IGF-I Gene Polymorphism Research Articles

Identification of the association of the GH, IGF-I and Pit-I gene polymorphism with growth traits in Saanen, Alpine and Boer goat breed

This study aims to determine an effect between GH, IGF-I, and Pit-I gene polymorphisms and growth traits such as body weight, heart girth, body length, height at wither, and chest width in Saanen, Alpine, and Boer goat breeds. The polymorphism was identified using the PCR-RFLP technique. GH/HaeIII gene polymorphism results identified two alleles (A and B) and two genotypes (AB and BB). A and B allele frequencies for Saanen, Alpine, and Boer goat breeds were found to be 0.438 and 0.562, 0.444 and 0.556, and 0.197 and 0.803, respectively. AB and BB genotype frequencies were found to be 0.876 and 0.124, 0.889 and 0.111, and 0.394 and 0.606, respectively. IGF-I/HaeIII gene polymorphism results identified two alleles (A and B) and three genotypes (AB, BB, and AA). A and B allele frequencies for the Saanen, Alpine, and Boer breeds were found to be 0.191 and 0.809, 0.173 and 0.827, and 0.182 and 0.818, respectively. The AB, BB, and AA genotype frequencies were found to be 0.315, 0.652, and 0.033 for Saanen, 0.247, 0.704, and 0.049 for Alpine, and 0.242, 0.697, and 0.061 for Boer, respectively. Regarding Pit-I/PstI gene polymorphism, T and C allele frequencies were determined as 0.921 and 0.079, 0.988 and 0.012, and 0.985 and 0.015 for Saanen, Alpine, and Boer breeds, respectively. TT and TC genotype frequencies were found to be 0.843 and 0.157, 0.975 and 0.025, and 0.970 and 0.030 in Saanen, Alpine, and Boer goats, respectively. An association was found between GH polymorphism and chest width in Saanen and Alpine goats and between body weight and heart girth in Boer goats. Additionally, an association was identified between IGF-I polymorphism and body weight in Alpine and chest width in Boer. There was also an association between Pit-I polymorphism and body weight in Alpine goats.

Insulin-like growth factor-1 (Igfi) gene polymorphism and its effect on egg quality traits of three chicken genotypes reared in hot humid tropics

A study was conducted on the effect of gene polymorphism of Insulin like Growth Factor-1 (IGFI) on egg quality traits in three chicken genotypes. A total of 250 chicken comprising 150 FUNAAB-Alpha (50 Normal feather, 50 Naked neck and 50 Frizzle feather), 50 Kuroiler and 50 Sasso were used for this experiment. At point of lay, 30 hens per genotype were selected and transferred into a battery cage of one unit per bird. Data was collected on the egg quality traits, 30 eggs for each genotype was collected. All collected data was subject to analysis of variance using a completely randomized design, of which genotype was the interest factor. At 16 weeks, 1ml of blood was collected from each hen and extraction of genomic DNA from the blood was done. PCR was conducted using the pair of primer and condition as described by Nagaraga, et al. (2000). The PCR amplicons were digested using PstI restriction enzymes following the manufacturer’s procedure. The resulting fragments were analyzed using GenAnalyzer (GenAlEx 6.502) was used for the genetic diversity of the IGFI locus. This data was subject to the PROC GLM of SAS 9.2. Results showed the chicken genotypes significantly (P<0.05) affect all the egg-quality traits except the shell weight, yolk ratio and albumen ratio. The IGFI gene polymorphism had no significant effect (P>0.05) on egg quality traits for except the egg length and egg width.
 
 
 
 
 Une étude a été menée sur l’effet du polymorphisme génique du facteur de croissance analogue à l'insuline (IGFI) sur les caractéristiques de qualité des œufs chez trois génotypes de poulet. Un total de 250 poulets comprenant 150 FUNAAB-Alpha (50 plumes normales, 50 cou nu et 50 plumes Frizzle), 50 Kuroiler et 50 Sasso ont été utilisés pour cette expérience. Au moment de la ponte, 30 poules par génotype ont été sélectionnées et transférées dans une cage en batterie d'une unité par oiseau. Des données ont été collectées sur les traits de qualité des œufs, 30 œufs pour chaque génotype ont été collectés. Toutes les données recueillies ont fait l'objet d'une analyse de variance selon un design complètement randomisé, dont le génotype était le facteur d'intérêt. À 16 semaines, 1 ml de sang a été prélevé sur chaque poule et l'extraction de l'ADN génomique du sang a été effectuée. La PCR a été réalisée en utilisant la paire amorce et condition décrite par Nagaraga et al. (2000). Les amplicons PCR ont été digérés à l'aide d'enzymes de restriction PstI selon la procédure du fabricant. Les fragments résultants ont été analysés à l'aide de GenAnalyzer (GenAlEx 6.502) a été utilisé pour la diversité génétique du locus IGFI. Ces données ont été soumises au PROC GLM de SAS 9.2. Les résultats ont montré que les génotypes de poulet affectent de manière significative (P <0,05) tous les caractères de qualité des œufs, à l'exception du poids de la coquille, du rapport de jaune et du rapport d'albumen. Le polymorphisme du gène IGFI n'a eu aucun effet significatif (P>0,05) sur les caractères de qualité des œufs, sauf la longueur et la largeur des œufs.

Polymorphisms of Palu Sheep IGF-1 Gene and Their Relationship with Skeletal Growth

This study aims to examine the polymorphisms of the IGF-1 gene associated with body weight and size. A total of 60 sheep from different farm locations in Palu City (Villages of Taipa, Poboya, Kawatuna, and Petobo), Central Sulawesi, Indonesia, were used. The variables observed were adult body weight and measurements, such as shoulder height, body length, humerus length, radius-ulna length, metacarpus length, hip height, femur length, tibial length, and metatarsus length as phenotypic characteristics. IGF-1 gene polymorphisms were analyzed using the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) with Bsp143ǀǀ as a restriction enzyme. These gene polymorphisms were calculated using the allele and genotype frequency approach, as well as the Polymorphic Informative Content (PIC). Genotype associations with body weight and bone size were analyzed using the General Linear Model analysis method. The PCR-RFLP analysis results showed the presence of polymorphisms with the frequency and genotypes of GG (21.7%), GC (68.3%), and CC (10%). Furthermore, the frequencies of G (55.8%) and C (44.2%) genes with a 49.32% polymorphism rate (PIC) were not in the Hardy-Weinberg equilibrium (p<0.05). In conclusion, the IGF-1 gene polymorphism was detected in Palu sheep with an insignificant effect on body weight and bone size.

The relationship between polymorphism of insulin-like growth factor I gene and susceptibility to type 2 diabetes in Uygur population, Xinjiang, China

BackgroundType 2 diabetes (T2DM) susceptibility varies among different populations and is affected by gene single nucleotide polymorphism (SNP). Insulin-like growth factor (IGF)-1 gene, which has many SNP loci, is involved in T2DM pathogenesis. However, the relationship of IGF-1 gene polymorphism with T2DM in Uyghur population is less studied.ObjectiveTo investigate the relationship between T2DM susceptibility and polymorphism of IGF-1 gene in Uyghur population of Xinjiang, China.MethodsThis study enrolled 220 cases (122 males (55.46%) and 98 females (44.54%); mean age of 53.40 ± 10.94 years) of T2DM patients (T2DM group) and 229 (124 males (54.15%) and 105 females (45.85%); mean age of 51.64 ± 10.48 years) healthy controls (control group). Biochemical indexes were determined. IGF-1 gene polymorphism was analyzed by SNP genotyping.ResultsThe levels of TG, HDL, LDL, BUN, and Cr were statistically significant between the T2DM group and the control group. In terms of IGF-1 polymorphism, T2DM group had higher frequency of AA genotype (OR = 2.40, 95% CI = 1.19–4.84) and allele A (OR = 1.55, 95% CI = 1.17–2.06) of rs35767 loci, suggesting that rs35767 is related to the occurrence of T2DM. A total of 5 gene interaction models was obtained through analyzing the interaction of 5 SNP loci with the GMDR method. Among them, the two-factor model that included rs35767 locus and rs5742694 locus had statistical difference with a large cross-validation consistency (10/10). The combination of GG/CC, GA/AA, AA/AA, and AA/AC genotype was in high-risk group, whereas the combination of GG/AA, GG/AC, GA/AC and GA/CC genotype was in the low-risk group. The risk of T2DM in the high-risk group was 2.165 times than that of the low-risk group (OR = 2.165, 95% CI = 1.478–3.171).ConclusionTG, HDL, LDL, BUN, and Cr are influencing factors of T2DM in Uyghur population. The rs35767 locus of IGF-1 gene may be associated with T2DM in Uyghur population. The high-risk group composing of rs35767 locus and rs5742694 locus has a higher risk of T2DM.

Assessment the linking of Insulin-like growth factor 1 hormone and their gene polymorphism with excess adiposity

This study aims to determine the correlation between the serum IGF-1 concentrations hormone and their gene polymorphism with excess adiposity (obese adults) in Babylon province. The study has performed on 50 participants divided into obese (n=30) and control (n=20) groups with age range (20-40 years). No significant differences have been reported in the concentrations of IGF-1 hormone in obese group. However, the results showed that genotype distribution of AA and AB in IGF-1 gene polymorphism was represented by 83.3% and 16.7%, respectively. While in control group, it was 90.0% and 10.0%, respectively. Furthermore, in obese group, the allele frequency of A and B in IGF-1 gene polymorphism was represented by 91.65% and 8.35%, respectively, whereas the control group presented as 95.0% and 5.0%, respectively. Moreover, several single nucleotide polymorphisms (SNPs) were obtained between the two resolved haplotypes and between the IGF1 genes. The results demonstrate that there is no association between AA and AB polymorphisms in the obese group (OR=0.87, CI [0.71-1.17]) as compared with the control group. How to Cite this Article Pubmed Style Amera Kamal Mohammed, Chrow Ahmed Khurshid, Heman Burhanalden Abdulrahman. the linking of Insulin-like growth factor 1 hormone and their gene polymorphism with excess adiposity. SRP. 2020; 11(5): 649-653. doi:10.31838/srp.2020.5.91 Web Style Amera Kamal Mohammed, Chrow Ahmed Khurshid, Heman Burhanalden Abdulrahman. the linking of Insulin-like growth factor 1 hormone and their gene polymorphism with excess adiposity. http://www.sysrevpharm.org/?mno=113366 [Access: March 30, 2021]. doi:10.31838/srp.2020.5.91 AMA (American Medical Association) Style Amera Kamal Mohammed, Chrow Ahmed Khurshid, Heman Burhanalden Abdulrahman. the linking of Insulin-like growth factor 1 hormone and their gene polymorphism with excess adiposity. SRP. 2020; 11(5): 649-653. doi:10.31838/srp.2020.5.91 Vancouver/ICMJE Style Amera Kamal Mohammed, Chrow Ahmed Khurshid, Heman Burhanalden Abdulrahman. the linking of Insulin-like growth factor 1 hormone and their gene polymorphism with excess adiposity. SRP. (2020), [cited March 30, 2021]; 11(5): 649-653. doi:10.31838/srp.2020.5.91 Harvard Style Amera Kamal Mohammed, Chrow Ahmed Khurshid, Heman Burhanalden Abdulrahman (2020) the linking of Insulin-like growth factor 1 hormone and their gene polymorphism with excess adiposity. SRP, 11 (5), 649-653. doi:10.31838/srp.2020.5.91 Turabian Style Amera Kamal Mohammed, Chrow Ahmed Khurshid, Heman Burhanalden Abdulrahman. 2020. the linking of Insulin-like growth factor 1 hormone and their gene polymorphism with excess Reviews in Pharmacy, 11 (5), 649-653. doi:10.31838/srp.2020.5.91 Chicago Style Amera Kamal Mohammed, Chrow Ahmed Khurshid, Heman Burhanalden Abdulrahman. Assessment the linking of Insulin-like growth factor 1 hormone and their gene polymorphism with excess adiposity. Systematic Reviews in Pharmacy 11 (2020), 649-653. doi:10.31838/srp.2020.5.91 MLA (The Modern Language Association) Style Amera Kamal Mohammed, Chrow Ahmed Khurshid, Heman Burhanalden Abdulrahman. Assessment the linking of Insulin-like growth factor 1 hormone and their gene polymorphism with excess adiposity. Systematic Reviews in Pharmacy 11.5 (2020), 649-653. Print. doi:10.31838/srp.2020.5.91 APA (American Psychological Association) Style Amera Kamal Mohammed, Chrow Ahmed Khurshid, Heman Burhanalden Abdulrahman (2020) the linking of Insulin-like growth factor 1 hormone and their gene polymorphism with excess Reviews in Pharmacy, 11 (5), 649-653. doi:10.31838/srp.2020.5.91

Mammographic breast density and IGF-1 gene polymorphisms rs1520220, rs2946834 and rs6219 in Polish women.

Aim of the studyThe aim of the study was to analyze three single nucleotide polymorphisms – rs1520220, rs2946834, rs6219 – of the IGF-1 gene in the context of breast mammographic density.Material and methodsThe research material included 202 samples of the peripheral blood of women with increased mammographic breast density and 238 samples of the epithelium from the oral mucosa of women without diagnosed pathological changes of the breast and with no family history of breast and/or ovarian cancer. The real-time polymerase chain reaction method was applied for analysis of polymorphisms.Resultsrs1520220 polymorphism was associated with increased mammographic density of the breasts. The presence of the CC genotype in the IGF-1 gene increased the risk of developing higher breast density visible in mammography by 2.43-fold. CC homozygotes (rs1520220) correlated with higher Breast Imaging-Reporting and Data System scale (3 vs. 4 and 5) (OR = 5.6; 95% CI: 1.82–16.3, p = 0.001). In the present study no relationship was detected between rs6219 and rs2946834 polymorphism and mammographic breast density.ConclusionsThe results suggest that the rs1520220 polymorphism of the IGF-1 gene plays an important role in the occurrence of increased mammographic breast density.

IGF-1 Gene Polymorphism in Migratory Gaddi Goats of Western Himalayan Region, India

IGF-1 Gene Polymorphism in Migratory Gaddi Goats of Western Himalayan Region, India

Study on Genetic Polymorphism of IGF-1 Gene in Barbari and Jamunapari Goat

Insulin like growth factor (IGF 1) play an important role in the production and reproduction. One hundred and ninety two adult goats of Barbari and Jamunapari breed were taken for study. Data on growth traits were recorded to identify SNPs in the IGF-1gene by using High Resolution Melting (HRM) technique. Five fragments of IGF-1 were amplified length of amplicon were 105, 124, 150, 122 and 122 bp covering 5’UTR, 3’UTR, Exon 3, Exon 2 and 5’UTR regions, respectively and subsequently sequenced. The HRM analysis revealed no sequence variation among the samples of both breeds. Hence, the all five amplified fragments of IGF-1 gene showed monomorphic pattern and, no significant association could be detected with growth traits in Barbari and Jamunapari goats.

Single nucleotide polymorphisms of insulin-like growth factor gene and mammographic breast density.

Aim of the studyTo analyze six single nucleotide polymorphisms (SNPs): rs1520220, rs2945834, rs5747694, rs6214, rs6219, rs5742678. An attempt was made to assess the significance of the above IGF-1 gene polymorphisms as prognostic and predictive factors in Polish women with diagnosed increased breast mammographic density.Material and methodsThe study included women diagnosed with an increased breast mammographic density (n = 98), breast cancer (n = 135) and women as a control group (n = 60). The method used to detect polymorphisms in the IGF-1 gene was the analysis of single-stranded DNA conformation polymorphism (SSCP-PCR) and Sanger’s sequencing.ResultsIn the case of rs1520220 polymorphism, the genotype CC was found to increase the risk of breast cancer (OR = 2.6 95% CI 1.01-6.5, p = 0.04). Analysis of the rs2945834 polymorphism revealed that the occurrence of the G allele reduced the risk of breast cancer, while the occurrence of the A allele increased the risk of disease almost twice (OR = 0.55 95% CI). Among women who are heterozygous in terms of rs5747694 polymorphism (TG), the risk of breast cancer is twice as high as in the control group. The SNPs in the study group did not correlate with mammographic breast density.ConclusionsThe results obtained in the course of the analysis indicate that polymorphisms rs1520220, rs2946834, rs5747694 gene IGF-1 are associated with the occurrence of breast cancer but not with increased mammographic density. Summing up, the association between the polymorphisms of IGF-1 and the risk of developing breast cancer is independent of mammographic density.

Genetic polymorphism in IGF-1 gene in four sheep and goat breeds and its association with biometrical traits in migratory Gaddi goat breed of western Himalayan state of Himachal Pradesh, India

Sheep and goat production is a predominant livestock activity in harsh climatic regions of the country particularly in hilly areas. The goat and sheep population in Himachal Pradesh is 1.12 and 0.81 million respectively. Gaddi and Rampur-Bushair are the two indigenous sheep breeds of the state well adapted to the prevalent migratory production system. The somatotrophic axis (GH/IGF-I axis) is considered as the key in postnatal growth and metabolism in different mammals including farm animals. The technique of PCR-RFLP was used to analyze polymorphism of IGF-1 gene in sheep and goat breeds of Himachal Pradesh and to study association with body measurements in Gaddi goats. For polymorphism studies, genomic DNA was isolated from 63, 68, 197 and 73 animals belonging to Gaddi sheep, Rampur- Bushair sheep, Gaddi goat and Chegu goats, respectively.. PCR amplification of IGF-1 yielded 363 bp amplicon. The PCR-RFLP digestion of amplified products with HaeIII revealed three fragments of 363 bp, 264 bp and 99 bp after digestion. Allele frequencies for A allele were 0.66 0.59, 0.65 and 0.70 and for B allele were 0.34, 0.41, 0.35 and 0.20 in Gaddi sheep, Rampur-Bushair sheep, Gaddi goat and Chegu goat, respectively. The frequency of AA, AB and BB genotypes ranged from 0.38 to 0.55, 0.30 to 0.42 and 0.14 to 0.19 in different breeds studied .The Ne, Hobs and Hexp ranged from 1.80 to 1.99, 0.30 to 0.43, 0.42 to 0.48, and 0.33 to 0.37, respectively in different populations. The PIC revealed median level of polymorphism in studied breeds. Alignment of sequences also confirmed presence of C/G substitution at 264 bp. Nucleotide variability was found at 17 places between different breeds. Genetic variability was detected among all four breeds studied, however no significant association could be detected in Gaddi goats.

Association of IGF-I gene polymorphism with diabetic nephropathy in Egyptians with type 2 diabetes

BackgroundGenetic-based studies are being carried out worldwide to identify the susceptibility genes for diabetic nephropathy (DN), which represents a major health problem in all diabetics.AimTo study the association between genotypes of insulin-like growth factor-1 (IGF-1) and DN among Egyptian patients with type 2 diabetes and if there is any possible relation between these polymorphisms and different variables.Patients and methodsA total of 26 diabetics without nephropathy (group 1) and 26 with nephropathy (group 2), with an average age of 52.7±6.1 years, and 25 age-matched and sex-matched healthy participants (control group) were included. Two tagging single nucleotide polymorphisms were assessed in IGF-1 gene: rs6214 and rs10860860. Genotypic distribution was tested for Hardy–Weinberg equilibrium. The genotype was evaluated using the χ2 tests. Fasting blood glucose, glycated hemoglobin, uric acid, lipid profile, serum creatinine, and urine albumin–creatinine ratio were assessed.ResultsThe distribution of IGF-1 gene polymorphisms reflects a significant association with DN, where the frequency of variant genotype GG in polymorphism rs6214 was found to be significantly higher in diabetics with nephropathy than other groups [odds ratio (OR)=20.57; 95% confidence interval, 2.25–74; P=0.001). Moreover, the frequency of variant AA in polymorphism rs10860860 was also found to be significantly higher in diabetics with nephropathy (OR=7.37; 95% confidence interval, 1.87–30.07; P=0.001). However, GA and AT alleles were found to be associated with ORs less than 1 in diabetics with nephropathy when compared with other groups (P=0.002 and 0.007, respectively), which means that it could be significantly protective against DN. where they found to be significantly higher in diabetics with genotype GG than those with genotype GA (P=0.13, 0.11 respectively).ConclusionThe variants of IGF-1 rs6214 and rs10860860 could entail a risk of DN in Egyptians with type 2 diabetes mellitus. It means that the type of IGF-1 gene polymorphism is responsible for the susceptibility of DN more than its serum level.

The relationship between CA repeat polymorphism of the IGF-1 gene and the structure of motor skills in young athletes.

The map of candidate genes that can potentially affect physical fitness becomes larger every year, and they are associated with such aspects as respiratory and cardiovascular stability; body build and composition - especially muscle mass and strength; carbohydrate and lipid metabolism; response to training; and exercise intolerance.The aim of this study was to analyze the relationship between the CA repeat polymorphism of the P1 promoter of the IGF1 gene and the structure of motor skills in the two groups of Polish young athletes in 2007-2009. In this study, 350 young sportsmen representing different sports disciplines were examined (age = 15.5 ± 0.5 years), by genotyping the IGF1 gene and determining the structure of motor skills using the International Physical Fitness Test (IPFT) battery. The multiple stepwise regression was used to determine the impact of the investigated motor skills on the indicator of the overall physical fitness, measured by the total score of the International Physical Fitness Test (IPFT). The analysis showed some regularity related to the character of the IGF1 gene polymorphism. It can be concluded that the two groups of young boys athletes practicing various sports disciplines (kinds of physical exercise) displayed similar associations between CA repeat polymorphism of the P1 promoter of the IGF1 gene and the level of motor effects. Our results suggest that this polymorphism may be a genetic marker of the physical performance phenotype. We demonstrated that CA repeat polymorphism of the P1 promoter of the IGF1 gene was associated with strength predispositions in the homozygous and non-carriers groups. In the group who were heterozygous it was speed-strength aptitudes.

Association of IGF1 Gene Polymorphism with Growth Rates in Madras Red Sheep

Insulin-like growth factors (IGFs), formerly called somatomedin, are members of a family of insulin related peptides. Insulin-like growth factors 1 (IGF-1) plays a key role in mammalian growth, lactation and metabolism, by stimulating anabolic processes such as cell proliferation, skeleton and hair growth and protein synthesis. The aim of this study was to investigate the association of IGF1 (exon1) gene polymorphism with growth rates in Madras Red sheep. Blood samples were collected from 66 animals maintained at Post Graduate Research Institute in Animal Sciences, Kattupakkam and 70 animals from farmers’ flock in the breeding tract of Madras Red sheep and DNA was isolated using high salt method. The animals were genotyped by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP). In the PCR reaction the primers used were 5’ ATTACAGCTGCCTGCCCCTT 3’ and 5’ CACATCTGCTTACACCTTACCCG 3’. A 265 bp long IGF1 (exon1) gene PCR product was genotyped for polymorphic pattern using SSCP method. The PCR-SSCP analysis of exon1 IGF-I revealed three distinct patterns viz., AA, AG and GG and the genotype frequencies were in the order of 0.963, 0.022 and 0.015. In the present study, no significant effect (P>0.05) was observed between genotypes on all age groups in Madras Red sheep.

DGAT1, CAST and IGF-I Gene Polymorphisms in Akkaraman Lambs and Their Effects on Live Weights up to Weaning Age

DGAT1, CAST and IGF-I Gene Polymorphisms in Akkaraman Lambs and Their Effects on Live Weights up to Weaning Age

IGF1 Gene Polymorphism in Selected Species of the Canidae Family

Abstract The gene IGF1 has been shown to have a significant influence on the size of individuals, including animals of the Canidae family. In this study we determined SNP mutations of the IGF1 gene in dogs, raccoon dogs and farmed and free-living red foxes from Poland and Canada. No SNP mutations were noted in dogs or raccoon dogs, but a total of 14 single nucleotide polymorphisms were identified in foxes, including 12 substitutions, as well as one new mutation missense variant (exon 6) in wild Polish foxes and one synonymous mutation variant in wild foxes from Canada. We identified specific SNP profiles characteristic only for farmed foxes and only for wild foxes, as well as specific SNP profiles or wild foxes from North America (Canada) and from Europe (Poland).

Investigation of the 5′ flanking region and exon 3 polymorphisms of IGF-1 gene showed moderate association with semen quality in Sanjabi breed rams

In this study, semen samples were collected from 96 Sanjabi rams in order to investigate the IGF-1 gene polymorphisms and their relationship with the characteristics of semen quality and testicular size. The dimensions of scrotal length, width and circumference were measured during autumn and spring over two years. Blood samples were simultaneously collected from jugular vein to extract DNA. PCR was performed using specific primers to amplify 294 and 272bp fragments including 5′ regulatory region and exon 3 of IGF-1 gene, respectively. PCR products were digested by BFOI and Eco88l restriction enzymes, respectively. Two genotypes including AA (194 and 100bp), AB (294, 194 and 100bp) and all possible genotypes including CC (182 and 90bp), CT (272, 182, and 90bp) and TT (272bp) were observed for 5′ flanking region and exon 3 of IGF-1 gene, respectively. The significant differences among IGF-1 genotypes for testicular dimensions were not observed. However, the polymorphism of 5′ flanking region in the studied population had significant effect on individual motility and percent morphology traits. Animals with AB genotype had significantly higher individual motility compared with AA genotype (P < 0.05). Also, animals with AA genotype had significantly the highest percent morphology compared with AB genotype (P < 0.1). The exon 3 of IGF-1 gene had significant effect on individual motility, concentration, morphology and water test traits. Animals with CT genotype had the highest sperm concentration (P < 0.1) and water test (P < 0.05) compared to CC and TT genotypes. Moreover, animals with TT genotype had significantly the highest percent morphology compared with other genotypes (P < 0.05). Briefly, the results indicated that individual motility, concentration, percent morphology and water test traits could be in association with IGF-1 genotypes. It might be concluded that polymorphisms in IGF-1gene can be considered to develop male fertility in future and for using in selection process of better animals under masker assisted selection programs.

New polymorphism in the 5' flanking region of IGF-1 gene and its association with wool traits in Egyptian Barki sheep.

Insulin-like growth factor-1 gene (IGF-1) is considered as a major candidate gene for the economic traits of animal production. Polymorphism of 5′ flanking region of IGF-1 gene in Barki sheep (n = 91) and its association with wool traits were studied using the polymerase chain reaction coupled with single-strand conformation polymorphism technique (PCR-SSCP), PCR-restriction fragment length polymorphism (PCR-RFLP), sequence analysis and different measurements of wool traits (clean fleece weight and fiber diameter). PCR-SSCP analysis revealed three different banding patterns corresponding with three genotypes frequencies GG (0.25), GA (0.58), AA (0.17). PCR-RFLP and corresponding sequence analysis revealed nucleotide transversion from Guanine (G) to Cytosine (C) at nucleotide position 85 and transition from (G) to Adenine (A) at position 87. This is the first study that recorded two SNPs within the 5′ flanking region of IGF-1 gene in Egyptian Barki sheep, which were submitted to DNA Data Bank OF Japan (DDBJ) with Accession No. LC151463.1. The genotype GG showed positive significant association (P < 0.001) with clean fleece weight (CFW) trait (Odd Ratio = 2.83). By contrast, genotype AA had negative significant association (P < 0.05) with such trait (Odd Ratio = 0.15). On the other hand, fiber diameter (FD) measurements showed no significant association (P > 0.05) with different IGF-1 genotypes. This study adds evidence of the association between IGF-1 gene polymorphism and CFW of wool in Egyptian Barki sheep. Therefore; it is important to consider IGF-1 gene as a candidate gene marker for wool weight traits and it should be identified before using successful breeding program.

Polymorphism of Insulin-like Growth Factor 1 Gene (IGF1/TasI, IGF1/SnaBI, IGF1/RsaI) and the Association with Daily Gain of Pesisir Cattle Local Breed from West Sumatera, Indonesia.

The insulin-like growth factor 1 gene (IGF1) is a candidate gene for marker-assisted selection strategies. Two single nucleotide polymorphism of IGF1 gene namely IGF1/SnaBI and IGF1/TasI has been reported to be associated with production traits in several cattle breeds. One single nucleotide polymorphism in exon 4 namely IGF1/Rsa1 has a significant influence (p<0.01) on birth weight, weaning weight and average daily gain of Bali cattle. The objective of this study was to determine the IGF1/SnaBI, IGF1/TasI and IGF1/RsaI polymorphisms and their associations with average daily gain in Pesisir cattle local breed from west Sumatera Indonesia. The isolation of DNA from 183 blood sample was performed using DNA extraction kit (Promega DNA purification kit) following the manufacture procedure. The amplification of IGF1 fragment was done by master mix from Thermo Scientific. In the case of the IGF1/SnaBI polymorphism, three genotypes were observed, frequencies were 0.011, 0.011 and 0.978 for AA, AB and BB, respectively. This gives frequencies of 0.064 and 0.9836 for A and B alleles. For IGF1-TasI locus showed that AA genotype occurred with a frequency of 0.978, AC with 0.011 and CC with 0.011 with frequency for allele A and C were 0.9836 and 0.0164, respectively. In the case IGF1/RsaI polymorphism produces only TT and CT genotype with frequency 0.027 and 0.973 respectively and frequency of T and C allele were 0.5137 and 0.4863, respectively. Among these 3 polymorphism only IGF1/RsaI was associated with average daily gain, Thus this polymorphism could be a potential for improving body weight in Pesisir cattle. Association study for IGF1/SnaBI and IGF1/TasI were strongly limited by low frequency of one allele.

Novel functional polymorphism in IGF-1 gene associated with multiple sclerosis: A new insight to MS

BackgroundInteractions between several genes and environment may play a role in susceptibility to multiple sclerosis (MS). The IGF-1 plays a key role in proliferation, maintenance and survival of nerve cells. Therefore, we hypothesized that IGF-1 may be a target for prediction and control MS. We aimed to analysis IGF-1 gene promoter sequence, to investigate the effect of the single nucleotide variants on IGF-1 expression and its association with MS. MethodsWe enrolled 339 MS patients and 431 healthy controls. A specific region in IGF-1 gene promoter was investigated by SSCP analysis. All samples were genotyped by SSP-PCR. In-vitro and in-vivo IGF-1 production was measured by ELISA assay. IGF-1 expression in PBMCs was measured using real-time PCR. ResultsWe identified a T to C single nucleotide substitution at position −1089 and a C to T at position −383 from transcription start site in the IGF-1 gene promoter. There was a significant association between MS and genotypes IGF-1(−383) C/T (p=0.001) and IGF-1(−383) C/C (p<0.001). There was also a significant association between IGF-1(−383) allele C and MS (p=0.001). In-vitro and in-vivo IGF-1 level showed that IGF-1 production in samples with genotype IGF-1(−383) C/C significantly was less than T/T (p=0.004) but not T/C (p=0.220). ConclusionAccording to IGF-1 roles in CNS and our results, this study suggests that low IGF-1 level may be associated with susceptibility to MS.

Association of insulin-like growth factor (IGF)-1 gene polymorphisms with plasma levels of IGF-1 and acne severity

Polymorphisms of the insulin-like growth factor (IGF)-1 gene consisting of variable cytosine adenosine repeats in the promoter region may directly influence the expression of IGF-1. We sought to assess the role of IGF-1 gene polymorphisms in determination of plasma IGF-1 levels, acne, and its severity. In this case-control study, 80 patients with acne vulgaris of 4 severity grades as per Global Acne Grading System and 80 age- and gender-matched control subjects without acne were studied. All the study subjects were without any disorder or a history of drug intake likely to affect IGF-1 level within a year before the study inclusion date. IGF-1 polymorphism was determined by polymerase chain reaction and plasma levels of IGF-1 by enzyme-linked immunosorbent assay. Acne severity was assessed by Global Acne Grading System. Mean plasma IGF-1 level in acne cases was significantly higher than in non-acne controls (P=.04). Plasma IGF-1 level positively correlated with severity of acne (P=.01). Individuals homozygous for the 192-base pair (bp) allele had 4.29 times odds risk (95% confidence interval 1.38-13.33) of having acne and a significantly higher mean level of IGF-1 compared with non-192/non-192 participants. Individuals homozygous for the 192-bp allele had 3.08 times odds risk (95% confidence interval 1.15- 8.31) of having higher severity grade of acne compared with non-192/non-192 participants. A relatively small number of participants were studied. Plasma IGF-1 levels positively correlate with severity of acne. The 192/192 homozygotes had higher risk of acne and higher severity grade of acne. Functional studies showing the relationship between IGF-1 promoter level polymorphism and actual gene expression in skin are warranted.