Identification Of Causative Mutations Research Articles

Differences in oxazolidinone resistance mechanisms and small colony variants emergence of Staphylococcus aureus induced in an in vitro resistance development model

ABSTRACT Invasive Staphylococcus aureus infections are associated with a high burden of disease, case fatality rate and healthcare costs. Oxazolidinones such as linezolid and tedizolid are considered potential treatment choices for conditions involving methicillin resistance or penicillin allergies. Additionally, they are being investigated as potential inhibitors of toxins in toxin-mediated diseases. In this study, linezolid and tedizolid were evaluated in an in vitro resistance development model for induction of resistance in S. aureus. Whole genome sequencing was conducted to elucidate resistance mechanisms through the identification of causal mutations. After inducing resistance to both linezolid and tedizolid, several partially novel single nucleotide variants (SNVs) were detected in the rplC gene, which encodes the 50S ribosome protein L3 in S. aureus. These SNVs were found to decrease the binding affinity, potentially serving as the underlying cause for oxazolidinone resistance. Furthermore, in opposite to linezolid we were able to induce phenotypically small colony variants of S. aureus after induction of resistance with tedizolid for the first time in literature. In summary, even if different antibiotic concentrations were required and SNVs were detected, the principal capacity of S. aureus to develop resistance to oxazolidinones seems to differ between linezolid and tedizolid in-vivo but not in vitro. Stepwise induction of resistance seems to be a time and cost-effective tool for assessing resistance evolution. Inducted-resistant strains should be examined and documented for epidemiological reasons, if MICs start to rise or oxazolidinone-resistant S. aureus outbreaks become more frequent.

RASopathies and cardiac manifestations.

As binary switches, RAS proteins switch to an ON/OFF state during signaling and are on a leash under normal conditions. However, in RAS-related diseases such as cancer and RASopathies, mutations in the genes that regulate RAS signaling or the RAS itself permanently activate the RAS protein. The structural basis of this switch is well understood; however, the exact mechanisms by which RAS proteins are regulated are less clear. RAS/MAPK syndromes are multisystem developmental disorders caused by germline mutations in genes associated with the RAS/mitogen-activated protein kinase pathway, impacting 1 in 1,000-2,500 children. These include a variety of disorders such as Noonan syndrome (NS) and NS-related disorders (NSRD), such as cardio facio cutaneous (CFC) syndrome, Costello syndrome (CS), and NS with multiple lentigines (NSML, also known as LEOPARD syndrome). A frequent manifestation of cardiomyopathy (CM) and hypertrophic cardiomyopathy associated with RASopathies suggest that RASopathies could be a potential causative factor for CM. However, the current supporting evidence is sporadic and unclear. RASopathy-patients also display a broad spectrum of congenital heart disease (CHD). More than 15 genes encode components of the RAS/MAPK signaling pathway that are essential for the cell cycle and play regulatory roles in proliferation, differentiation, growth, and metabolism. These genes are linked to the molecular genetic pathogenesis of these syndromes. However, genetic heterogeneity for a given syndrome on the one hand and alleles for multiple syndromes on the other make classification difficult in diagnosing RAS/MAPK-related diseases. Although there is some genetic homogeneity in most RASopathies, several RASopathies are allelic diseases. This allelism points to the role of critical signaling nodes and sheds light on the overlap between these related syndromes. Even though considerable progress has been made in understanding the pathophysiology of RASopathy with the identification of causal mutations and the functional analysis of their pathophysiological consequences, there are still unidentified causal genes for many patients diagnosed with RASopathies.

A novel telomerase activity and microRNA-21 upregulation identified in a family with palmoplantar keratoderma

Palmoplantar keratoderma is a set of skin diseases with hyperkeratotic thickening of palms and soles which are characteristic of these heterogeneous group of keratinization disorders.Various genetic mutations, autosomal dominant or recessive, have been identified which may triggerpalmoplantar keratoderma, as KRT9 (Keratin 9), KRT1 (Keratin1), AQP5 (Aquaporin), SERPINB 7 (serine protease inhibitor). The identification of causal mutations is extremely important for the correct diagnosis. Here, we report the case of a family affected from Palmoplantar keratoderma caused by autosomal dominant KRT1 mutations (Unna-Thost disease).Telomerase activation and hTERT expression take a part in the process of cell proliferation and inflammation and microRNAs, as microRNA-21, are emerging as drivers in the regulation of telomerase activity.Here, the patients underwent KRT1 analysis genetic sequence, telomerase activity and miR-21 expression. Beside histopathology assay was performed. The patients presented thickening of the skin on soles of the feet and the palms of the hands, KRT1mutations and showed high expression levels of hTERT and hTR, the gene encoding for the telomeric subunits, and miR-21 (fold change > 1.5 and p value = 0.043), explicating the aberrant proliferation of epidermal layer and the inflammatory state characterizing palmoplantar keratoderma.

Exploring genome-wide differentiation and signatures of selection in Italian and North American Holstein populations

Among Italian dairy cattle, the Holstein is the most reared breed for the production of Parmigiano Reggiano protected designation of origin cheese, which represents one of the most renowned products in the entire Italian dairy industry. In this work, we used a medium-density genome-wide data set consisting of 79,464 imputed SNPs to study the genetic structure of Italian Holstein breed, including the population reared in the area of Parmigiano Reggiano cheese production, and assessing its distinctiveness from the North American population. Multidimensional scaling and ADMIXTURE approaches were used to explore the genetic structure among populations. We also investigated putative genomic regions under selection among these 3 populations by combining 4 different statistical methods based either on allele frequencies (single marker and window-based) or extended haplotype homozygosity (EHH; standardized log-ratio of integrated EHH and cross-population EHH). The genetic structure results allowed us to clearly distinguish the 3 Holstein populations; however, the most remarkable difference was observed between Italian and North American stock. Selection signature analyses identified several significant SNPs falling within or closer to genes with known roles in several traits such as milk quality, resistance to disease, and fertility. In particular, a total of 22 genes related to milk production have been identified using the 2 allele frequency approaches. Among these, a convergent signal has been found in the VPS8 gene which resulted to be involved in milk traits, whereas other genes (CYP7B1, KSR2, C4A, LIPE, DCDC1, GPR20, and ST3GAL1) resulted to be associated with quantitative trait loci related to milk yield and composition in terms of fat and protein percentage. In contrast, a total of 7 genomic regions were identified combining the results of standardized log-ratio of integrated EHH and cross-population EHH. In these regions candidate genes for milk traits were also identified. Moreover, this was also confirmed by the enrichment analyses in which we found that the majority of the significantly enriched quantitative trait loci were linked to milk traits, whereas the gene ontology and pathway enrichment analysis pointed to molecular functions and biological processes involved in AA transmembrane transport and methane metabolism pathway. This study provides information on the genetic structure of the examined populations, showing that they are distinguishable from each other. Furthermore, the selection signature analyses can be considered as a starting point for future studies in the identification of causal mutations and consequent implementation of more practical application.

Optimization of long-range PCR protocol to prepare filaggrin exon 3 libraries for PacBio long-read sequencing

BackgroundThe filaggrin (FLG) protein, encoded by the FLG gene, is an intermediate filament-associated protein that plays a crucial role in the terminal stages of human epidermal differentiation. Loss-of-function mutations in the FLG exon 3 have been associated with skin diseases. The identification of causative mutations is challenging, due to the high sequence homology within its exon 3 (12,753 bp), which includes 10 to 12 filaggrin tandem repeats. With this study we aimed to obtain the whole FLG exon 3 sequence through PacBio technology, once 13-kb amplicons have been generated.Methods and resultsFor the preparation of SMRTbell libraries to be sequenced using PacBio technology, we focused on optimizing a 2-step long-range PCR protocol to generate 13-kb amplicons covering the whole FLG exon 3 sequence. The performance of three long-range DNA polymerases was assessed in an attempt to improve the PCR conditions required for the enzymes to function properly. We focused on optimization of the input template DNA concentration and thermocycling parameters to correctly amplify the entire FLG exon 3 sequence, minimizing non-specific amplification.ConclusionsTaken together, our findings suggested that the PrimeSTAR protocol is suitable for producing the amplicons of the 13-kb FLG whole exon 3 to prepare SMRTbell libraries. We suggest that sequencing the generated amplicons may be useful for identifying LoF variants that are causative of the patients’ disorders.

Overview of SERPING1 Variations Identified in Hungarian Patients With Hereditary Angioedema

BackgroundHereditary angioedema (HAE) due to C1-inhibitor (C1-INH) deficiency (C1-INH-HAE) is a rare autosomal dominant disorder, characterized by recurrent, unpredictable edematous symptoms involving subcutaneous, and/or submucosal tissue. C1-INH-HAE may be caused by more than 700 different mutations in the gene encoding C1-INH (SERPING1) that may lead to decreased protein synthesis or to functional deficiency.MethodsConcentrations of C1-INH, C4, C1q, and anti-C1-INH antibodies, as well as functional C1-INH activity were determined in subjects suffering from edematous symptoms and admitted to the Hungarian Angioedema Center of Reference and Excellence. In those patients, who were diagnosed with C1-INH-HAE based on the complement measurements, SERPING1 was screened by bidirectional sequencing following PCR amplification and multiplex ligation-dependent probe amplification. For detecting large deletions, long-range PCRs covering the entire SERPING1 gene by targeting 2–7 kb long regions were applied.ResultsAltogether 197 individuals with C1-INH deficiency belonging to 68 families were identified. By applying Sanger sequencing or copy number determination of SERPING1 exons, 48 different mutations were detected in 66/68 families: 5 large and 15 small insertions/deletions/delins, 16 missense, 6 nonsense, and 6 intronic splice site mutations. Two novel variations (p.Tyr199Ser [c.596A>C] and the duplication of exon 7) were shown to cosegregate with deficient C1-inhibitor level and activity, while two other variations were detected in single patients (c.797_800delinsCTTGGAGCTCAAGAACTTGGAGCT and c.812dup). A series of long PCRs was applied in the remaining 2 families without an identified mutation and a new, 2606 bp long deletion including the last 91 bp of exon 6 (c.939_1029+2515del) was identified in all affected members of one pedigree. In the remaining one family, a deep intronic SERPING1 variation (c.1029+384A>G) was detected by a targeted next-generation sequencing panel as reported previously.ConclusionsSequencing and copy number determination of SERPING1 exons uncover most pathogenic variants in C1-INH-HAE patients, and further methods are worth to be applied in cases with unrevealed genetic background. Since knowledge of the genetic background may support the establishment of the correct and early diagnosis of C1-INH-HAE, identification of causative mutations and reporting data supporting the interpretation on the pathogenicity of these variants is of utmost importance.

Predicting pathogenicity for novel hearing loss mutations based on genetic and protein structure approaches

Hearing loss is a heterogeneous disorder. Identification of causative mutations is demanding due to genetic heterogeneity. In this study, we investigated the genetic cause of sensorineural hearing loss in patients with severe/profound deafness. After the exclusion of GJB2-GJB6 mutations, we performed whole exome sequencing in 32 unrelated Argentinean families. Mutations were detected in 16 known deafness genes in 20 patients: ACTG1, ADGRV1 (GPR98), CDH23, COL4A3, COL4A5, DFNA5 (GSDDE), EYA4, LARS2, LOXHD1, MITF, MYO6, MYO7A, TECTA, TMPRSS3, USH2A and WSF1. Notably, 11 variants affecting 9 different non-GJB2 genes resulted novel: c.12829C > T, p.(Arg4277*) in ADGRV1; c.337del, p.(Asp109*) and c.3352del, p.(Gly1118Alafs*7) in CDH23; c.3500G > A, p.(Gly1167Glu) in COL4A3; c.1183C > T, p.(Pro395Ser) and c.1759C > T, p.(Pro587Ser) in COL4A5; c.580 + 2 T > C in EYA4; c.1481dup, p.(Leu495Profs*31) in LARS2; c.1939 T > C, p.(Phe647Leu), in MYO6; c.733C > T, p.(Gln245*) in MYO7A and c.242C > G, p.(Ser81*) in TMPRSS3 genes. To predict the effect of these variants, novel protein modeling and protein stability analysis were employed. These results highlight the value of whole exome sequencing to identify candidate variants, as well as bioinformatic strategies to infer their pathogenicity.

Abstract 11332: Integration of Protein Interactome Networks with Congenital Heart Disease Variants Reveals Candidate Disease Genes

Congenital heart disease (CHD) is present in 1% of live births, yet despite large-scale genomic sequencing efforts, identification of causal mutations remains a challenge. We hypothesized that genetic determinants for CHDs may lie in the protein interactomes of GATA4 and TBX5, two transcription factors whose mutation cause CHDs. Defining the GATA4 or TBX5 interactomes in human cardiac progenitors via affinity purification-mass spectrometry and integrating the results with genetic data from the Pediatric Cardiac Genomic Consortium revealed an enrichment of de novo variants associated with CHD. A consolidative score that prioritized interactome members based on variant, gene, and proband features identified likely CHD-causing genes, including the epigenetic reader GLYR1. GLYR1 and GATA4 widely co-occupied and co-activated cardiac developmental genes, and the GLYR1 missense variant identified disrupted interaction with GATA4 and impaired transcriptional co-regulation in cardiomyocyte differentiation in vitro and cardiogenesis in vivo. This integrative proteomic and genetic approach provides a framework for prioritizing and interrogating the contribution of genetic variants in disease.

Clinical exome sequencing facilitates the understanding of genetic heterogeneity in Leber congenital amaurosis patients with variable phenotype in southern India

BackgroundLeber congenital amaurosis (LCA), primarily characterized by retinal degeneration is the most severe form of inherited retinal dystrophy (IRD) responsible for congenital blindness. The presence of phenotypic heterogeneity makes the diagnosis of LCA challenging, especially in the absence of pronounced disease pathognomonic, yet it can be well comprehended by employing molecular diagnosis. Therefore, the present study aimed to reveal the causative mutations in ten LCA patients with variable phenotypes using clinical exome sequencing (CES).MethodsCES was performed in ten unrelated LCA patients. Ophthalmic information and family history of all patients were obtained to make a meaningful interpretation. The clinical exome data was analyzed and prioritized using a bioinformatics pipeline to identify mutations, which was further validated by Sanger sequencing. Segregation analysis was also performed on available family members.ResultsCES led to the identification of causative mutations in nine LCA patients. Seven patients harbored a mutation in six LCA candidate genes, including RPE65, LCA5 (n = 2), CRX, PRPH2, CEP290, and ALMS1, while two patients possess a mutation in IFT80 and RP1, known to cause other diseases. Three novel mutations in LCA5 (c.1823del), CRX (c.848del) and CEP290 (c.2483G > T) were identified. The current study reports for the first time, a mutation in PRPH2, CEP290, and ALMS1 from the Indian population. Additionally, we observed a novel association of LCA phenotype with IFT80 known to cause Jeune syndrome. Based on the genetic finding, the patient AS09, who harbored a mutation in the RP1 gene, was re-diagnosed with early-onset retinitis pigmentosa.ConclusionIn conclusion, the results underline the importance of CES in clinically diagnosed LCA patients with variable phenotypes. The correlation between mutations in candidate genes and clinical phenotypes, helps to refine the clinical diagnosis. However, molecular evaluation with a larger cohort of LCA patients is needed for better understanding of the mutational spectrum in southern India.

Exploring the Hereditary Nature of Migraine.

Migraine is a common neurological disorder which affects 15–20% of the population; it has a high socioeconomic impact through treatment and loss of productivity. Current forms of diagnosis are primarily clinical and can be difficult owing to comorbidity and symptom overlap with other neurological disorders. As such, there is a need for better diagnostic tools in the form of genetic testing. Migraine is a complex disorder, encompassing various subtypes, and has a large genetic component. Genetic studies conducted on rare monogenic subtypes, including familial hemiplegic migraine, have led to insights into its pathogenesis via identification of causal mutations in three genes (CACNA1A, ATP1A2 and SCN1A) that are involved in transport of ions at synapses and glutamatergic transmission. Study of familial migraine with aura pedigrees has also revealed other causal genes for monogenic forms of migraine. With respect to the more common polygenic form of migraine, large genome-wide association studies have increased our understanding of the genes, pathways and mechanisms involved in susceptibility, which are largely involved in neuronal and vascular functions. Given the preponderance of female migraineurs (3:1), there is evidence to suggest that hormonal or X-linked components can also contribute to migraine, and the role of genetic variants in mitochondrial DNA in migraine has been another avenue of exploration. Epigenetic studies of migraine have shown links between hormonal variation and alterations in DNA methylation and gene expression. While there is an abundance of preliminary studies identifying many potentially causative migraine genes and pathways, more comprehensive genomic and functional analysis to better understand mechanisms may aid in better diagnostic and treatment outcomes.

The role of multimodal imaging and vision function testing in ABCA4-related retinopathies and their relevance to future therapeutic interventions.

The aim of this review article is to describe the specific features of Stargardt disease and ABCA4 retinopathies (ABCA4R) using multimodal imaging and functional testing and to highlight their relevance to potential therapeutic interventions. Standardised measures of tissue loss, tissue function and rate of change over time using formal structured deep phenotyping in Stargardt disease and ABCA4R are key in diagnosis, and prognosis as well as when selecting cohorts for therapeutic intervention. In addition, a meticulous documentation of natural history will be invaluable in the future to compare treated with untreated retinas. Despite the familiarity with the term Stargardt disease, this eponymous classification alone is unhelpful when evaluating ABCA4R, as the ABCA4 gene is associated with a number of phenotypes, and a range of severity. Multimodal imaging, psychophysical and electrophysiologic measurements are necessary in diagnosing and characterising these differing retinopathies. A wide range of retinal dystrophy phenotypes are seen in association with ABCA4 mutations. In this article, these will be referred to as ABCA4R. These different phenotypes and the existence of phenocopies present a significant challenge to the clinician. Careful phenotypic characterisation coupled with the genotype enables the clinician to provide an accurate diagnosis, associated inheritance pattern and information regarding prognosis and management. This is particularly relevant now for recruiting to therapeutic trials, and in the future when therapies become available. The importance of accurate genotype-phenotype correlation studies cannot be overemphasised. This approach together with segregation studies can be vital in the identification of causal mutations when variants in more than one gene are being considered as possible. In this article, we give an overview of the current imaging, psychophysical and electrophysiological investigations, as well as current therapeutic research trials for retinopathies associated with the ABCA4 gene.

Genome-wide association study identifies quantitative trait loci regions involved in muscle acidic profile in Large White heavy pigs

The widespread use of genome-wide association studies resulted in the discovery of genomic regions associated with fatty acid (FA) composition in different porcine tissues, but little information exists about the genes involved in FA composition of meat obtained from heavy pigs selected for the production of Italian dry-cured hams. To this objective, we genotyped with a single nucleotide polymorphism (SNP) panel 795 Italian Large White heavy pigs to identify the markers and genomic regions associated with Semimembranosus muscle FA profile. Heritability estimates for intramuscular fat FA profile were of low-to-moderate magnitude, suggesting that these traits may be improved with genomic selection. On the whole, 45 SNPs were significantly associated with 14 FAs, and 4 of them (ALGA008109, ALGA0081097, CASI0010164 and SIRI0000267) were associated with more than 1 FA. The palmitoleic : palmitic and oleic : stearic ratios displayed the highest number of significant markers and the most significant associations (Bonferroni adjusted P < 5.00E−07). Of particular interest, the palmitoleic : palmitic ratio was strongly associated with markers located at 111 to 114 Mb on chromosome 14, in the same chromosomal region where Stearoyl-CoA desaturase Δ9 (SCD) gene is located. Several significant chromosomal regions were found; some of them harbour key genes playing pivotal roles in FA desaturation and elongation, such as SCD and some members of the Elongation of Very Long-Chain FA (ELOVL) gene family. The results suggest that the identification of causal mutations in these regions may provide a set of markers useful for selection schemes aimed at improving FA composition in pork products.

Hereditary xerocytosis - spectrum and clinical manifestations of variants in the PIEZO1 gene, including co-occurrence with a novel β-globin mutation

Hereditary xerocytosis (HX) is a rare, autosomal dominant congenital hemolytic anemia (CHA) characterized by erythrocyte dehydration with presentation of various degrees of hemolytic anemia. HX is often misdiagnosed as hereditary spherocytosis or other CHA. Here we report three cases of suspected HX and one case of HX associated with β-thalassemia.Sanger method was used for sequencing cDNA of the PIEZO1 gene. Variants were evaluated for potential pathogenicity by MutationTaster, PROVEAN, PolyPhen-2 and M-CAP software, and by molecular modeling.Four different variants in the PIEZO1 gene were found, including three substitutions (p.D669H, p.D1566G, p.T1732 M) and one deletion (p.745delQ). In addition, in the patient with the p.T1732 M variant we detected a 12-nucleotide deletion in the β-globin gene leading to a deletion of amino acids 62AHGK65. The joint presence of mutations in two different genes connected with erythrocytes markedly aggravated the presentation of the disease. Bioinformatic analysis and molecular modeling strongly indicated likely deleterious effects of all four PIEZO1 variants, but co-segregation analysis showed that the p.D1566G substitution is in fact non-pathogenic.Identification of causative mutations should improve the diagnosis and management of HX and provide a new insight into the molecular basis of this complex red blood cell abnormality.

Genome wide analysis of infectious salmon anemia resistance in commercial Saint John River Atlantic salmon

Infectious salmon anemia (ISA) is an economically costly viral disease to the global Atlantic salmon aquaculture industry due to the high virulence and high mortality rate. Selective breeding for disease resistance traits using genomic information has been suggested to increase the resistance to various diseases in the breeding population. The aim of this study was to perform a genome wide association (GWA) analysis to identify regions of the genome associated with ISA resistance in the commercial Saint John River population. A total of 2233 parr from 72 families from the 2015 year class were challenged with ISA using a cohabitation trial. The heritability of ISA resistance was 0.16 ± 0.04 on the observed scale for the binary trait of ISA survival at 50% mortality of all cohabitating fish. Binary phenotypes were recorded for all fish with those that survived the challenge being classified as resistant and those that died being classified as susceptible. Selective genotyping using a custom North American 50 K SNP chip was performed by choosing, where possible, four resistant fish and four susceptible fish from each challenged family (n = 572). After quality control a total of 547 fish and 38,954 SNP markers remained for GWA analysis. Two survival traits were analyzed for the genotyped fish: ‘survival to day 37’ when mortality had reached 50% and ‘survival at trial termination’ on day 54. Two SNPs on Ssa03 and on Ssa07 were significant associated with ‘survival to day 37’ but only at the chromosome wide level. More notably nine significant SNPs on nine different chromosomes, were significantly associated with ‘survival at trial termination’ at the genome wide level. The most significant SNP, on Ssa13, explained 8.6% of the phenotypic variation, while SNPs on Ssa12 and Ssa11 explained 7.6% and 6.4% respectively. The remaining six SNPs explained between 4 and 6% of the phenotypic variation, indicating oligogenic architecture of the ‘survival at trial termination’ trait. A total of 33 genes known to be differentially expressed during infection with ISA were located downstream on the same chromosome arm of the nine significant SNPs. Identification of causal mutations is not necessary to implement genomic information into selective breeding programs but improves understanding of the genetic basis of ISA resistance.

Genetic diagnosis and prenatal diagnosis of autosomal dominant polycystic kidney disease

To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD). Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family. Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband. Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.

Bi-allelic Loss-of-Function CACNA1B Mutations in Progressive Epilepsy-Dyskinesia

The occurrence of non-epileptic hyperkinetic movements in the context of developmental epileptic encephalopathies is an increasingly recognized phenomenon. Identification of causative mutations provides an important insight into common pathogenic mechanisms that cause both seizures and abnormal motor control. We report bi-allelic loss-of-function CACNA1B variants in six children from three unrelated families whose affected members present with a complex and progressive neurological syndrome. All affected individuals presented with epileptic encephalopathy, severe neurodevelopmental delay (often with regression), and a hyperkinetic movement disorder. Additional neurological features included postnatal microcephaly and hypotonia. Five children died in childhood or adolescence (mean age of death: 9 years), mainly as a result of secondary respiratory complications. CACNA1B encodes the pore-forming subunit of the pre-synaptic neuronal voltage-gated calcium channel Cav2.2/N-type, crucial for SNARE-mediated neurotransmission, particularly in theearly postnatal period. Bi-allelic loss-of-function variants in CACNA1B are predicted to cause disruption of Ca2+ influx, leading to impaired synaptic neurotransmission. The resultant effect on neuronal function is likely to be important in the development of involuntary movements and epilepsy. Overall, our findings provide further evidence for the key role of Cav2.2 in normal human neurodevelopment.

From Genotype to Phenotype: Through Chromatin.

Advances in sequencing technologies have enabled the exploration of the genetic basis for several clinical disorders by allowing identification of causal mutations in rare genetic diseases. Sequencing technology has also facilitated genome-wide association studies to gather single nucleotide polymorphisms in common diseases including cancer and diabetes. Sequencing has therefore become common in the clinic for both prognostics and diagnostics. The success in follow-up steps, i.e., mapping mutations to causal genes and therapeutic targets to further the development of novel therapies, has nevertheless been very limited. This is because most mutations associated with diseases lie in inter-genic regions including the so-called regulatory genome. Additionally, no genetic causes are apparent for many diseases including neurodegenerative disorders. A complementary approach is therefore gaining interest, namely to focus on epigenetic control of the disease to generate more complete functional genomic maps. To this end, several recent studies have generated large-scale epigenetic datasets in a disease context to form a link between genotype and phenotype. We focus DNA methylation and important histone marks, where recent advances have been made thanks to technology improvements, cost effectiveness, and large meta-scale epigenome consortia efforts. We summarize recent studies unravelling the mechanistic understanding of epigenetic processes in disease development and progression. Moreover, we show how methodology advancements enable causal relationships to be established, and we pinpoint the most important issues to be addressed by future research.

An exonic splicing enhancer mutation in DUOX2 causes aberrant alternative splicing and severe congenital hypothyroidism in Bama pigs.

ABSTRACTPigs share many similarities with humans in terms of anatomy, physiology and genetics, and have long been recognized as important experimental animals in biomedical research. Using an N-ethyl-N-nitrosourea (ENU) mutagenesis screen, we previously identified a large number of pig mutants, which could be further established as human disease models. However, the identification of causative mutations in large animals with great heterogeneity remains a challenging endeavor. Here, we select one pig mutant, showing congenital nude skin and thyroid deficiency in a recessive inheritance pattern. We were able to efficiently map the causative mutation using family-based genome-wide association studies combined with whole-exome sequencing and a small sample size. A loss-of-function variant (c.1226 A>G) that resulted in a highly conserved amino acid substitution (D409G) was identified in the DUOX2 gene. This mutation, located within an exonic splicing enhancer motif, caused aberrant splicing of DUOX2 transcripts and resulted in lower H2O2 production, which might cause a severe defect in thyroid hormone production. Our findings suggest that exome sequencing is an efficient way to map causative mutations and that DUOX2D409G/D409G mutant pigs could be a potential large animal model for human congenital hypothyroidism.

Development of a Pedigreed Sorghum Mutant Library.

Induced mutagenesis is a powerful approach to generate variations for elucidation of gene function and to create new traits for breeding. Here, we described a procedure to develop a pedigreed mutant library through chemical mutagenesis with ethylmethane sulfonate (EMS) treated seeds in sorghum and discussed its potential to generate new traits for sorghum improvement. Unlike random mutagenesis, a pedigreed mutant library, once properly established, can serve as a powerful resource to isolate and recover mutations of both agronomical and biological importance. With the development of affordable and high-throughput next-generation sequencing technologies, identification of causal mutations from a mutant library with a uniform genetic background becomes increasingly efficient and cost-effective. Fast causal gene discovery from mutant libraries combined with precise genome editing techniques will accelerate incorporation of new traits and revolutionize crop breeding.

News about the genetics of congenital primary adrenal insufficiency

Primary adrenal insufficiency (PAI) is characterized by impaired production of steroid hormones due to an adrenal cortex defect. This condition incurs a risk of acute insufficiency which may be life-threatening. Today, 80% of pediatric forms of PAI have a genetic origin but 5% have no clear genetic support. Recently discovered mutations in genes relating to oxidative stress have opened the way to research on genes unrelated to the adrenal gland. Identification of causal mutations in a gene responsible for PAI allows genetic counseling, guidance of follow-up and prevention of complications. This is particularly true for stress oxidative anomalies, as extra-adrenal manifestations may occur due to the sensitivity to oxidative stress of other organs such as the heart, thyroid, liver, kidney and pancreas.