic plants were observed. One leaf disk per plant (8 mm in diameter) was sampled with a cork borer and grounded individually with a micro pestle in a 1.7 ml microcentrifuge tube with 150 ul of Tri-reagent (Molecular Research Center). Total RNA was extracted from each sample using the Zymo Direct-zol-96 kit (Zymo Research). Samples were diluted with water to a ratio of 1:10 after RNA extraction. RT-qPCR was performed in 20 ul reactions with 5 ul of input RNA using the PCR Biosystems qPCRBIO Probe 1-Step Go No-ROX for the cDNA/qPCR master mix. RT-qPCR assays were carried out in multiplex reactions using primers specific for TSWV and INSV, in addition to a lettuce internal control gene (LOC111918243), along with negative controls. Primer and probe sequence details are reported in supplemental Table 1. We used a cycle threshold (ct) < 40 to indicate a positive result for both INSV and TSWV (Chen et al. 2013; Boonham et al. 2002). RT-qPCR successfully amplified INSV in 90 out of 96 samples and TSWV in 8 out of 96 samples. These 8 samples tested positive for both TSWV and INSV, showing that INSV and TSWV co-infected lettuce plants. Thus overall, ∼ 95% of symptomatic plants were infected with INSV alone, and ∼ 8% were co-infected with TSWV and INSV. Amplicons of 4 samples testing positive for TSWV were sent for Sanger sequencing (Eurofins Genomics, Louisville, KY). All were identified as TSWV. One amplicon with TSWV was sequenced for INSV and double infection was confirmed. BLAST results from the NCBI nt database show 100% (138 bp) identity to TWSV (MW519211) for the 4 TWSV amplicons and 99.22% (137 bp) identity to INSV (KX790323) for the INSV amplicon. Sanger sequence data are in the GenBank (accession: OQ685940-OQ685944). Based on RT-qPCR results, all TSWV infected plants were also infected with INSV. INSV may have been introduced to Yuma by infected plants or thrips from lettuce transplants produced in California (Hasegawa et al. 2022). TSWV could have been introduced similarly. To our knowledge, this is the first report of TSWV infecting lettuce in Yuma and the first report of INSV and TSWV co-infecting lettuce. TSWV and INSV infections have remained low since their discovery in Yuma, in part due to effective cultural and chemical management by lettuce growers (Palumbo, 2022). However, an increase in disease incidence and severity in the future could have a significant negative impact on production of romaine lettuce in the region.

First Report of Tobacco Ringspot Virus Infecting Pawpaw Orchard (Asimina triloba (L.) Dunal) in North America.

Pawpaw (Asimina triloba (L.) Dunal, Annonaceae) is a fruit tree native to eastern North America, increasingly grown for commercial production in the United States (Callaway, 1992; Layne, 1996), Europe, and Western Asia (Brannan and Coyle, 2021; Lolletti et al., 2021). In 2012, virus-like symptoms were noticed in a 0.3 ha pawpaw orchard at Michigan State University Plant Pathology Research Station; ~30% of the trees presented symptoms which included foliar mosaic, vein yellowing, and necrosis, and were first mistaken for nutrient (magnesium/zinc) deficiency. Trees were treated for magnesium/zinc deficiency but continued to decline in fruit yield and overall vigor, and typically died within 3─4years after symptoms were first observed (Fig. S1). Preliminary testing using Agdia ImmunoStrips for cucumber mosaic virus, impatiens necrotic spot virus, tobacco mosaic virus, tomato spotted wilt virus and the genus Potyvirus were negative. However, icosahedral virus particles were observed by TEM (Fig. S2). To establish virus identity, we deep-sequenced tissue from a symptomatic pawpaw obtained from same site in summer 2021. Virus particles were purified , and virion-associated nucleic acids (VANA) were extracted using the Purelink viral RNA/DNA kit (Invitrogen) (Maclot et al., 2021). Both viral RNA and DNA were subjected to high-throughput sequencing (HTS) on the Illumina NextSeq 500 platform (GIGA, University of Liege, Belgium). A total of 574,274 trimmed reads (150 nt read length) were de novo assembled using Geneious Prime 2022.2.2 software (https://www.geneious.com) and subjected to BLASTn analysis. Two contigs of 7511 bp (average coverage: 1048) and 3924 bp (average coverage: 3012) showed 94% and 95% nt identities with tobacco ringspot virus (TRSV) RNA1 isolate YW (MT042825) and RNA2 isolate OH19 (MT561435) respectively. These two contigs (Accession no. OP589177 and OP589178) covered the complete TRSV genome for each segment. HTS found no other plant-associated viral / virus-like sequences in this symptomatic pawpaw sample. To further confirm TRSV infection, leaf extract from this sample was tested with RT-PCR using primers specific to the RdRp gene of TRSV RNA1 (Forward, 5'-TAACCTCATTGCAGTTGATCCTT-3'; Reverse, 5'-TAATTCAAGCTCAGGTCTCTTCT-3'; 739 bp amplicon) and the coat protein of TRSV RNA2 (Forward, 5'-TCATGCTTAAAGATGCAGATGTG-3'; Reverse, 5'-TATAAAGCTCCGCACTAGAAAACA-3'; 753 bp amplicon). Sanger sequence analysis showed 99.5% and 99.8% nt identity between the amplicons and the HTS contigs (RNA1 and RNA2 respectively) assembled from the pawpaw sample, and the amplicons likewise matched GenBank TRSV sequences (91.7% and 95.6% nt identities respectively with TRSV RNA1 isolate CmTX-H (MN504766) and TRSV RNA2 isolate IA-1-2017 (MT563079)). We further screened for TRSV infection in leaves from four symptomatic and three non-symptomatic pawpaw trees collected from the same site in 2022. RT-PCR revealed positive infection in all four symptomatic samples and one of the three (33%) non-symptomatic samples. Our results confirm the presence of TRSV infection in symptomatic pawpaw trees and emphasize the importance of also monitoring non-symptomatic trees. We confirmed graft transmission with 100% transmission rate observed in 200 trees grafted from a TRSV-infected pawpaw (Shenandoah cultivar), and investigation of other transmission vectors is on going. Because of TRSV's wide host range (Tolin, 2008), its broad transmission profile in other crops (via nematodes, thrips, seeds, sap inoculation, and grafting) (Hill and Whitham, 2014), and the notable decline observed in infected pawpaws from different cultivars (10-35, NC-1, Overleese, Pennsylvania-Golden, Shenandoah, Sunflower, Wabash), TRSV appears to pose a new threat to pawpaw orchards. To the best of our knowledge, this is the first report of TRSV infecting pawpaw in North America and the world.

First Report of Resistance-Breaking Variants of Tomato Spotted Wilt Virus (TSWV) Infecting Tomatoes with the Sw-5 Tospovirus-Resistance Gene in North Carolina.

Widespread use of tomato cultivars with the Sw-5 resistance gene has led to the emergence of resistance-breaking (RB) strains of tomato spotted wilt virus across the globe. In June of 2022, tomato spotted wilt (TSW) symptoms were observed at two farms (A and B, within 15 miles of each other) in Rowan County, NC on several commercial TSW resistant tomato cultivars (all heterozygous for the Sw-5 gene). At farm A, ~10% of plants had symptomatic foliage with ~30% of fruit with symptoms, while at farm B, up to 50% of plants had symptomatic foliage with ~80% of fruit with symptoms. Visual symptoms included stunting, severe leaf curling and bronzing, necrotic lesions on leaves, petioles and stems, and concentric ring spots on fruit (Supplementary Fig. 1). TSWV ImmunoStrips (AgDia, Elkhart, IN) and reverse-transcription (RT)-PCR with NSm primers (di Rienzo et al 2018) confirmed the presence of TSWV in 12 symptomatic plants sampled across the two farms. Primers designed to detect Impatiens necrotic spot virus, groundnut ringspot virus, tomato chlorotic spot virus, tomato chlorosis virus, alfalfa mosaic virus, and tomato necrotic streak virus (ilarvirus, Badillo et al., 2016) failed to generate amplicons of the expected size from cDNA generated from these field samples. The amplicons from full-length NSm cDNA were sequenced from independent, single-leaflet isolates from the TSWV-positive plants (three from farm A, nine from farm B) with the expectation of finding an amino acid (aa) substitution associated with the Sw-5 RB phenotype identified previously in CA (C118Y, Batuman et al. 2017) or Spain (C118Y and T120N, Lopez et al. 2011). All three nucleotide sequences from farm A contained the NSm C118Y substitution reported in CA. All three sequences were 99% identical (including the C118Y mutation) to NCBI GenBank accession KU179600.1, a TSWV isolate collected from GA in 2014 with no cultivar information reported. The nine nucleotide sequences from farm B contained neither of the two previously reported aa substitutions associated with the RB phenotype. Instead, all contained a D122G substitution within a conserved region of the TSWV NSm protein reported to be involved in direct interaction with the Sw-5 protein (Zhu et al 2017). Likewise, Huang et al (2021) generated a D122A mutation in TSWV-NSm, resulting in failure to elicit a Sw-5 mediated hypersensitive response. Three NSm sequences retrieved from GenBank contained the D122G substitution (AY848921.1, HM015516.1, KU179582.1), however, this mutation was not implicated directly with RB phenotypes (Ciuffo et al., 2005; Lopez et al., 2011; Marshall, 2016). The RB phenotype was confirmed with the NC variants on 'Mountain Merit' (Sw-5) by two means of virus inoculation: mechanical, rub-inoculation with extracted sap from infected plants, and thrips transmission assays with lab colony-maintained, Frankliniella occidentalis, the western flower thrips. Symptomatic leaf tissue obtained from these inoculation assays tested positive for TSWV by DAS-ELISA (AgDia, Elkhart, IN) and RT-PCR with NSm primers, providing definitive evidence of the occurrence of RB-TSWV at both farms, and subsequent sequencing confirmed the C118Y and D122G substitutions. This report warrants further investigation of the putative origins, prevalence and epidemiological implications of RB-TSWV variants in NC tomato production, and the development of new sources of resistance to TSWV.

Genetic and physiological determinants of lettuce partial resistance to Impatiens necrotic spot virus.

Impatiens necrotic spot virus (INSV) is a major pathogen currently threatening lettuce (Lactuca sativa L.) production in the coastal areas of California. The virus is transmitted by the western flower thrips (Frankliniella occidentalis Pergande). We have tested a diversity panel of almost 500 lettuce accessions for disease incidence (DI) in 12 field experiments performed over 7 years. This set of accessions was also assessed for thrips feeding damage (TFD), the rate of plant development (PD), and the content of chlorophyll (SPAD) and anthocyanins (ACI) to determine their effect on resistance to INSV. In addition, recombinant inbred lines from two biparental mapping populations were also evaluated for DI in field experiments. The mean DI in 14 field experiments ranged from 2.1% to 70.4%. A highly significant difference in DI was observed among the tested accessions, with the overall lowest DI detected in the red color cultivars, Outredgeous Selection, Red Splash Cos, Infantry, Sweet Valentine, Annapolis, and Velvet. Multiple linear regression models revealed a small but significant effect (p < 0.005) of the four analyzed determinants on DI. Accessions with lower DI values had slower plant development (PD, r = 0.352), higher ACI content (r = -0.284), lower TFD (r = 0.198), and lower SPAD content (r = 0.125). A genome-wide association study revealed 13 QTLs for DI located on eight out of the nine lettuce chromosomes (the exception was chr. 8). The most frequently detected QTL (qINSV2.1) was located on chr. 2. Several of the QTLs for DI were in the same genomic areas as QTLs for PD, ACI, and SPAD. Additional three QTLs for DI on chr. 5 and 8 were identified using linkage mapping performed on two biparental mapping populations. The work highlights the genetic basis of partial resistance to INSV and reveals the relationship between resistance, the host physiology, and the thrips vector. Results of this study are an important steppingstone toward developing cultivars with increased resistance against INSV.

Interspecies/Intergroup Complementation of Orthotospovirus Replication and Movement through Reverse Genetics Systems.

Orthotospoviruses, the plant-infecting bunyaviruses, cause serious diseases in agronomic crops and pose major threats to global food security. The family of Tospoviridae contains more than 30 members that are classified into two geographic groups, American-type and Euro/Asian-type orthotospovirus. However, the genetic interaction between different species and the possibility, during mixed infections, for transcomplementation of gene functions by orthotospoviruses from different geographic groups remains underexplored. In this study, minireplicon-based reverse genetics (RG) systems have been established for Impatiens necrotic spot virus (INSV) (an American-type orthotospovirus) and for Calla lily chlorotic spot virus and Tomato zonate spot virus (CCSV and TZSV) (two representative Euro/Asian orthotospoviruses). Together with the earlier established RG system for Tomato spotted wilt virus (TSWV), a type species of the Orthotospovirus American-clade, viral replicase/movement proteins were exchanged and analyzed on interspecies transcomplementation. Whereas the homologous RNA-dependent RNA polymerase (RdRp) and nucleocapsid (N) protein supported the replication of orthotospoviruses from both geographic groups, heterologous combinations of RdRp from one group and N from the other group were unable to support the replication of viruses from both groups. Furthermore, the NSm movement protein (MP), from both geographic groups of orthotospoviruses, was able to transcomplement heterologous orthotospoviruses or a positive-strand Cucumber mosaic virus (CMV) in their movement, albeit with varying efficiency. MP from Rice stripe tenuivirus (RSV), a plant-infecting bunyavirus that is distinct from orthotospoviruses, or MP from CMV also moves orthotospoviruses. Our findings gain insights into the genetic interaction/reassortant potentials for the segmented plant orthotospoviruses. IMPORTANCE Orthotospoviruses are agriculturally important negative-strand RNA viruses and cause severe yield-losses on many crops worldwide. Whereas the emergence of new animal-infecting bunyaviruses is frequently associated with genetic reassortants, this issue remains underexposed with the plant-infecting orthotospovirus. With the development of reverse genetics systems for orthotospoviruses from different geographic regions, the interspecies/intergroup replication/movement complementation between American- and Euro/Asian-type orthotospoviruses were investigated. Genomic RNAs from American orthotospoviruses can be replicated by the RdRp and N from those of Euro/Asia-group orthotospoviruses, and vice versa. However, their genomic RNAs cannot be replicated by a heterologous combination of RdRp from one geographic group and N from another geographic group. Cell-to-cell movement of viral entity is supported by NSm from both geographic groups, with highest efficiency by NSm from viruses belonging to the same group. Our findings provide important insights into the genetic interaction and exchange ability of viral gene functions between different species of orthotospovirus.

Epidemiology and Economic Impact of Impatiens Necrotic Spot Virus: A Resurging Pathogen Affecting Lettuce in the Salinas Valley of California.

The Orthotospovirus impatiens necrotic spot virus (INSV) is a thrips-transmitted pathogen of lettuce that has rapidly emerged as a serious threat to production in the Salinas Valley of Monterey County, California. As a first step toward understanding the severity of the virus, we utilized Spatial Analysis by Distance IndicEs (SADIE) to characterize the distribution and progression of INSV outbreaks and thrips infestations in two commercial lettuce fields. In both fields, INSV incidence rapidly increased from 15.86% ± 1.77 to 80.24% ± 2.60 over the course of 7 weeks and aggregated at specific edges in both fields as early as 3 weeks after planting (Ia = 1.63, Pa = 0.0100, and Ia = 1.53, Pa = 0.0300). In one of the fields, thrips populations aggregated in areas that also experienced the most INSV (Ia = 1.2435, Pa = 0.0400, week 3; Ia = 1.4815, Pa < 0.0001, week 6; Ia = 1.5608, Pa < 0.0001, week 9), while in the second field, thrips were distributed randomly despite the aggregated effects that were observed for INSV incidence. Economic analysis estimated that the virus accounted for over $475,000 in losses for the two fields, while stakeholder surveys documented over 750 fields that experienced INSV infection during the 2021 season in Monterey County alone. These studies enhance our knowledge on the epidemiology of thrips and INSV under current lettuce production practices in the Salinas Valley, while elucidating the economic consequences and broader challenges that are associated with managing thrips-transmitted viruses.

First report of Impatiens necrotic spot orthotospovirus infecting Tulbaghia violacia Harv. in China.

Tulbaghia violaceaHarv. indigenous to southern African countries, is an herbaceous perennial bulbous plant belonging to the familyAmaryllidaceae. It is a popular garden plant in China. This attractive plant is traditionally used as medicine and repellent (Kubec et al. 2002; Moodley et al. 2015). In June 2021,T. violaceaplants showing typical tospovirus-like symptoms of chlorotic rings patterns, were found at the campus of Yunnan University of Chinese Medicine (Fig.S1). Disease incidence was about 11.0% during the field survey. Total RNA was extracted from symptomatic leaves of T. violacea plants using the TRIzol reagent (ambio, Carlsbad, CA). Reverse transcription (RT)-PCR was conducted to identify thevirus using RNA extract as the template. The degenerate primers (dTospo-F2 and dTospo-R2) (Huang et al. 2018) were used to amplify the conserved regions of the orthotospoviral L RNA sequences. No amplification was obtained from extracts of two asymptomatic plants. The amplicons from four symptomatic samples were cloned into the pMD19-T vector (TaKaRa) and sequenced (three clones for each amplicon) by Tsingke (Shanghai, China). The obtained DNA fragments were determined to be 312 bp. The sequences from four symptomatic samples were identical (GenBank acc.no. OK258285) and shared the highest nucleotide identities (98.0%) with a corresponding sequence of segment L of impatiens necrotic spot virus (INSV) isolated (GQ336991) from Phalaenopsis amabilis in Yunnan province, China. To further confirm the INSV infection to T. violacea, the samples were analyzed with the specific primers for the N, NSs and NSm genes of INSV (Table S1), respectively. Amplicons of the expected size, 789 bp, 1344 bp and 912 bp, were produced, respectively. Amplicons were cloned and sequenced. The 789-bp N (ON529554) and 1344-bp NSs (ON529554) gene sequences had 99.1% and 99.3% nucleotide identities with the corresponding region of previously described INSV Phalenopsis isolate (GQ336989), respectively. The 912-bp NSm (ON529553) gene sequence shared 99.5% nucleotide identity with the corresponding region of INSV Phalenopsis isolate (GQ336990). Metavirome and Sanger sequencing were used to complete the genome of INSV from T. violacea. The leaves of the symptomatic sample were used to construct an rRNA-depleted library using Nextera XT reagents (Illumina, San Diego, CA). The library was subjected to RNA-Seq a NovaSeq 6000 platform (Illumina, San Diego, CA). A total of 33,193,233 quality-filtered reads were obtained using BBMAP (https://github.com/BioInfoTools/BBMapBBMap-BushnellB.-sourceforge.net/projects/bbmap/). Among 161052 reads mapped to virus sequences, 151407 reads (read ratios 94.0%) were mapped to INSV. Three complete segments of INSV genome were determined to 8,778 nt (L segment, Acc. No. ON529552), 4,958 nt (M segment, Acc. No. ON529553), and 2,983 nt (S segment, Acc. No. ON529554) in length. These segments were validated by RT-PCR and Sanger sequencing. Three segments share nucleotide sequence identities of 99.6%, 99.3% and 98.9% with the L (GQ336991), M (GQ336990) and S segments (GQ336989) of INSV Phalenopsis isolate, respectively. The results of sequence comparisons showed no evidence of reassortment between INSV and another orthotospovirus.There was a report of tomato spotted wilt virus infecting T. violacea in Florida, USA (Dey et al. 2019). No other virus infecting T. violacea was reported. INSV has been reported to infect several economically important crops including Phalenopsis, pepper etc. in China (Chen et al. 2016). INSV-infected T. violacea not only losses landscaping value but also plays an important intermedia host role in the spread of INSV. Additional surveys and evaluation will be needed to understand the potential medicinal effect of this virus on this plant. To our knowledge, this is first report of INSV in T. violacea.

Determination of Some Virus Diseases on Gerbera Plants in Antalya Province

Gerbera spp., which is in the Asteraceae family, is the most widely cultivated cut flower ornamental plant in Türkiye after carnation. Approximately 74% of Türkiye's production is met from Antalya province. Virus diseases are a problem in the cultivation of Gerbera as they significantly reduce the yield and quality. In this study, which was carried out to detect some virus diseases seen in Gerbera production areas in Antalya province, surveys were carried out in commercial production areas in the 2021-2022 production season. For this purpose, a total of 112 leaf samples, which are thought to be infected with viruses, were collected from 100 Gerbera plants showing symptoms similar to virus disease symptoms and 12 selected weeds regardless of the presence of symptoms. These leaf samples, which were later brought to the laboratory, then were tested by the Double Antibody Sandwich Enzyme-linked Immunosorbent Assay (DAS-ELISA) method to detect infections of Tomato spotted wilt virus (TSWV), Cucumber mosaic virus (CMV), Tobacco streak virus (TSV) and Impatiens necrotic spot virus (INSV). As a result of the tests, TSWV (41.9%), CMV (1.7%) and TSV (37.5%) infections were detected in Gerbera plant samples. In addition, TSWV (25%) infections were most common in weed samples, followed by TSV (16%) and CMV (8.3%) infections. The presence of INSV virus was not detected in any of the leaf samples tested by DAS-ELISA. With this study, TSWV, TSV and CMV infections in Gerbera production areas in Türkiye were revealed for the first time.

Konya İli Park ve Ev Bahçelerinde Peyzaj Amaçlı Yetiştirilen Dahlia Türlerinde Enfeksiyon Yapan Bazı Virüs Hastalıklarının Serolojik Yöntemlerle Belirlenmesi

In this study, it was aimed to reveal some viruses that are a problem in Dahlia plants grown for ornamental plants in parks and home gardens in Selçuklu, Karatay and Meram districts of Konya. For this reason, in the 2019 summer, leaf samples were taken from 152 Dahlia plants showing symptoms similar to virus disease symptoms such as mosaic, deformations, yellowing, blight on the leaves and stunted plants. Possible infections of Cucumber mosaic virus (CMV), Tomato spotted-wilt virus (TSWV) and Impatiens necrotic spot virus, (INSV) on these leaves were tested by serological-based DAS-ELISA (Double Antibody Sandwich- Enzyme Linked Immuno Sorbent Assay) method. According to DAS-ELISA results, it was determined that 46.71% of the samples were infected with at least one of these three viruses. In addition, TSWV was detected as the most common virus with a 38.82% relative incidence in the samples, followed by CMV (27.63%). Mixed infections of the viruses were also detected in the leaf samples tested. As a result of the tests, only CMV + TSWV double infection was detected in a total of 30 samples. On the other hand, INSV infection was not detected in any of the leaf samples tested. As a result of survey studies, the average of prevalence rate of virus diseases in Dahlia plants grown in Konya was calculated as 69.56%. Moreover, it was determined that virus diseases were most common in Selçuklu district (75.47%). This is the first report of CMV and TSWV on Dahlia spp. in Türkiye.

First report of Konjac mosaic virus in Zantedeschia aethiopica from the United Kingdom

In June 2019 a sample of lily (Zantedeschia aethiopica) was submitted to Fera Science Ltd from a horticultural retail nursery in Hampshire, England. The sample was sent in following a routine inspection, where the appearance of an unknown disease was discovered. Symptoms manifested as yellow streaks on the leaves (Figs 1-3). In a batch of 60,000 plants, approximately 50% showed symptoms. The sample was tested by ELISA for a broad spectrum of potyviruses along with Tomato spotted wilt virus (both DSMZ, Germany). Cucumber mosaic virus (Agdia, USA) and Impatiens necrotic spot virus (Bioreba, Switzerland) according to the manufacturer's instructions. The sample tested positive for the presence of a potyvirus but negative for the other viruses. To confirm the diagnosis and identify the potyvirus, the sample was tested by conventional PCR using primers to detect a broad range of potyviruses (van der Vlugt et al., 1999). A product of the expected size (c. 650 bp) was obtained and sent for Sanger sequencing (Eurofins, Germany). A Blastn nucleotide sequence comparison showed a 97.98% match with the polyprotein precursor of Zantedeschia mosaic virus (GenBank Accession No. AF332872.1) and a 97.78% match with Konjac mosaic virus (KoMV) coat protein (LC114491.1) confirming the virus to be an isolate of KoMV (Adams & Valkonen, 2007). The sequence has been deposited in GenBank (ON324829) Following notification to the inspector, the grower was informed and took the infected batch of plants off sale. The infection source is unclear as the propagation material had been in the UK nursery for at least 25 years. KoMV is known to be transmitted by aphids (Liao et al., 2020) so aphid transmission from other local plants is possible. Alternatively, low levels of the virus may have been present in the parent material, having built up over years of continuous propagation. KoMV isolates in Zantedeschia are reported to be a significant problem in Taiwan, ever since the plant was introduced in the 1990's from New Zealand and the Netherlands, suggesting the virus has been present within commercial Zantedeschia for many years (Liao et al., 2020). This finding suggests that KoMV is more widely distributed than currently reported. Species of Zantedeschia such as Z. aethiopica are widely grown for the ornamental and fresh cut flower markets. KoMV could have a significant impact on sales of this popular ornamental by reducing the growth and quality of plants. This work was funded under the Defra-Fera long term services agreements.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Diagnosis of Important Virus Diseases of Ornamental Anthurium in Screen- Houses in Tehran Province

Introduction: One of the limiting factors for Anthurium production is its infection with various viruses. During the year 2014- 2015, a total of 504 symptomatic ornamental Anthurium leaf samples with virus-like symptoms including leaf and flower blister, dwarfing, mosaic, yellowing, leaf marginal chlorosis, and deformity were collected from Varamin and Pakdasht (Tehran province) Screen-houses. Aim: Samples were tested for infection to Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV) and Dasheen mosaic viruses (DaMV). Method: Biological, serological (ELISA) and molecular methods (RT-PCR) were performed for the detection and analysis of the important viral agents infecting Anthurium ornamental plants. Results: According to ELISA test results the prevalence of CMV were (31.54%) followed by TSWV (25%) and DaMV (7.93%) viruses respectively. Results of mechanical inoculation and host range reaction of CMV, TSWV and DaMV isolates were also recorded (fig 2). Coat protein gene sequence of Iranian CMV isolate showed the highest similarity (97%) with a CMV isolate Cucurbit pepo (Acc. No.GU327368.1) from South Korea. DMV on ornamental Anthurium is reported for the first time in this research from Iran. Conclusion: Despite the detection of CMV, TSWV and DaMV in this study, viral pathogens are one of the most economically damaging agents in the ornamental Anthurium plant. Development of research methods for, the detection and study of different isolates of these agents from different hosts, and study of the characteristics of each of these isolates has always been a scientific need.

Detection of Persistent Viruses by High-Throughput Sequencing in Tomato and Pepper from Panama: Phylogenetic and Evolutionary Studies

High-throughput sequencing from symptomatic tomato and pepper plants collected in Panama rendered the complete genome of the southern tomato virus (isolate STV_Panama) and bell pepper endornavirus (isolate BPEV_Panama), and almost-complete genomes of three other BPEV isolates. Tomato chlorosis virus, tomato mosaic virus, and impatiens necrotic spot virus were also detected. Analysis of the complete genome of STV and BPEV worldwide isolates revealed nucleotide diversities of 0.004246 and 0.070523, respectively. Bayesian phylogenetic analysis showed two main groups for each virus (I and II), and several subgroups for BPEV (IA, IB, IC, IIA and IIB). Isolate STV_Panama clustered with NC_12-03-08 from USA and Tom3-T from France (99.97% nucleotide identity) in Group I and BPEV_Panama was close to the Canadian isolate BPEV_Ontario (99.66% nucleotide identity) in Subgroup IB. No correlation was observed between geographic and genetic distances for both viruses. Panamanian BPEV isolates were divergent, belonging to Groups I and II (nucleotide identities > 87.33%). Evolutionary analysis showed purifying selection in all encoding regions of both viruses, being stronger in the overlapping region of both STV genes. Finally, recombination was detected in BPEV but not in STV. This is the first report of STV and BPEV in Panama.

Could Broccoli and Cauliflower Influence the Dispersal Dynamics of Western Flower Thrips (Thysanoptera: Thripidae) to Lettuce in the Salinas Valley of California?

The western flower thrips, Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae), is an important, worldwide vector of two tospoviruses (Family Bunyaviridae; Genus Tospovirus), Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV). In the Salinas Valley of California, INSV causes severe necrosis, stunting, and crop losses to lettuce (Lactuca sativa L.). Because broccoli (Brassica oleracea var. italica L.) and cauliflower (Brassica oleracea var. botrytis L.) are major rotation crops with lettuce in the Salinas Valley, it is critical to understand if these Brassicas influence the dispersal dynamics of F. occidentalis. In 2013 and 2014, surveys were conducted evaluating yellow sticky cards and plant samples in lettuce, broccoli, and cauliflower fields in three regions of the Salinas Valley. F. occidentalis were collected on sticky cards from April to November and on foliage in all three regions. Two-choice oviposition assays as well as no-choice and two-choice feeding assays were conducted where F. occidentalis adults were exposed to leaves of lettuce, broccoli, and cauliflower. A significantly greater number of eggs was found on lettuce than on broccoli or cauliflower leaves in the choice assay, whereas for the broccoli and cauliflower choice assay, the number of eggs retrieved was low and not significantly different between hosts. The number of F. occidentalis feeding spots and leaf area injury ratings were similar on broccoli and lettuce leaves but were significantly lower on cauliflower than on lettuce and broccoli leaves. The implications of these results on thrips and plant virus management are discussed.

Newly identified host range of viruses infecting species of the genus Allium and their distribution in six habitats in the Czech Republic

AbstractStudies on plant viruses are concentrated mainly towards crop diseases and little is known about viruses in wild and ornamental species. We surveyed viruses infecting 65 vegetable, wild, and ornamental Allium species cultivated or naturally occurring in the Czech Republic. Allium plants were collected from six habitat categories (botanical gardens, private gardens, cultivated fields, ornamentals from markets, cultivated plants of wild origin, wild origin). Samples were tested by ELISA and/or reverse transcription‐PCR for the presence of 15 viruses belonging to the genera Allexivirus, Carlavirus, Potyvirus, and Orthotospovirus. Of the 883 sampled plants, 63.4% were infected by at least one or more viruses. The infection rate of Allium samples differed depending on the habitat origin and phylogenetic relatedness of the hosts. Viruses were most frequently detected in cultivated species, with a high incidence of leek yellow stripe virus (LYSV), garlic common latent virus (GCLV), shallot virus X (ShVX), garlic virus A (GarV‐A), and garlic virus B (GarV‐B). Low infection rates and virus‐free samples were detected in species of wild origin. Composition of viruses belonging to the genus Allexivirus significantly differentiated the subgenus Melanocrommyum from other Allium subgenera. Mixed infections (51.1% of analysed plants) were widespread in most species. New host associations were observed for some viruses previously recorded in the Czech Republic. In addition, three viruses, shallot yellow stripe virus (SYSV), Impatiens necrotic spot virus (INSV), and iris yellow spot virus (IYSV), were detected for the first time on Allium species in the Czech Republic.