Human Telomeric DNA Quadruplex Research Articles

Substituted Naphthalenediimide Compounds Bind Selectively to Two Human Quadruplex Structures with Parallel Topology.

Interactions are reported of three representative naphthalenediimide derivatives with three quadruplex targets, from the promoter region of the telomerase (hTERT) gene, a human telomeric DNA quadruplex, and a telomeric RNA quadruplex (TERRA). Thermal melting studies showed that these compounds strongly stabilize the quadruplexes, with weak stabilization of a duplex DNA. Binding studies by surface plasmon resonance and fluorescence spectroscopy found that the compounds bind to the quadruplexes with nanomolar equilibrium dissociation constants. Plausible topologies for the quadruplex complexes were deduced from CD spectra, which together with the surface plasmon resonance data indicate that the quadruplexes with parallel quadruplex folds are preferred by two compounds, which was confirmed by qualitative molecular modeling.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M−1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M−1, and that of BER was (0.98 ± 0.03) × 105 M−1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Diverse effects of naturally occurring base lesions on the structure and stability of the human telomere DNA quadruplex.

Various base lesions continuously form in cellular nucleic acids and the unrepaired lesions are promutagenic and procarcinogenic. Though natural base lesions have been extensively studied in double-stranded DNA models, these studies are only less than a decade old for non-canonical DNA models, such as quadruplexes. Here we present a report on the effects of three frequently occurring natural lesions that can form in the TTA loops on the structure of the human telomere quadruplex d[AG3(TTAG3)3]. We compared the effect of the abasic site and 8-oxoadenine replacing adenine and 5-hydroxymethyluracil substituting for thymine. The results showed that the three lesions impacted the stability and quadruplex folding in markedly different ways. The effects depended on the type of lesion and the position in the sequence. Analogous lesions of guanine in the G-tetrads extensively destabilized the quadruplex and the effects depended more on the position than on the type of lesion. The distinct effects of the loop substitutions as well as comparison of the modifications of the loops and the quadruplex tetrads are discussed in this communication.

Novel trisubstituted acridines as human telomeric quadruplex binding ligands

A novel series of trisubstituted acridines were synthesized with the aim of mimicking the effects of BRACO19. These compounds were synthesized by modifying the molecular structure of BRACO19 at positions 3 and 6 with heteroacyclic moieties. All of the derivatives presented in the study exhibited stabilizing effects on the human telomeric DNA quadruplex. UV–vis spectroscopy, circular dichroism, linear dichroism and viscosimetry were used in order to study the nature of the DNA binding in more detail. The results show that all of the novel derivatives were able to fold the single-stranded DNA sequences into antiparallel G-quadruplex structures, with derivative 15 exhibiting the highest stabilizing capability. Cell cycle analysis revealed that a primary trend of the “braco”-like derivatives was to arrest the cells in the S- and G2M-phases of the cell cycle within the first 72h, with derivative 13 and BRACO19 proving particularly effective in suppressing cell proliferation. All studies derivatives were less toxic to human fibroblast cell line in comparison with HT 29 cancer cell line.

Dramatic Effect of Furanose C2′ Substitution on Structure and Stability: Directing the Folding of the Human Telomeric Quadruplex with a Single Fluorine Atom

Human telomeric DNA quadruplexes can adopt different conformations in solution. We have found that arabinose, 2'F-arabinose, and ribose substitutions stabilize the propeller parallel G-quadruplex form over competing conformers, allowing NMR structural determination of this particularly significant nucleic acid structure. 2'F-arabinose substitution provides the greatest stabilization as a result of electrostatic (F-CH---O4') and pseudo-hydrogen-bond (F---H8) stabilizing interactions. In contrast, 2'F-rG substitution provokes a dramatic destabilization of the quadruplex structure due to unfavorable electrostatic repulsion between the phosphate and the 2'-F.

Molecular Basis of Structure–Activity Relationships between Salphen Metal Complexes and Human Telomeric DNA Quadruplexes

The first X-ray crystal structures of nickel(II) and copper(II) salphen metal complexes bound to a quadruplex DNA are presented. Two structures have been determined and show that these salphen-metal complexes bind to human telomeric quadruplexes by end-stacking, with the metal in each case almost in line with the potassium ion channel. Quadruplex and duplex DNA binding is presented for these two and other related salphen complexes, all with side-chains terminating in pyrrolidino end-groups and differing patterns of substitution on the salphen core. The crystal structures are able to provide rationalizations for the structure-activity data, and in particular for the superior quadruplex-binding of the nickel complexes compared to that of the copper-containing ones. The complexes show significant antiproliferative activity for the compounds in a panel of cancer cell lines. They also show telomerase inhibitory activity in the telomerase TRAP-LIG assay.

Arrangements of human telomere DNA quadruplex in physiologically relevant K + solutions

The arrangement of the human telomeric quadruplex in physiologically relevant conditions has not yet been unambiguously determined. Our spectroscopic results suggest that the core quadruplex sequence G3(TTAG3)3 forms an antiparallel quadruplex of the same basket type in solution containing either K+ or Na+ ions. Analogous sequences extended by flanking nucleotides form a mixture of the antiparallel and hybrid (3 + 1) quadruplexes in K+-containing solutions. We, however, show that long telomeric DNA behaves in the same way as the basic G3(TTAG3)3 motif. Both G3(TTAG3)3 and long telomeric DNA are also able to adopt the (3 + 1) quadruplex structure: Molecular crowding conditions, simulated here by ethanol, induced a slow transition of the K+-stabilized quadruplex into the hybrid quadruplex structure and then into a parallel quadruplex arrangement at increased temperatures. Most importantly, we demonstrate that the same transitions can be induced even in aqueous, K+-containing solution by increasing the DNA concentration. This is why distinct quadruplex structures were detected for AG3(TTAG3)3 by X-ray, nuclear magnetic resonance and circular dichrosim spectroscopy: Depending on DNA concentration, the human telomeric DNA can adopt the antiparallel quadruplex, the (3 + 1) structure, or the parallel quadruplex in physiologically relevant concentrations of K+ ions.

Topology Conservation and Loop Flexibility in Quadruplex–Drug Recognition: Crystal Structures of Inter- and Intramolecular Telomeric DNA Quadruplex–Drug Complexes

Knowledge of the biologically relevant topology is critical for the design of drugs targeting quadruplex nucleic acids. We report here crystal structures of a G-quadruplex-selective ligand complexed with two human telomeric DNA quadruplexes. The intramolecular quadruplex sequence d[TAGGG(TTAGGG) 3] and the bimolecular quadruplex sequence d(TAGGGTTAGGGT) were co-crystallized with a tetra-substituted naphthalene diimide quadruplex-binding ligand. The structures were solved and refined to 2.10- and 2.20-Å resolution, respectively, revealing that the quadruplex topology in both structures is unchanged by the addition of the ligands, retaining a parallel-stranded arrangement with external double-chain-reversal propeller loops. The parallel topology results in accessible external 5′ and 3′ planar G-tetrad surfaces for ligand stacking. This also enables significant ligand-induced conformational changes in several TTA propeller loops to take place such that the loops themselves are able to accommodate bound drug molecules without affecting the parallel quadruplex topology, by stacking on the external TTA connecting loop nucleotides. Ligands are bound into the external TTA loop nucleotides and stack onto G-tetrad surfaces. These crystal structures provide a framework for further ligand development of the naphthalene diimide series to enhance selectivity and affinity. [Display omitted]

Telomestatin-induced stabilization of the human telomeric DNA quadruplex monitored by electrospray mass spectrometry.

Electrospray mass spectrometry (ESI-MS) was used to monitor the kinetics of duplex formation between the human telomeric DNA quadruplex and its complementary strand; the complexation of telomestatin to the G-quadruplex delays the unwinding of the quadruplex structure and formation of the duplex.

Molecular Modeling Studies on G-Quadruplex Complexes of Telomerase Inhibitors: Structure−Activity Relationships

Inhibition of the ability of the enzyme telomerase to add telomeric repeats to the end of chromosomes is a novel target for potential anticancer therapy. This paper examines the hypothesis that compounds possessing a planar aromatic chromophore inhibit telomerase via stabilization of, and binding to, a folded guanine quadruplex structure. Two series of telomerase inhibitors have been designed based on the 2,6-disubstituted amidoanthracene-9,10-dione and 3,6-disubstituted acridine chromophores in order to investigate structure-activity relationships between biological activity and substituent group size. The relative binding energies between these compounds and the folded human telomere DNA quadruplex were determined using molecular simulation methods, involving explicitly solvated structures. The results obtained are in excellent agreement with the biological activity as measured in vitro using a modified TRAP assay and in general agreement with the ranking order of binding enthalpies found in isothermal titration calorimetry studies. This broad agreement provides strong support for the hypothesis that guanine quadruplexes are the primary target for telomerase inhibitors with extended planar chromophores.