Hunter Syndrome Patients Research Articles

A phase III clinical trial of GC1111 as an enzyme replacement therapy in previously untreated mucopolysaccharidosis type II (Hunter syndrome) patients: A double-blind, randomized, active-controlled (part 1) and open-labeled, historical placebo-controlled (part 2) study

A phase III clinical trial of GC1111 as an enzyme replacement therapy in previously untreated mucopolysaccharidosis type II (Hunter syndrome) patients: A double-blind, randomized, active-controlled (part 1) and open-labeled, historical placebo-controlled (part 2) study

Clinical assessment of upper airway and its complications in Hunter syndrome.

Hunter syndrome (HS) is an X-linked, recessive, lysosomal storage disease caused by a deficiency of the lysosomal enzyme, iduronate sulfatase (IDS). It is characterized by multisystem accumulations of glycosaminoglycans and upper airway obstruction is one of the major causes of death. While the current disease severity classifications for HS are mainly based on the degree of neurocognitive impairment, its association with the level of upper airway obstruction has not been assessed. A retrospective chart review of HS patients who were followed at the Jikei University School of Medicine was performed. Association between the degree of airway obstruction and the currently used disease severity scores was evaluated. We identified eight HS patients and they were enrolled in the study. The Modified Mallampati classification (MMC) score, used to predict difficulties for oropharyngeal procedures, was significantly correlated with the HS severity. It was also correlated with the Apnea-Hypopnea Index (AHI). No significant correlation between IDS enzymatic activity and the severity of HS disease was identified. Variable clinical expressivities exist in HS, but the risk of respiratory complications is likely to be associated with disease severity, assessed by the previously recognized neurocognitive function-based severity scoring systems. MMC can be a simple supplementary tool to evaluate disease severity as well as predict difficulties for oropharyngeal procedures and respiratory function complications in HS, such as sleep apnea.

Clinical experience of replacing enzyme replacement therapy in a patient with mucopolysaccharidosis type II

Mucopolysaccharidosis type II (MPS II, Hunter syndrome) is an inherited chronic progressive lysosomal disease associated with recessive X-linked inheritance. MPS II is classified as an orphan disease and occurs at a rate of 1.3 per 100,000 white boys. Hunter syndrome is the most common type of mucopolysaccharidosis, accounting for about 50% of MPS types. The diseases pathogenesis is based on a violation of the stepwise cleavage of glycosaminoglycans (GAG) heparansulfate and dermatansulfate caused by a deficiency of the iduronate-2-sulfatase enzyme encoded by theIDSgene. The existing deficiency or complete absence of iduronate-2-sulfatase leads to a violation of the final stage of glycosaminoglycan catabolism and the accumulation heparansulfate and dermatansulfate in all organs and tissues. Currently, there are two drugs registered in the Russian Federation for pathogenetic enzyme replacement therapy of MPS: idursulfase and idursulfase beta. This refers to the expansion of the therapeutic options for Hunter syndrome patients in the event of severe adverse events. It allows choosing the treatment regimen that will be optimal for the patient and will significantly improve the quality of life. In this article, the authors share their own experience of changing enzyme replacement therapy in an MPS II child patient.

In vitrorecapitulation of the site-specific editing (to wild-type) of mutantIDSmRNA transcripts, and the characterization of IDS protein translated from the edited mRNAs

The transfer of genomic information into the primary RNA sequence can be altered by RNA editing. We have previously shown that genomic variants can be RNA-edited to wild-type. The presence of distinct "edited" iduronate 2-sulfatase (IDS) mRNA transcripts ex vivo evidenced the correction of a nonsense and frameshift variant, respectively, in three unrelated Hunter syndrome patients. This phenomenon was confirmed in various patient samples by a variety of techniques, and was quantified by single-nucleotide primer extension. Western blotting also confirmed the presence of IDS protein similar in size to the wild-type. Since preliminary experimental evidence suggested that the "corrected" IDS proteins produced by the patients were similar in molecular weight and net charge to their wild-type counterparts, an in vitro system employing different cell types was established to recapitulate the site-specific editing of IDS RNA (uridine to cytidine conversion and uridine deletion), and to confirm the findings previously observed ex vivo in the three patients. In addition, confocal microscopy and flow cytometry analyses demonstrated the expression and lysosomal localization in HEK293 cells of GFP-labeled proteins translated from edited IDS mRNAs. Confocal high-content analysis of the two patients' cells expressing wild-type or mutated IDS confirmed lysosomal localization and showed no accumulation in the Golgi or early endosomes.

Biodistribution of Idursulfase Formulated for Intrathecal Use (Idursulfase-IT) in Cynomolgus Monkeys after Intrathecal Lumbar Administration

Enzyme replacement therapy with intravenous idursulfase (recombinant iduronate-2-sulfatase) is approved for the treatment of Hunter syndrome. Intravenous administration does not, however, treat the neurological manifestations, due to its low central nervous system bioavailability. Using intrathecal-lumbar administration, iduronate-2-sulfatase is delivered directly to the central nervous system. This study investigates the central nervous system biodistribution of intrathecal-lumbar administered iduronate-2-sulfatase in cynomolgus monkeys. Twelve monkeys were administered iduronate-2-sulfatase in one 30 mg intrathecal-lumbar injection. Brain, spinal cord, liver, and kidneys were collected for iduronate-2-sulfatase concentration (measured by an enzyme linked immunosorbent assay) and enzyme activity measurement (via a method utilizing 4-methylumbelliferyl-α-iduronate-2-sulfate) at 1, 2, 5, 12, 24, and 48 hours following administration. The tissue enzyme linked immunosorbent assay confirmed iduronate-2-sulfatase uptake to the brain, spinal cord, kidneys, and liver in a time-dependent manner. In spinal cord and brain, iduronate-2-sulfatase appeared as early as 1 hour following administration, and peak concentrations were observed at ~2 and ~5 hours. Iduronate-2-sulfatase appeared in liver and kidneys 1 hour post intrathecal-lumbar dose with peak concentrations between 5 and 24 hours. Liver iduronate-2-sulfatase concentration was approximately 10-fold higher than kidney. The iduronate-2-sulfatase localization and enzyme activity in the central nervous system, following intrathecal administration, demonstrates that intrathecal-lumbar treatment with iduronate-2-sulfatase may be considered for further investigation as a treatment for Hunter syndrome patients with neurocognitive impairment.

CNS-directed gene therapy for the treatment of neurologic and somatic mucopolysaccharidosis type II (Hunter syndrome)

Mucopolysaccharidosis type II (MPSII) is an X-linked lysosomal storage disease characterized by severe neurologic and somatic disease caused by deficiency of iduronate-2-sulfatase (IDS), an enzyme that catabolizes the glycosaminoglycans heparan and dermatan sulphate. Intravenous enzyme replacement therapy (ERT) currently constitutes the only approved therapeutic option for MPSII. However, the inability of recombinant IDS to efficiently cross the blood-brain barrier (BBB) limits ERT efficacy in treating neurological symptoms. Here, we report a gene therapy approach for MPSII through direct delivery of vectors to the CNS. Through a minimally invasive procedure, we administered adeno-associated virus vectors encoding IDS (AAV9-Ids) to the cerebrospinal fluid of MPSII mice with already established disease. Treated mice showed a significant increase in IDS activity throughout the encephalon, with full resolution of lysosomal storage lesions, reversal of lysosomal dysfunction, normalization of brain transcriptomic signature, and disappearance of neuroinflammation. Moreover, our vector also transduced the liver, providing a peripheral source of therapeutic protein that corrected storage pathology in visceral organs, with evidence of cross-correction of nontransduced organs by circulating enzyme. Importantly, AAV9-Ids-treated MPSII mice showed normalization of behavioral deficits and considerably prolonged survival. These results provide a strong proof of concept for the clinical translation of our approach for the treatment of Hunter syndrome patients with cognitive impairment.

Levels of glycosaminoglycans in the cerebrospinal fluid of healthy young adults, surrogate-normal children, and Hunter syndrome patients with and without cognitive impairment

In mucopolysaccharidoses (MPS), glycosaminoglycans (GAG) accumulate in tissues. In MPS II, approximately two-thirds of patients are cognitively impaired. We investigated levels of GAG in cerebrospinal fluid (CSF) in different populations from four clinical studies (including NCT00920647 and NCT01449240). Data indicate that MPS II patients with cognitive impairment have elevated levels of CSF GAG, whereas those with the attenuated phenotype typically have levels falling between those of the cognitively affected patients and healthy controls.

Antibody response to investigational intrathecal enzyme replacement therapy with idursulfase-IT in pediatric Hunter syndrome patients with cognitive impairment

Antibody response to investigational intrathecal enzyme replacement therapy with idursulfase-IT in pediatric Hunter syndrome patients with cognitive impairment

Safety and efficacy of enzyme replacement therapy with idursulfase beta in children aged younger than 6 years with Hunter syndrome

Idursulfase beta (Hunterase®) has been used for enzyme replacement therapy (ERT) of patients with mucopolysaccharidosis II (MPS II, Hunter syndrome) aged 6years or older since 2012 in Korea. The objective of this study was to evaluate the safety and efficacy of ERT with idursulfase beta in Hunter syndrome children younger than 6years. This study was a 52-week, single center, single arm, open-label clinical trial (NCT01645189). Idursulfase beta (0.5mg/kg/week) was administered intravenously for 52weeks. The primary endpoint was safety assessed by adverse events (AEs). Secondary endpoints included vital signs, physical examination, ECG, laboratory tests, anti-idursulfase antibodies, and efficacy represented by changes in urinary glycosaminoglycan (GAG) at week 53 from baseline. In addition, growth indices and developmental milestones (Denver II test) were evaluated as exploratory variables. All six patients experienced at least one AE. A total of 109 AEs were reported. One patient experienced a serious AE (hospitalization due to gastroenteritis) that was considered not to be treatment related. One patient (16.7%) experienced infusion-related adverse drug reactions (ADRs), developing urticaria six times and a cough five times. There were no serious ADRs and no clinically significant changes in vital signs, physical exam, laboratory parameters, or ECG. Of the six patients, four (66.7%) showed anti-idursulfase antibodies and neutralizing antibodies on at least one occasion during the study. At week 53, urinary GAG was significantly reduced by −35.1±30.6mgGAG/g creatine from baseline (P=0.038). This study indicates that the safety and efficacy of idursulfase beta are similar to those reported in Hunter syndrome patients aged 6years or older.

A biochemical and physicochemical comparison of two recombinant enzymes used for enzyme replacement therapies of hunter syndrome.

Mucopolysaccharidosis II (MPS II, Hunter syndrome; OMIM 309900) is an X-linked lysosomal storage disease caused by a deficiency in the enzyme iduronate-2-sulfatase (IDS), leading to accumulation of glycosaminoglycans (GAGs). For enzyme replacement therapy (ERT) of Hunter syndrome, two recombinant enzymes, idursulfase (Elaprase(®), Shire Human Genetic Therapies, Lexington, MA) and idursulfase beta (Hunterase(®), Green Cross Corporation, Yongin, Korea), are currently available in Korea. To compare the biochemical and physicochemical differences between idursulfase and idursulfase beta, we examined the formylglycine (FGly) content, specific enzyme activity, mannose-6-phosphate (M6P) content, sialic acid content, and in vitro cell uptake activity of normal human fibroblasts of these two enzymes.The FGly content, which determines the enzyme activity, of idursulfase beta was significantly higher than that of idursulfase (79.4 ± 0.9 vs. 68.1 ± 2.2 %, P < 0.001). In accordance with the FGly content, the specific enzyme activity of idursulfase beta was significantly higher than that of idursulfase (42.6 ± 1.1 vs. 27.8 ± 0.9 nmol/min/μg protein, P < 0.001). The levels of M6P and sialic acid were not significantly different (2.4 ± 0.1 vs 2.4 ± 0.3 mol/mol protein for M6P and 12.3 ± 0.7 vs. 12.4 ± 0.4 mol/mol protein for sialic acid). However, the cellular uptake activity of the normal human fibroblasts in vitro showed a significant difference (Kuptake, 5.09 ± 0.96 vs. 6.50 ± 1.28 nM protein, P = 0.017).In conclusion, idursulfase beta exhibited significantly higher specific enzyme activity than idursulfase, resulting from higher FGly content. These biochemical differences may be partly attributed to clinical efficacy. However, long-term clinical evaluations of Hunter syndrome patients treated with these two enzymes will be needed to demonstrate the clinical implications of significant difference of the enzyme activity and the FGly content.

Levels of glycosaminoglycans in the cerebrospinal fluid of healthy young adults, surrogate-normal children, and Hunter syndrome patients with and without cognitive impairment

Levels of glycosaminoglycans in the cerebrospinal fluid of healthy young adults, surrogate-normal children, and Hunter syndrome patients with and without cognitive impairment

A multicenter, open-label study evaluating safety and clinical outcomes in children (1.4–7.5 years) with Hunter syndrome receiving idursulfase enzyme replacement therapy

Purpose:The primary objective of this study was to determine the safety of idursulfase in Hunter syndrome patients aged 5 years or younger.Methods:Idursulfase (0.5 mg/kg) was administered intravenously on a weekly basis (52 infusions per patient) in an open-label study. Safety monitoring included adverse events, anti-idursulfase antibodies, vital signs, physical examination, 12-lead electrocardiogram, concomitant medications or procedures, and laboratory testing (clinical chemistry, hematology, and urinalysis). The following exploratory efficacy outcomes were assessed at baseline and at weeks 18 or 36 or 53: urinary glycosaminoglycan levels, liver or spleen size, developmental milestones, and growth indices. Pharmacokinetic parameters were assessed at week 27.Results:Twenty-eight boys aged 1.4–7.5 years were enrolled (one discontinued for noncompliance) in the study. All the patients reported adverse events (16 patients (57%) reported possibly or probably treatment-related adverse events). The only severe adverse event was sleep apnea (two patients); others were mild or moderate. Sixteen patients had infusion-related adverse events, a similar proportion as previously reported. Thirteen patients (46%) experienced at least one serious adverse event: pyrexia and bronchopneumonia were the most common (three patients each). No clinically important drug-related changes in laboratory parameters or vital signs or electrocardiograms were reported. Nineteen patients (68%) developed anti-idursulfase immunoglobulin G antibodies. Growth rates remained within normal age-related ranges. Developmental quotients were lower than normal but remained stable. By week 18, organ size and urinary glycosaminoglycan levels decreased as compared with baseline and remained stable throughout the study.Conclusion:Idursulfase safety, tolerability, and efficacy were similar to that previously reported in males ≥5 years.

A study of the relationship between clinical phenotypes and plasma iduronate-2-sulfatase enzyme activities in Hunter syndrome patients

PurposeMucopolysaccharidosis type II (MPS II or Hunter syndrome) is a rare lysosomal storage disorder caused by iduronate-2-sulfatase (IDS) deficiency. MPS II causes a wide phenotypic spectrum of symptoms ranging from mild to severe. IDS activity, which is measured in leukocyte pellets or fibroblasts, was reported to be related to clinical phenotype by Sukegawa-Hayasaka et al. Measurement of residual plasma IDS activity using a fluorometric assay is simpler than conventional measurements using skin fibroblasts or peripheral blood mononuclear cells. This is the first study to describe the relationship between plasma IDS activity and clinical phenotype of MPS II.MethodsWe hypothesized that residual plasma IDS activity is related to clinical phenotype. We classified 43 Hunter syndrome patients as having attenuated or severe disease types based on clinical characteristics, especially intellectual and cognitive status. There were 27 patients with the severe type and 16 with the attenuated type. Plasma IDS activity was measured by a fluorometric enzyme assay using 4-methylumbelliferyl-α-iduronate 2-sulphate.ResultsPlasma IDS activity in patients with the severe type was significantly lower than that in patients with the attenuated type (P=0.006). The optimal cut-off value of plasma IDS activity for distinguishing the severe type from the attenuated type was 0.63 nmol·4 hr-1·mL-1. This value had 88.2% sensitivity, 65.4% specificity, and an area under receiver-operator characteristics (ROC) curve of 0.768 (ROC curve analysis; P=0.003).ConclusionThese results show that the mild phenotype may be related to residual lysosomal enzyme activity.

High prevalence of carpal tunnel syndrome in children with mucopolysaccharidosis type II (Hunter syndrome)

Although carpal tunnel syndrome (CTS) is the most common compressive neuropathy seen in the upper extremity of adults, it is rarely seen in children. Several reports have shown that mucopolysaccharidosis type II (Hunter syndrome), a rare genetic disorder, is one of the causes of CTS in children. Usual symptoms of CTS are pain, weakness, and paresthesias in the hand and digits. However, the diagnosis of CTS in Hunter syndrome is often delayed or unrecognized because of atypical symptoms and cognitive impairment. Here, we report the prevalence, clinical manifestation, and nerve conduction profiles of CTS in 45 Hunter syndrome patients. The mean age of the study participants was 117.1 (74.9) months (range: 4-408 months); all patients were male. Forty-three (96.0%) of the 45 patients with Hunter syndrome had CTS. Bilateral CTS was observed in all patients; 73 (82.0%) of the patients' hands had severe degree of CTS. Intriguingly, in contrast with other nerve velocities, decreases in forearm conduction velocities of the median nerve were observed in 28 (31.5%) of 89 hands with CTS. There was a significant difference in age (P < 0.001) between hands with normal, mild, moderate, and severe grades of CTS. The compound muscle action potential and sensory nerve action potential amplitudes of the median nerves decreased with age (CMAP, r = -0.526, P < 0.001; SNAP, r = -0.564, P < 0.001). Early recognition and intervention to ameliorate the symptoms of CTS are important in improving the quality of life of Hunter syndrome patients.

A mother and daughter with the p.R443X mutation of mucopolysaccharidosis type II: Genotype and phenotype analysis

Mucopolysaccharidosis type II (Hunter syndrome) is a lysosomal storage disease caused by a deficiency of iduronate-2-sulfatase. Most reported patients are males because of X-linked recessive inheritance pattern. Only a few female patients with Hunter syndrome have been reported, and there is no prior report of offspring from a patient with Hunter syndrome. In this report, we describe a woman with mild manifestations of Hunter syndrome who gave birth to a daughter. Both the mother and daughter carried the p.R443X mutation in exon 9 of the ID2S gene. Iduronate-2-sulfatase activity in the mother was as low as that found in male Hunter syndrome patients, but it was in the low-normal range in her daughter. Unlike her mother, the daughter did not show any physical signs of Hunter syndrome, and urinary excretion of glycosaminoglycan was within normal range. However, she had severe pulmonary vein stenosis with pulmonary hypertension and a large atrial septal defect and died at 11 months of age.

Enigmatic In Vivo iduronate-2-sulfatase (IDS) mutant transcript correction to wild-type in Hunter syndrome

Sequence analysis of the X-linked iduronate-2-sulfatase (IDS) gene in two Hunter syndrome patients revealed a lack of concordance between IDS genomic DNA and cDNA. These individuals were found to be hemizygous respectively for a nonsense mutation [c.22C>T;p.R8X] and a frameshift micro-insertion [c.10insT;p.P4Sfs] in their genomic DNA. However, both wild-type and mutant IDS sequences were evident upon cDNA analysis. Similar discrepant results were also obtained in a third unrelated patient carrying the same p.R8X mutation. Since both p.R8X mutations were inherited from carrier mothers, somatic mosaicism could be excluded. Although the presence of wild-type IDSmRNA-transcripts was confirmed in all three patients by restriction enzyme digestion, clone sequencing, pyrosequencing and single nucleotide primer extension (SNuPE), no wild-type IDS genomic sequence was detectable. The relative abundance of wild-type and mutation-bearing IDS-transcripts in different tissues was quantified by SNuPE. Although IDS transcript levels, as measured by real-time PCR, were reduced (51-71% normal) in these patients, some wild-type IDS protein was detectable by western blotting. Various possible explanations for these unprecedented findings (e.g. accidental contamination, artefactual in vitro nucleotide misincorporation, malsegregation of an extra maternal X-chromosome) were explored and experimentally excluded. PCR-based discriminant assay and segregation analysis of a linked IDS polymorphism (rs1141608) also served to exclude the presence of IDS cDNA derived from the maternal wild-type chromosome. Although it remains to be formally demonstrated by direct experimentation, the intriguing possibility arises that we have observed the in vivo correction of heritable gene lesions at the RNA level operating via a correction mechanism akin to RNA-editing. (c) 2010 Wiley-Liss, Inc.

Differences in methylation patterns in the methylation boundary region of IDS gene in hunter syndrome patients: implications for CpG hot spot mutations

Hunter syndrome, an X-linked disorder, results from deficiency of iduronate-2-sulfatase (IDS). Around 40% of independent point mutations at IDS were found at CpG sites as transitional events. The 15 CpG sites in the coding sequences of exons 1 and 2, which are normally hypomethylated, account for very few of transitional mutations. By contrast, the CpG sites in the coding sequences of exon 3, though also normally hypomethylated, account for much higher fraction of transitional mutations. To better understand relationship between methylation status and CpG transitional mutations in this region, the methylation patterns of 11 Hunter patients with transitional mutations at CpG sites were investigated using bisulfite genomic sequencing. The patient cohort mutation spectrum is composed of one mutation in exon 1 (one patient) and three different mutations in exon 3 (10 patients). We confirmed that in normal males, cytosines at the CpG sites from the promoter region to a portion of intron 3 were hypomethylated. However, specific CpG sites in this area were more highly methylated in patients. The patients with p.R8X (exon 1), p.P86L (exon 3), and p.R88H (exon 3) mutations had a hypermethylated condition in exon 2 to intron 3 but retained hypomethylation in exon 1. The same trend was found in four patients with p.A85T (exon 3), although the degree of hypermethylation was less. These findings suggest methylation patterns in the beginning of IDS genomic region are polymorphic in humans and that hypermethylation in this region in some individuals predisposes them to CpG mutations resulting in Hunter syndrome.

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

Identification of 9 novel IDS gene mutations in 19 unrelated Hunter syndrome (mucopolysaccharidosis Type II) patients. Mutations in brief no. 202. Online.

Hunter syndrome is an X-linked lysosomal storage disorder caused by a deficiency of the lysosomal enzyme iduronate-2-sulfatase (IDS). The IDS deficiency can be caused by several different types of mutations in the IDS gene. We have performed a molecular and mutation analysis of a total 19 unrelated MPS II patients of different ethnic origin and identified 19 different IDS mutations, 9 of which were novel and unique. SSCP analysis followed by DNA sequencing revealed four novel missense mutations: S143F, associated with the 562C-->T polymorphism, C184W, D269V and Y348H. Two novel nonsense mutations were found: Y103X (433C-->A) and Y234X (826C-->G). In two patients two novel minor insertions (42linsA and 499insA) were identified. In one patient a complete IDS deletion was found, extending from locus DXS1185 to locus DXS466).

Detection of point mutations and a gross deletion in six Hunter Syndrome patients

We have used screening with the polymerase chain reaction and chemical mismatch detection of amplified cDNA to detect and characterize deletions and point mutations in six Hunter Syndrome patients. A high degree of mutational heterogeneity was observed. The first patient is completely deleted for the gene coding for α- l-iduronate sulfate sulfatase, while the second has a point mutation that creates a stop codon. The third patient shows a point mutation that creates a novel splice site that is preferentially utilized and results in partial loss of one exon in the RNA. Patients 4, 5, and 6 have point mutations resulting in single amino acid substitutions. Four of the six single-base changes observed in this study were examples of transitions of the highly mutable dinucleotide CpG to TpG. This study has demonstrated a procedure capable of detecting all types of mutation that affect the function of the IDS protein and should enable direct carrier and prenatal diagnosis for Hunter syndrome families.