Immune Checkpoint Molecules PD-1 Research Articles

12-Lipoxygenase inhibition suppresses islet immune and inflammatory responses and delays autoimmune diabetes in human gene replacement mice.

Type 1 diabetes (T1D) is characterized by the autoimmune destruction of insulin-producing β cells and involves an interplay between β cells and cells of the innate and adaptive immune systems. We investigated the therapeutic potential of targeting 12-lipoxygenase (12-LOX), an enzyme implicated in inflammatory pathways in β cells and macrophages, using a mouse model in which the endogenous mouse Alox15 gene is replaced by the human ALOX12 gene. Our findings demonstrate that VLX-1005, a potent 12-LOX inhibitor, effectively delays the onset of autoimmune diabetes in human gene replacement non-obese diabetic (NOD) mice. By spatial proteomics analysis, VLX-1005 treatment resulted in marked reductions in infiltrating T and B cells and macrophages with accompanying increases in immune checkpoint molecules PD-L1 and PD-1, suggesting a shift towards an immune-suppressive microenvironment. RNA sequencing analysis of isolated islets from inhibitor-treated mice revealed significant alteration of cytokine-responsive pathways. RNA sequencing of polarized proinflammatory macrophages showed that VLX-1005 significantly reduced the interferon response. Our studies demonstrate that the ALOX12 human replacement gene mouse provides a platform for the preclinical evaluation of LOX inhibitors and supports VLX-1005 as an inhibitor of human 12-LOX that engages the enzymatic target and alters the inflammatory phenotypes of islets and macrophages to promote the delay of autoimmune diabetes.

Neoadjuvant nivolumab with or without relatlimab in resectable non-small-cell lung cancer: a randomized phase 2 trial

Antibodies targeting the immune checkpoint molecules PD-1, PD-L1 and CTLA-4, administered alone or in combination with chemotherapy, are the standard of care in most patients with metastatic non-small-cell lung cancers. When given before curative surgery, tumor responses and improved event-free survival are achieved. New antibody combinations may be more efficacious and tolerable. In an ongoing, open-label phase 2 study, 60 biomarker-unselected, treatment-naive patients with resectable non-small-cell lung cancer were randomized to receive two preoperative doses of nivolumab (anti-PD-1) with or without relatlimab (anti-LAG-3) antibody therapy. The primary study endpoint was the feasibility of surgery within 43 days, which was met by all patients. Curative resection was achieved in 95% of patients. Secondary endpoints included pathological and radiographic response rates, pathologically complete resection rates, disease-free and overall survival rates, and safety. Major pathological (≤10% viable tumor cells) and objective radiographic responses were achieved in 27% and 10% (nivolumab) and in 30% and 27% (nivolumab and relatlimab) of patients, respectively. In 100% (nivolumab) and 90% (nivolumab and relatlimab) of patients, tumors and lymph nodes were pathologically completely resected. With 12 months median duration of follow-up, disease-free survival and overall survival rates at 12 months were 89% and 93% (nivolumab), and 93% and 100% (nivolumab and relatlimab). Both treatments were safe with grade ≥3 treatment-emergent adverse events reported in 10% and 13% of patients per study arm. Exploratory analyses provided insights into biological processes triggered by preoperative immunotherapy. This study establishes the feasibility and safety of dual targeting of PD-1 and LAG-3 before lung cancer surgery.ClinicalTrials.gov Indentifier: NCT04205552.

Abstract CT079: The Pseudovax trial: A novel peptide vaccine targeting mutated GNAS for pseudomyxoma peritonei

Abstract Background: Pseudomyxoma peritonei (PMP) is a rare cancer originating from appendiceal mucinous tumors, which may spread to encompass the entire peritoneal cavity. Complete surgical removal and hyperthermic intraperitoneal chemotherapy cures approximately half of the patients, but patients with recurrent or non-resectable disease have no efficacious treatment options. These patients have a high unmet need for novel treatment options, and in the Pseudovax trial we will explore a novel therapeutic concept. A main molecular driver of PMP (in up to 90% of cases) is otherwise rare mutations in the GNAS oncogene, coding for the Gsα protein. We hypothesized that mutated Gsα would be a tumor neoantigen, and in T cells isolated from peripheral blood of PMP patients, a strong T cell proliferative response was observed. In the corresponding tumors, T cells with up-regulated immune checkpoint molecules PD-1 and TIGIT were detected. Study hypotheses: Patients with GNAS-mutated PMP has a preexisting, attenuated immune response directed against mutated Gsα protein. Vaccination with mutated Gsα peptides can be combined with immune checkpoint inhibition (ICI) with acceptable toxicity. The vaccine will reactivate the immune response and ICI will restore measurable anticancer immunity in patients. Study design: The Pseudovax trial is a small (10 patients) first-in-human, proof-of-concept, prospective, open label, phase I trial. Patients with recurrent or non-resectable PMP are eligible for inclusion. During a treatment period of 12 months, a mutated Gsα peptide vaccine + adjuvant (GM-CSF) will be administered as intradermal injections. After 12 weeks, treatment with ICI will be initiated. The primary endpoints are toxicity and circulating immune response against the vaccine, measured as increase in interferon-gamma production or proliferation of circulating vaccine-specific T cells compared to pre-vaccination baseline. Secondary endpoints are progression-free survival (abdominopelvic CT scans, blood levels of carcinoembryonic antigen (CEA) and/or detection of GNAS mutation by ctDNA analysis). Citation Format: Kjersti Flatmark, Annette Torgunrud, Fleten G. Karianne, Ben Davidson, Hedvig V. Juel, Nadia Mensali, Christin Lund Andersen, Else Marit Inderberg. The Pseudovax trial: A novel peptide vaccine targeting mutated GNAS for pseudomyxoma peritonei [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 2 (Late-Breaking, Clinical Trial, and Invited Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(7_Suppl):Abstract nr CT079.

Soluble immune-checkpoint factors: a potential immunotherapy biomarker.

There is unmet need for additional biomarkers to better select patients with non-small cell lung cancer (NSCLC) that are likely to benefit from immunotherapy in order to improve patient outcomes, reduce patient toxicity, and relieve the growing burden of healthcare costs. In this issue of the JCI, Hayashi and colleagues evaluated soluble forms of the immune checkpoint molecules PD-L1, PD-1, and CTLA-4 in the plasma of patients with advanced NSCLC who had been treated with anti-PD-1/L1 therapy. The findings suggest that these soluble immune-checkpoint factors may provide a complementary biomarker to PD-L1 IHC, although application into the clinic may not be straightforward.

The evaluation of PD-1 and Tim-3 expression besides their related miRNAs in PBMCs of women with recurrent pregnancy loss

Recurrent pregnancy loss (RPL) is a multifactorial disorder, associated with immunologic abnormalities. During pregnancy, the maternal immune system uses different tolerance mechanisms to deal with a semi-allogenic fetus. The expression of immune checkpoints and their related miRNAs in immune cells can ensure pregnancy at the feto-maternal interface by modulating immune responses. This study aims to evaluate the expression of the immune checkpoint molecules PD-1 and Tim-3 on circulating T cells by flow cytometry, that of mir-138 and mir-155 in PBMCs by Real-time PCR, and the concentrations of TGF-β and IP-10 in the sera of women suffering from RPL as well as of gestational age-matched healthy pregnant women by ELISA. The percentage of PD-1 or Tim-3 expressing CD8+ T cells was significantly lower in RPL patients compared to the controls, while there was no significant difference in Tim-3 expression of CD4+ T cells between the two groups. The mRNA of both the PD-1 and Tim-3 genes were downregulated in PBMCs of RPL patients compared to controls, however, the difference was not statistically significant for Tim-3. The concentration of TGF-β was significantly lower and that of IP-10 was significantly higher in the sera of RPL patients than in those of the controls. The relative expression of mir-138 and miR-155 were significantly lower, in PBMCs of RPL patients than in those of healthy pregnant women. These data confirm that by affecting cytokine production, immune checkpoints, and microRNAs play a role in establishing the appropriate local immune environment for successful pregnancy. The wider analysis of immune checkpoints may also yield new biomarkers for the diagnosis and prevention of RPL.

Abstract C078: Pembrolizumab response in melanoma patients: an analysis of the tumor microenvironment

Abstract Background: Melanoma has been associated with poor prognosis and limited treatment options. Immunotherapy, particularly the use of immune checkpoint inhibitors, has revolutionized the treatment landscape for advanced melanoma. Pembrolizumab, a PD-1 inhibitor, has shown promising results; however, the underlying mechanisms of its efficacy and the influence of the tumor microenvironment (TME) on treatment response remain incompletely understood. This study aims to investigate the response to pembrolizumab in melanoma patients and analyse the TME using a multiplexed immunofluorescence (mIF) spatial tissue analysis to gain insights into potential predictive factors and therapeutic targets. Methods: A retrospective analysis was conducted on formalin-fixed paraffin-embedded (FFPE) tumour samples from baseline melanoma patient samples, classified as responders (n = 6) or non-responders (n = 4) based on the response at 3 months post pembrolizumab treatment. Analysis was done using the mIF platform MultiOmyx™, a proprietary, immunofluorescence (IF) multiplexing assay that enables visualization and characterization of up to 60 biomarkers on a single FFPE section. Image segmentation, cell phenotyping, and spatial analytics were performed using our AI-powered image analytics software, NeoLYTX™. Results: Analysis of the 10 FFPE samples from metastatic melanoma patients treated with pembrolizumab revealed significant differences in immune cell populations between non-responders and responders. Patients who responded favorably to pembrolizumab exhibited increased infiltration of cytotoxic T lymphocytes (CTLs) and tumor-associated macrophages within the TME. This finding suggests that an immune-inflamed microenvironment, characterized by high levels of tumor-infiltrating lymphocytes may be indicative of a robust antitumor immune response. Moreover, immune checkpoint molecules PD-1, CTLA-4, LAG3, and TIM3 were also significantly increased in responding patients, suggesting potential therapeutic targets to enhance pembrolizumab response, including combination strategies targeting multiple immune checkpoints. When spatially characterizing T cell activation and exhaustion status in different regions of the TME we found an increase in checkpoint molecules among intra-tumoral CTLs as compared to intra-stromal CTLs. In particular, the fraction of CTLs with quadruple-positive CTLA4+LAG3+PD1+TIM3+ expression was doubled. This suggests an immunosuppressive TME in which CTLs are rapidly exhausted upon reaching the tumor. Work is now ongoing to characterize how this cell population spatially interacts with other immune and tumor cells in the TME. Conclusions: This study provides valuable insights into the response to pembrolizumab in melanoma patients and highlights the crucial role of the TME in determining treatment outcomes. Identification of immune cell subsets, and immunosuppressive mechanisms associated with pembrolizumab response may guide the development of novel therapeutic approaches to improve patient outcomes in advanced melanoma. Citation Format: Anna Juncker-Jensen, Juliana Wortman, Nigel Beaton, Kristina Beeler, Tobias Treiber, Mitchell Levesque, Julia Martinez Gomez, Jakob Vowinckel, Harry Nunns. Pembrolizumab response in melanoma patients: an analysis of the tumor microenvironment [abstract]. In: Proceedings of the AACR-NCI-EORTC Virtual International Conference on Molecular Targets and Cancer Therapeutics; 2023 Oct 11-15; Boston, MA. Philadelphia (PA): AACR; Mol Cancer Ther 2023;22(12 Suppl):Abstract nr C078.

Induction of a different immune response in non-titanized compared to titanized polypropylene meshes.

It is well known that pelvic organ prolapse (POP) significantly reduces the quality of life of affected women and in many cases requires corrective surgery. Aim of the study was to compare the immune response against titanized versus non-titanized meshes, especially macrophage polarization and immune checkpoint association. For this, we analyzed 644 POP surgeries, which were performed between 2017 and 2022, in our department. Four of them needed revision surgery caused by erosion. We analyzed the influx of CD68 & CD163 positive macrophages and the expression of immune checkpoint molecules PD-L1 and PD1 in these 4 patients. We identified a large number of CD68 and CD163 positive macrophages and additionally a PD-L1 expression of these cells. Based on the in-vivo results, we isolated monocytes and co-cultivated monocytes with different mesh material covered with or without fibroblasts. We identified a significantly enhanced macrophage activation and PD-L1 expression in macrophages surrounding non-titanized polypropylene mesh material. Encapsulation of the material by fibroblasts was crucial for that. Specifically, CD68-positive macrophages are upregulated (p<0.001), co-expressing PD-L1 (p<0.001) in monocytes co-cultivated with non-titanized polypropylene meshes. Monocytes co-cultivated with titanized polypropylene meshes showed significantly lower expression of CD163 (p=0.027) and PD-L1 (p=0.022). In conclusion, our in vitro data suggest that the titanium coating leads to a decreased polarization of macrophages and to a decreased immune response compared to non-titanized meshes. This could be an indication for the increased incidence of erosion of the non-titanized meshes, which is a severe complication of this procedure and requires revision surgery. STATEMENT OF SIGNIFICANCE: Pelvic organ prolapse is a well-known problem for women and often requires corrective surgery. Polypropylene meshes are often used, which differ in their coating (titanized vs. non-titanized). A severe side effect of these surgeries is mesh erosion, due to onset of inflammation, which requires revision surgery. We examined all erosion cases (4 of 644 patients) with implanted nontitanium-coated meshes by immunohistochemistry and found upregulation of macrophage polarization (as markers CD68 and CD163) and increased expression of the immune checkpoint molecules PD-L1 and PD1. This suggests inflammatory processes and an enhanced immune response. In addition, we set up an in vitro experiment to investigate whether coating plays a role. Here, we demonstrated that the non-titanized meshes elicited a significantly higher immune response in comparison to tetanized meshes, which could lead to the higher erosion rate of the non-titanized meshes. Our results highlight the benefit of titanized meshes, which should lead to a lower revision surgery rate and thus improved patient outcome.

Development of a high-affinity anti-bovine PD-1 rabbit–bovine chimeric antibody using an efficient selection and large production system

Immune checkpoint molecules PD-1/PD-L1 cause T-cell exhaustion and contribute to disease progression in chronic infections of cattle. We established monoclonal antibodies (mAbs) that specifically inhibit the binding of bovine PD-1/PD-L1; however, conventional anti-PD-1 mAbs are not suitable as therapeutic agents because of their low binding affinity to antigen. In addition, their sensitivity for the detection of bovine PD-1 is low and their use for immunostaining PD-1 is limited. To address these issues, we established two anti-bovine PD-1 rabbit mAbs (1F10F1 and 4F5F2) and its chimeric form using bovine IgG1 (Boch1D10F1), which exhibit high binding affinity. One of the rabbit mAb 1D10F1 binds more strongly to bovine PD-1 compared with a conventional anti-PD-1 mAb (5D2) and exhibits marked inhibitory activity on the PD-1/PD-L1 interaction. In addition, PD-1 expression in bovine T cells could be detected with higher sensitivity by flow cytometry using 1D10F1. Furthermore, we established higher-producing cells of Boch1D10F1 and succeeded in the mass production of Boch1D10F1. Boch1D10F1 exhibited a similar binding affinity to bovine PD-1 and the inhibitory activity on PD-1/PD-L1 binding compared with 1D10F1. The immune activation by Boch1D10F1 was also confirmed by the enhancement of IFN-γ production. Finally, Boch1D10F1 was administered to bovine leukemia virus-infected cows to determine its antiviral effect. In conclusion, the high-affinity anti-PD-1 antibody developed in this study represents a powerful tool for detecting and inhibiting bovine PD-1 and is a candidate for PD-1-targeted immunotherapy in cattle.

CD8+ T cell infiltration and proliferation in the brainstem during experimental cerebral malaria.

Cerebral malaria (CM) is a lethal neuroinflammatory disease caused by Plasmodium infection. Immune cells and brain parenchyma cells contribute to the pathogenesis of CM. However, a systematic examination of the changes that occur in the brain parenchyma region during CM at the single-cell resolution is still poorly studied. To explore cell composition and CD8+ T cell infiltration, single-cell RNA sequencing (scRNA-seq) was performed on the brainstems of healthy and experimental cerebral malaria (ECM) mice. Then CD8+ T cell infiltration was confirmed by flow cytometry and immunofluorescence assays. Subsequently, the characteristics of the brain-infiltrated CD8+ T cells were analyzed. Finally, the interactions between parenchyma cells and brain-infiltrated CD8+ T cells were studied with an astrocytes-CD8+ T cell cocultured model. The brainstem is the most severely damaged site during ECM. ScRNA-seq revealed a large number of CD8+ T cells infiltrating into the brainstem in ECM mice. Brain-infiltrated CD8+ T cells were highly activated according to scRNA-seq, immunofluorescence, and flow cytometry assays. Further analysis found a subset of ki-67+ CD8+ T cells that have a higher transcriptional level of genes related to T cell function, activation, and proliferation, suggesting that they were exposed to specific antigens presented by brain parenchyma cells. Brain-infiltrated CD8+ T cells were the only prominent source of IFN-γ in this single-cell analysis. Astrocytes, which have a high interferon response, act as cross-presenting cells to recruit and re-activate brain-infiltrated CD8+ T cells. We also found that brain-infiltrated CD8+ T cells were highly expressed immune checkpoint molecule PD-1, while parenchyma cells showed up-regulation of PD-L1 after infection. These findings reveal a novel interaction between brain-infiltrated CD8+ T cells and parenchyma cells in the ECM brainstem, suggesting that the PD-1/PD-L1 signal pathway is a promising adjunctive therapeutic strategy for ECM targeting over-activated CD8+ T cells.

#5611 ASSOCIATION BETWEEN LOSS OF IMMUNE CHECKPOINT PROGRAMMED CELL DEATH PROTEIN 1 AND ACTIVE ANCA-ASSOCIATED RENAL VASCULITIS

Abstract Background and Aims Immune checkpoint inhibitors (ICIs) have made an important contribution on the survival of patients with certain cancers. ICIs interrupt co-inhibitory signalling pathways mediated by programmed cell death protein 1 (PD-1), programmed cell death protein-ligand 1 (PD-L1), and cytotoxic T lymphocyte-associated antigen (CTLA-4) that result in the elimination of cancer cells by stimulating the immune system. Immune-related adverse events have also been described and attributed to an enhanced immune system activation. Recent observations have suggested dysregulation of immune checkpoints in active antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV). Therefore, we here aimed to analyze abundance of immune checkpoint molecules PD-1/PD-L1 and its implications in ANCA-associated renal vasculitis. Method We here analyzed intrarenal PD-1 and PD-L1 by immunostaining in a total number of 15 kidney biopsies with ANCA-associated renal vasculitis in correlation with glomerular and tubulointer-stitial lesions. For independent validation, publicly available datasets were analyzed for PD-1 expression (encoded by PDCD1). Results We here observed a predominant tubulointerstitial expression of PD-1 that is decreased in ANCA-associated renal vasculitis. Moreover, loss of tubulointerstitial PD-1 correlated with active ANCA-associated renal vasculitis. Consistent to the observed association with active glomerular and tubulointerstitial lesions, we identified that interstitial PD-1 correlated with tubular and/or glomerular PD-L1 positivity. Finally, PD-1 was associated with decreased local synthesis of complement factor B. Interestingly, we did not observe a correlation between PD-1 and complement C5 or its C5a receptor. Combined with our observations, this may implicate a link between im-paired PD-1/PD-L1 signalling, complement factor B, and active ANCA-associated renal vasculitis. Conclusion These findings could be of relevance because experimental data have already been described that PD-1 agonism can be used therapeutically to attenuate autoimmunity in multiple disease models. Furthermore, targeted therapy against complement C5/C5a receptor and factor B are both available and currently evolving in the treatment of AAV. Therefore, this pilot study expands our current knowledge and describes a potential interplay between immune checkpoints and the alternative complement pathway in active ANCA-associated renal vasculitis.

PD-1 Overexpression in Sézary Syndrome Is Epigenetically Regulated

PD-1 Overexpression in Sézary Syndrome Is Epigenetically Regulated

PD-1 Carried on Small Extracellular Vesicles Leads to OSCC Metastasis

Immune checkpoint molecule PD-1, expressed on the cell surface, impairs antigen-driven activation of T cells and thus plays a critical role in tumorigenesis, progression, and the poor prognosis of oral squamous cell carcinoma (OSCC). In addition, increasing evidence indicates that PD-1 carried on small extracellular vesicles (sEVs) also mediates tumor immunity, although their contributions to OSCC are yet unclear. Here, we investigated the biological functions of sEV PD-1 in patients with OSCC. The cell cycle, proliferation, apoptosis, migration, and invasion of CAL27 cell lines treated with or without sEV PD-1 were examined in vitro. We performed mass spectrometry to investigate the underlying biological process, combined with an immunohistochemical study of SCC7-bearing mice models and OSCC patient samples. In vitro data demonstrated that sEV PD-1 induced senescence and subsequent epithelial-mesenchymal transition (EMT) in CAL27 cells by ligating with tumor cell surface PD-L1 and activating the p38 mitogen-activated protein kinase (MAPK) pathway. Comprehensive immunohistochemical analysis of the xenograft mice models and OSCC patient samples revealed a very close correlation between the level of circulating sEV PD-1 and lymph node metastasis. These results demonstrate that circulating sEV PD-1 triggers senescence-initiated EMT in a PD-L1-p38 MAPK-dependent manner, contributing to tumor metastasis. It also suggests that the inhibition of sEV PD-1 may be a promising therapeutic target for the treatment of OSCC.

Metformin plays an antitumor role by downregulating inhibitory cells and immune checkpoint molecules while activating protective immune responses in breast cancer

This study seeks to test the effect of metformin treatment on the outcomes of breast cancer in BALB/c mice bearing 4T1 breast cancer cells. The survival rate and tumor size of mice were compared, as well as evaluation of the changes of immune cells in spleens and the microenvironment of tumors using flow cytometry and ELISA. Our results demonstrate that metformin prolongs mouse survival. A significant decrease in M2-like macrophages (F4/80+CD206+) was found in mice spleen treated with metformin. The treatment also inhibited monocytic myeloid-derived suppressor cells (M-MDSCs, CD11b+Gr-1+) and regulatory T cells (Tregs, CD4+CD25+Foxp3+). Metformin treatment resulted in an increase in the level of IFN-γ and a decrease in IL-10. Expression of the immune checkpoint molecule PD-1 on T cells was inhibited following treatment. Metformin enhances local antitumor activity in the tumor microenvironment, and our data supports the drug as a candidate for evaluation in the treatment of breast cancer.

The programmed cell death protein 1 (PD1) and the programmed cell death ligand 1 (PD-L1) are significantly downregulated on macrophages and Hofbauer cells in the placenta of preeclampsia patients

Preeclampsia is a pregnancy-specific disease which is characterized by abnormal placentation, endothelial dysfunction, systemic inflammation and disruption of the immune system. The goal of this study was to characterize the PD-1/PD-L1 system, an important immune checkpoint system, on macrophages and Hofbauer cells (HBC) in the placenta of preeclamptic patients. The expression of the macrophage markers CD68 and CD163 as well as the proteins PD1 and PD-L1 in the placenta of preeclamptic patients was examined by immunohistochemistry and immunofluorescence in comparison to the placenta of healthy pregnancies. The numbers of CD68-positive and CD163-positive macrophages were significantly downregulated in the decidua (p = 0.021 and p = 0.043) and in the chorionic villi (p < 0.001 and p < 0.001) of preeclamptic patients. The majority of macrophages in the decidua and the chorionic villi were identified to be CD163-positive, indicating a predominantly M2-polarisation. The expression of PD1 on maternal macrophages of the decidua (p < 0.001) and on Hofbauer cells (p < 0.001) was shown to be significantly lower in preeclampsia. Looking at the protein PD-L1 the expression was proven to be downregulated on maternal macrophages in the decidua of preeclamptic patients (p = 0.043). This difference was only caused by a downregulation of PD-L1 expression in male offspring (p = 0.004) while there was no difference in female offspring (p = 0.841). The variation of the immune checkpoint molecules PD1 and PD-L1 in preeclampsia might play an important role in the development of inflammation seen in preeclamptic patients. It might thereby be an important target in the therapy of preeclampsia.

Abstract 6556: A gene signature of DNA damage response pathway is predictive of patient clinical outcomes and is associated with tumor immune microenvironment of lung adenocarcinoma

Abstract DNA damage response (DDR) is crucial to prevent the accumulation of DNA lesions that can lead to genomic instability and promote tumorigenesis. Dysregulation of DDR pathways also provides therapeutic opportunities for new cancer therapy. Given that lung cancer displays a high level of genetic mutation and genomic instability, a comprehensive understanding of the dysregulation of DDR genes in lung cancer, especially non-small cell lung cancer (NSCLC) which accounts for 85% of all lung cancer cases, will be critical for identifying new genes contributing to tumorigenesis and novel targets for lung cancer therapy. The goal of this study is to identify novel targets for lung cancer treatment through a comprehensive analysis of DDR genes and its association with patient survival, genomic mutation/instability, tumor immune microenvironment (TIME), and tumor proliferation ability. To this end, we have comprehensively characterized the expression of 276 DDR genes using the Cancer Genome Atlas (TCGA) and other publicly available data of lung adenocarcinoma (LUAD), the most common NSCLC. We found that 36 out of 276 DDR genes are dysregulated with majority being upregulated in tumors and are associated with patient overall survival (OS) and progression free survival (PFS) based on the TCGA LUAD cohort. A gene expression signature, i.e., DDR gene expression dysregulation score (DDRDS), was constructed based on the geometric mean of the differentially expressed genes that were also associated with patient OS. Patients with a higher DDRDS showed significantly worse OS and PFS, more advanced tumor stage, a higher tumor mutational burden (TMB), neoantigen load, and homologous recombination deficiency (HRD) score. In addition, tumors with higher DDRDS displayed an increase in CD4+ activated memory T-cells, CD8+ T- cells, M0 and M1 macrophage, and NK cells, but a decrease in B cells, CD4+ resting memory T-cells, monocytes, and dendritic cells in TIME. Further, these tumors also showed a higher expression of immune check point molecules PD1 and PD-L1. Lastly, gene set enrichment analysis demonstrated that these tumors had significantly increased nuclear division, DNA replication, chromosome segregation, and cell cycles, reflecting the aggressiveness of the disease. Hence, despite the previous studies demonstrating that mutation and deletion defects in DDR genes are frequent in tumors, we found that the dysregulated DDR genes are mainly upregulated, and DDRDS based on the dysregulated expression of DDR genes is associated with the alteration in TMB/HRD/TIME, tumor aggressiveness, and ultimately patient outcomes. These results suggested that patients with a higher tumor DDRDS are associated with poor prognosis but might benefit from immune checkpoint blockade-associated immunotherapy. Citation Format: Xiaoli Zhang, Junran Zhang. A gene signature of DNA damage response pathway is predictive of patient clinical outcomes and is associated with tumor immune microenvironment of lung adenocarcinoma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 6556.

Abstract 6380: Ultrasensitive detection of circulating human PD-1 and PD-L1 using Single Molecule Counting (SMC) technology

Abstract Immune checkpoint proteins are key regulators of the immune system and potential drug targets for cancer immunotherapy. Cancer immunotherapy targeting immune checkpoint, like programmed cell death protein-1 (PD-1) and programmed cell death ligand 1 (PD-L1) inhibitors has shown treatment efficacy for a broad spectrum of human cancers. Immune checkpoint molecules PD-1 and PD-L1 are expressed on the cell surface of immune cells and tumor cells. Recent studies have also reported these immune checkpoint proteins may undergo alternative splicing or proteolytic cleavage to produce soluble checkpoint proteins. Multiple molecular forms of soluble PD-1 (sPD-1) and PD-L1 (sPD-L1) are detectable in patient sera of multiple types of cancer, and these soluble checkpoint proteins have been reported as putative liquid biopsy biomarkers in the diagnosis and prognosis of oncological disease. Though the clinical significance of circulating soluble immune checkpoint protein profiles as predictive biomarkers has yet to be fully explored and validated, we have committed to develop better and more reliable bioassays to further this research. With that, we have developed 2 Luminex-based multiplex immunoassays for simultaneous quantitation of 48 immune checkpoint proteins, including PD-1 and PD-L1, for patient sera and tumor lysate samples. Here we report the development of 2 novel Single Molecule Counting (SMC) technology-based ultrasensitive single-plex immune checkpoint immunoassays for the detection of sPD-L1 and sPD-1 in human serum and plasma samples. Comparative studies demonstrate these SMC ultrasensitive assays possesses at least 10-100-fold higher sensitivity as compared with the Luminex-based immunoassays. Using these novel ultrasensitive assays, we have validated the detection of significant increases in sPD-L1 and sPD-1 in cancer serum samples as compared with the levels in healthy controls. We have also applied these high sensitivity assays to measure human PD-L1 and PD-1 biomarkers in other sample types including urine, tumor lysates and exosomes. In conclusion, we envision that these PD-1 and PD-L1 SMC assays may overcome a major limitation in biomarker utility and enable the ultrasensitive detection of sPD-1 and sPD-L1 in liquid biopsy and blood biomarker research. Citation Format: Laila Faramarzi, Wen-Rong Lie, Rick Wiese, Jared Fiske. Ultrasensitive detection of circulating human PD-1 and PD-L1 using Single Molecule Counting (SMC) technology [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 6380.

Abstract 5862: ABCB5 knockdown suppresses tumor-intrinsic expression of immune checkpoint regulators PD-1 and PD-L1 in hepatocellular carcinoma (HCC)

Abstract ATP-binding cassette member B5 (ABCB5) identifies cancer-initiating cells (CICs) in multiple malignancies, including malignant melanoma, colorectal cancer, glioblastoma, and hepatocellular carcinoma (HCC). In human melanoma, ABCB5-positive CIC subpopulations have been shown to preferentially express the immune checkpoint molecules PD-1 and PD-L1, and tumor-intrinsic PD-1 receptor functions have been found to promote tumor growth, even in mice lacking adaptive immunity. In HCC, where ABCB5 mediates CIC chemoresistance, PD-1 expression has also recently been identified. However, whether ABCB5 regulates tumor-intrinsic PD-1 expression in HCC or other malignancies is currently unknown. Here, we employed RNA interference in Hep G2 HCC cells with high endogenous ABCB5 expression to study the potential role of ABCB5 in regulating PD-1 expression, utilizing the ABCB5 shRNA target sequence GCTGGAAAGATAGCAACTGAA for ABCB5 knockdown (KD) as described previously. Endogenous ABCB5 levels in ABCB5-KD cells were successfully reduced by 92.8% compared to controls. Investigation of the effects of ABCB5-KD on tumor-intrinsic immune checkpoint molecule expression and on expression of the HCC-CIC marker GRN revealed that ABCB5-KD significantly reduced PD-1 expression by 98.0%, and PD-L1 expression by 62.8% compared to controls. Expression of GRN was also significantly reduced in ABCB5-KD cells by 78.8% compared to controls, suggesting ABCB5 KD-dependent loss of CIC phenotype. Injection of ABCB5-KD cells in NSG mice showed 32.3% reduction in tumor size at endpoint (6 weeks) compared to controls (728.7 ± 199.3mm3 vs 1076.0 ± 450.9 mm3, mean ± SD; p&amp;lt;0.005, repeated measures ANOVA) and 8.53% reduction in tumor weight at endpoint (0.47 ± 0.21g vs 0.51 ± 0.21g, mean ± SD). These results provide initial evidence in an HCC cell line model system that ABCB5 functionally regulates tumor-intrinsic PD-1 and PD-L1 expression. They therefore suggest that ABCB5 blockade represents a novel therapeutic strategy for targeted inhibition of pro-tumorigenic tumor-intrinsic PD-1/PD-L1 expression, with important additional implications for immune checkpoint-targeted cancer immunotherapy. Citation Format: Chun Philip Yeung, Brian J. Wilson, Yuzuru Sasamoto, Ana Maria Waaga-Gasser, Svetlana Karpova, Qin Guo, Natasha Y. Frank, Markus H. Frank. ABCB5 knockdown suppresses tumor-intrinsic expression of immune checkpoint regulators PD-1 and PD-L1 in hepatocellular carcinoma (HCC) [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 5862.

High TOX expression on CD8+ T cells in pure red cell aplasia.

Thymocyte selection-associated high-mobility group box protein (TOX) is an important molecule regulating the development and exhaustion of T lymphocytes. Our aim is to investigate the role of TOX in the immune pathogenesis of pure red cell aplasia (PRCA). TOX expression of CD8+ lymphocytes from the peripheral blood of patients with PRCA was detected by flow cytometry. Additionally, the expression of immune checkpoint molecules PD1 and LAG3 and cytotoxic molecules perforin and granzyme B of CD8+ lymphocytes was measured. The quantity of CD4+CD25+CD127low T cells was analyzed. TOX expression on CD8+ T lymphocytes in PRCA patients was significantly increased (40.73 [Formula: see text] 16.03 vs. 28.38 [Formula: see text] 12.20). The expression levels of PD1 and LAG3 on CD8+ T lymphocytes in PCRA patients were significantly higher than those in the control group (34.18 [Formula: see text] 13.26 vs. 21.76 [Formula: see text] 9.22 and 14.17 [Formula: see text] 13.74 vs. 7.24 [Formula: see text] 5.44, respectively). The levels of perforin and granzyme in CD8+ T lymphocytes of PRCA patients were 48.60 [Formula: see text] 19.02 and 46.66 [Formula: see text] 25.49, respectively, which were significantly higher than those of the control group (31.46 [Formula: see text] 7.82 and 16.17 [Formula: see text] 4.84, respectively). The number of CD4+CD25+CD127low Treg cells in PRCA patients was significantly decreased (4.30 [Formula: see text] 1.27 vs. 1.75 [Formula: see text] 1.22). In PRCA patients, CD8+ T cells were activated and exhibited overexpression of TOX, PD1, LAG3, perforin, and granzyme B, while regulatory T cells decreased. These findings suggest that T cell abnormality plays a critical role in the pathogenesis of PRCA.

Beyond antibody fucosylation: α-(1,6)-fucosyltransferase (Fut8) as a potential new therapeutic target for cancer immunotherapy.

Aberrant post-translational glycosylation is a well-established hallmark of cancer. Altered core fucosylation mediated by α-(1,6)-fucosyltransferase (Fut8) is one of the key changes in tumor glycan patterns that contributes to neoplastic transformation, tumor metastasis, and immune evasion. Increased Fut8 expression and activity are associated with many types of human cancers, including lung, breast, melanoma, liver, colorectal, ovarian, prostate, thyroid, and pancreatic cancer. In animal models, inhibition of Fut8 activity by gene knockout, RNA interference, and small analogue inhibitors led to reduced tumor growth/metastasis, downregulation of immune checkpoint molecules PD-1, PD-L1/2, and B7-H3, and reversal of the suppressive state of tumor microenvironment. Although the biologics field has long benefited tremendously from using FUT8 -/- Chinese hamster ovary cells to manufacture IgGs with greatly enhanced effector function of antibody-dependent cellular cytotoxicity for therapy, it is only in recent years that the roles of Fut8 itself in cancer biology have been studied. Here, we summarize the pro-oncogenic mechanisms involved in cancer development that are regulated by Fut8-mediated core fucosylation, and call for more research in this area where modifying the activity of this sole enzyme responsible for core fucosylation could potentially bring rewarding surprises in fighting cancer, infections, and other immune-related diseases.

PD-1 Inhibitors Can be the First-Line Therapy for Myelodysplastic Syndrome (MDS) --Study on the Bone Marrow Immune Microenvironment of MDS By Multispectral Imaging of Multiplex Immunofluorescence

Objective: Myelodysplastic Syndrome (MDS) is a special myeloid neoplasm with still limited treatment choices and poor survival. Although current therapies including HMAs have been shown to prolong survival, only 40-50% of patients respond to therapy, and responses are universally transient, with loss of response within 2 years. With the increasing understanding of the pathogenesis of MDS in recent years, MDS was found closely associated with the bone marrow microenvironment, including immune microenvironment (IME). More and more evidences show that the immune microenvironment of MDS is related with its disease characteristics and prognosis. Knowing more of the IME of MDS may facilitate the diagnose and treatment on MDS. However, till now little was known about the bone marrow immune microenvironment of MDS. Previous studies mostly applied multiparameter flow cytometry and based on the PB samples or frozen bone marrow fluid samples, less was known about the immune landscape of MDS bone marrow biopsies. Methods: We use multispectral imaging of multiplex immunofluorescence (mIF) to analyze the bone marrow biopsy slides and explore the bone marrow immune microenvironment of MDS patients. A total of 20 de novo MDS patients, 20 post-treatment MDS patients and 20 normal controls were included in this study. In HMAs treated group, 10 patients were response to HMA and another 10 patients were not response. HMAs were either decitabine with a dose at 20mg/m2 d1-5 or 5-Azacytidine with a dose at 75mg/m2 d1-7. The multiplex staining panel could differentiate the distinct cell subpopulations into CD34+CD117+ cells, CD8+ cells, PD1+ cells, CTLA4+ cells, CD8+PD1+ cells and CD8+CTLA4+ cells, CD8-PD1+ cells and CD8-CTLA4+ cells, respectively. We analyzed the proportion of these cells in MDS patients and normal controls, and analyzed the proportion of these cells in MDS patients with different IPSS risk stratifications, and we also assessed the degree of myelofibrosis in MDS patients and analyzed the relationship between myelofibrosis and immune cells. Results: We found that compared with the normal control, the proportion of CD8+ cells in de novo MDS patients increased, and CD8+PD1+ T cells increased too, but the CD8+CTLA4+ T cells decreased. Compared with the lower-risk groups, CD8+ T cells as well as CD8+PD1+ T cells increased in higher-risk groups, while CD8+CTLA4+ T cells decreased. We also found a higher CD8+ T cells as well as CD8+/PD1+ T cells in MDS-F patients, especially in MDS-F patients with higher IPSS risk levels. We also found that compared with the normal control, the proportion of CD8+ T cells per CD34+CD117+ cell reduced, and was lower in IPSS int-2 risk/high-risk group than that in low-risk/int-1 risk group. But the proportion of CD8+PD1+/CD34+CD117+ increased compared with normal control. To analyze the bone marrow immune microenvironment after HMAs treatment, CD8+PD1+ T cells decreased in patients who are effective to HMAs, but still remain high in patients who had no response to HMAs, so did the proportion of CD8+PD1+/CD8+ and CD8+PD1+/CD34+CD117+. However, such findings were not found on CD8+/CTLA4+ T cells. Conclusions: Our research findings provide a new insight on the bone marrow IME of MDS. The results confirmed that the immune checkpoint molecule PD-1 positive CD8+ T cells are abundant in MDS IME and associated with the risk. However, CTLA4 may not be a major molecule interfere with the IME of MDS. Our result also suggest that PD-1 inhibitor combines with HMAs might be used as a first-line therapy for de novo MDS patients to cover those patients who may not have response to HMAs. Also, PD-1 inhibitor may cover higher risk MDS and MDS-F, the latter is a high-risk subtype of MDS. Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal