Human Granulocyte-macrophage Colony-stimulating Factor Gene Research Articles

Recombinant adenoviral vector expressing human wild-type p53, GM-CSF, and B7-1 genes suppresses the growth of glioma in vivo

Malignant gliomas are the most common of primary brain tumors and have been proven incurable with conventional treatments. Evidence have shown that a recombinant adenoviral vector expressing human wild-type p53, granulocyte-macrophage colony-stimulating factor (GM-CSF), and B7-1 genes (BB-102) may have antitumor effects in vitro. In this study, we investigated the effects of BB-102-based vaccine on glioma in vivo. An animal model using nonobese diabetic/severe combined immunodeficiency (NOD/SCID) mice with human immune system was established. The mice were vaccinated with inactivated U251 glioma cells transduced with BB-102 or adenoviral vector expressing green fluorescence protein (Ad-GFP) as a control and followed by the challenge of live U251 glioma cells. Tumor growth and antitumor responses were measured. Data showed that mice vaccinated with BB-102 had significantly reduced local tumor growth compared to mice with Ad-GFP vaccination or the control group. Histopathological analysis displayed low tumor cell density and significant infiltration of human peripheral blood lymphocytes (HuPBLs) in the tumor tissues of mice transduced with BB-102. Immunohistochemical analysis showed that mutant p53 was not expressed in tumor tissues of mice with BB-102 vaccination, and the expression level of Ki67 was significantly lower in the tumor tissues of the BB-102 group than those in the Ad-GFP group or the control group. Further study demonstrated that mice with BB-102 vaccination had significantly increased total T cell numbers, total T cell proportion, CD4+ T cell proportion, and CD8+ T cell proportion in spleens, as well as higher value of IgG, IgA, and IgE in sera. These data suggest that the recombinant adenoviral vector expressing human wild-type p53, GM-CSF, and B7-1 genes could suppress glioma in NOD/SCID mice model and might be considered as a novel strategy for glioma therapy.

Pharmacokinetics of combined gene therapy expressing constitutive human GM-CSF and hyperthermia-regulated human IL-12

BackgroundAn adenovirus that expresses both interleukin (IL)-12 and granulocyte-macrophage colony-stimulating-factor (GM-CSF) has been proven to be very effective in treating several tumors, but causes serious normal tissue toxicities.MethodsIn this study, a novel adenoviral vector was constructed by placing the human GM-CSF gene under the control of the CMV-IE promoter and human IL-12 gene under the control of heat shock protein 70B gene promoter. Both hGM-CSF and hIL-12 expressions in virus-infected tumor cells were analyzed in vitro and in vivo when underlying single or multiple rounds of hyperthermia.ResultsWe observed constitutive high expression of human GM-CSF and heat-induced expression of human IL-12 after a single round of hyperthermia post viral infection. The heat-induced hIL-12 expression exhibited a pulse-like pattern with a peak at 24 hrs followed by a decline 48 hrs post heat stress. Repeated heat treatment was more effective in inducing hIL-12 expression than a one-time heat treatment. Interestedly, we also observed that constitutive expression of hGM-CSF could be stimulated by heat stress in tested tumor cells.ConclusionOur study provided a novel strategy for combined gene therapy that allows constitutive expression of a non-toxic gene such as GM-CSF and heat-induced expression of a toxic gene such as IL-12. In addition, our study also showed that hyperthermia can be used to trigger gene expression in temporal and special manner.

Chromatin structure at active genes

For gene switching, chromatin must be manipulated, a process initiating at key cis-controlling elements, labelled operationally as DNaseI hypersensitive sites (DHS). This minireview series expands on how the remodelling of chromatin structure comes about and the consequences for gene activation and repression The conventional wisdom embodied (but not, in this age of rapid development, embalmed) in many textbooks has it that chromatin exists in cells either in a linker histone-containing condensed fibre of nucleosomes, diameter 30–40 nm, characteristic of heterochromatin, or as an open extended beads-on-a-string like structure, characteristic of all active genes. Even brief thought gives the lie to the second concept, since in very active tissues such as brain or stem cells in which, say, 40% of all genes are active, were they all fully extended throughout their transcribed length the nuclear volume could not possibly accommodate them. Since the chromatin of an active gene must be opened up at the moment of polymerase passage, it follows that continuous manipulation of chromatin structure must occur at active genes. Indeed, using the criterion of DNaseI accessibility we have recently shown that the overall state of certain active genes differs little from that of an immediately adjacent heterochromatin segment, experimentally demonstrated to be in the form of the 30 nm fibre. This time-averaged observation does not apply, however, to cis-controlling elements such as promoters and enhancers that, since the seminal observations of Hal Weintraub and Mark Groudine in 1976, have been shown to be locally hypersensitive to DNaseI digestion, i.e. in a more open conformation. Thus whereas the presence of bound histones, including the H1 linker, does not in general present a barrier to passage of the polymerase complex through an active gene, access to the DNA at cis elements requires a more open structure. It is worth emphasizing that DNaseI remains a valuable tool in studying local chromatin structure, not only for defining key control points as DNaseI hypersensitive sites, but also for locating the rare segments of open nucleosomal chromatin, i.e. genuine beads-on-a-string structures, sometimes found in the region of promoters or enhancers. This results from the fact that, whereas MNase digestion of nuclei always gives rise to conventional nucleosomal ladders, whether the underlying structure is the 30 nm fibre or open nucleosomal beads, DNaseI does not generate ladders from 30 nm chromatin fibres (the bulk of the chromatin) but it does from open beaded structures. Overall, the controlled manipulation of chromatin structure at such locations, in particular the displacement or even eviction of nucleosomes to permit the ordered recruitment of transcription factors, is a complex process requiring many interdependent components, in particular chromatin remodelling and histone modifying complexes. The following three minireviews address the problem of chromatin manipulation. The first, by Peter Cockerill, takes an overview of the chromatin structure at active genes and then illustrates this with the process of activating the human GM-CSF (granulocyte/macrophage colony stimulating factor) gene during T cell development, emphasizing how the binding of transcription factors is dependent on nucleosome displacement and is accompanied by the appearance of DNaseI hypersensitive sites. The paper by Gordon Hager and colleagues reviews how, following treatment of cells with steroid hormones, the chromatin structure of responsive genes changes in consequence of binding by the immediate hormone targets, the nuclear receptors. Finally, Stefan Dimitrov and his colleague Jan Bednar relate how the bare bone mechanics of chromatin manipulation could occur as nucleosomes and chromatin fibres are put under stress by pulling and tugging whilst held by optical and magnetic tweezers. In a field that can be confounded by the wide variation of experimental conditions, the authors very helpfully provide a summarizing table of published results.

Gene Therapy for Human Nasopharyngeal Carcinoma by Adenovirus–Mediated Transfer of Human p53, GM-CSF, and B7-1 Genes in a Mouse Xenograft Tumor Model

Incidence of nasopharyngeal carcinoma (NPC) remains high in endemic regions. Prevention of tumor recurrences and metastases is a crucial approach to improve therapeutic outcome in NPC patients. In this study, we investigated the effects of the cotransfer of the tumor suppressor gene, p53, in combination with the immunostimulatory genes, GM-CSF and B7-1, on tumor regression and subsequent tumor recurrence. We constructed a recombinant adenovirus carrying human wild-type p53, granulocyte-macrophage colony-stimulating factor (GM-CSF), and B7-1 genes (Ad-p53/GM-CSF/B7-1), which mediated high-level expression of these three genes in NPC CNE-1 cells. Ad-p53/GM-CSF/B7-1 infection inhibited the growth of CNE-1 cells and induced tumor-specific cytotoxic T-lymphocytes (CTLs) in vitro. In CNE-1 xenograft tumor models in huPBL-nonobese diabetic/severe combined immunodeficiency (NOD/SCID) mice, an intratumoral injection of Ad-p53/GM-CSF/B7-1 resulted in a reduced tumor burden, compared to normal saline (NS) and Ad-p53 controls. Tumors in the Ad-p53/GM-CSF/B7-1 group displayed diffuse necrosis and infiltration of human T-cells. Further, the tumor occurrence of CNE-1 cell rechallenge largely decreased after the primary tumor was intratumorally injected with Ad-p53/GM-CSF/B7-1 in the HuPBL-NOD/SCID mice model. Only 2 of 8 (25%) animals in the Ad-p53/GM-CSF/B7-1 group had developed measurable tumors, which demonstrated extensive necrosis and much more human T-cell infiltration, compared to 5 of 7 (71%) in the NS and Ad-p53 groups. Therefore, the adenovirus-mediated introduction of p53, GM-CSF, and B7-1 genes could improve local control and prevent the recurrence or metastases of NPC tumors, which suggests a potential therapeutic value in NPC treatment.

A GM-CSF/CD40L Producing Cell Augments Anti-tumor T Cell Responses

Tumors evade T cell-mediated rejection despite the presence of tumor associated antigens (TAAs) and T cells specific for these TAAs in cancer patients. Therapeutic tumor vaccines are being developed to prevent this evasion. Previous reports revealed that anti-tumor T cell responses could be activated in mice when granulocyte macrophage-colony stimulating factor (GM-CSF) or CD40L are produced at tumor vaccine sites. We sought to test the hypothesis that production of GM-CSF and CD40L by a bystander cell line could induce an anti-tumor T cell response in an in vitro human model. The K562 cell line was stably transfected with the human GM-CSF and CD40L genes. The effect of this cell line on T cell responses was tested in a human autologous mixed tumor cell/lymph node cell model using tissue from a series of cancer patients. There was no significant anti-tumor T cell response when human lymphocytes derived from tumor-draining lymph nodes were stimulated with autologous tumor cells in vitro. However, significant anti-tumor T cell responses were observed when bystander cells transfected with CD40L and GM-CSF were added to the cultures. A fully autologous human model consisting of tumor cells as stimulator cells and tumor-draining lymph nodes as responder cells can be used to test immunotherapeutic strategies. T cells in these lymph nodes are unresponsive to autologous tumor cells, but this lack of responsiveness can be reversed in the presence of GM-CSF and CD40L. These data provide a rationale for testing tumor cell vaccines incorporating GM-CSF- and CD40L-expressing bystanders in clinical trials.

17beta-estradiol enhances the production of granulocyte-macrophage colony-stimulating factor in human keratinocytes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is effective for impaired wound repair. Estrogen is known to enhance wound repair. We examined if 17beta-estradiol (E2) may in vitro enhance GM-CSF production in human keratinocytes. E2 and membrane-impermeable bovine serum albumin-conjugated E2 increased GM-CSF secretion, mRNA stability, and promoter activity. The element homologous to activator protein-1 (AP-1) on the promoter was responsible for the activation. E2 enhanced transcriptional activity and DNA binding of AP-1. E2 transiently generated c-Fos protein, and shifted AP-1 composition from c-Jun homodimers to c-Fos/c-Jun heterodimers in keratinocytes. E2-induced enhancement of GM-CSF secretion, mRNA stability, and promoter activity were not suppressed by estrogen receptor antagonist ICI 182,780, however, suppressed by conventional protein kinase C inhibitor Gö6976 and PD98059, an inhibitor of mitogen-activated protein kinase kinase (MEK). Gö6976 and PD98059 suppressed E2-induced c-Fos expression and enhancement of DNA-binding and transcriptional activity at AP-1. E2 induced membrane translocation of protein kinase Calpha, which was suppressed by phosphatidylinositol (PI)-specific phospholipase C (PLC) inhibitor U73122. E2 stimulated the phosphorylation of extracellular signal-regulated kinase (ERK), which was suppressed by PD98059, Gö6976, and U73122. E2 transiently generated inositol 1,4,5-triphosphate in keratinocytes, which was suppressed by U73122 and guanine nucleotide-binding protein inhibitor. These results suggest that E2 may enhance GM-CSF production via guanine nucleotide-binding protein-coupled membrane receptors and signaling cascade of PI-specific PLC/protein kinase Calpha/MEK/ERK.

Growth suppression and immunogenicity enhancement of Hep-2 or primary laryngeal cancer cells by adenovirus-mediated co-transfer of human wild-type p53, granulocyte-macrophage colony-stimulating factor and B7-1 genes

Co-transfer of immunomodulatory and antiproliferative genes may be the basis for new strategies to potentiate tumor regression. In this study, we evaluated the in vitro effect of the introduction of human wild-type p53, granulocyte-macrophage colony-stimulating factor (GM-CSF), and B7-1 genes via recombinant adenovirus on the growth and immunogenicity of Hep-2 or primary laryngeal cancer cells. By the introduction of wild-type p53 gene, the growth of Hep-2 cells was inhibited via enhanced apoptosis. By the introduction of GM-CSF and B7-1 genes, the immunogenicity of cancer cells was enhanced. Significant proliferation of tumor infiltrating lymphocytes (TILs) and tumor-specific cytotoxicity of cytotoxic T lymphocytes (CTLs) were induced in vitro. Furthermore, the combinative effect of GM-CSF and B7-1 was even more evident than that of any one of them singly. These results suggest that the co-transfer of human wild-type p53, GM-CSF and B7-1 genes into tumor cells via recombinant adenovirus may be further developed into a potential combination gene therapy strategy for cancer.

Molecular cloning and expression of woodchuck granulocyte‐macrophage colony stimulating factor*

Granulocyte-macrophage colony stimulating factor (GM-CSF) has immunoregulatory and antiviral effects, and may thus be promising for the treatment of chronic hepatitis B. Using woodchuck hepatitis virus (WHV)-infected woodchuck as an animal model to test the efficacy and safety of GM-CSF on the therapy of chronic hepatitis B, woodchuck GM-CSF will be required due to the apparent species-specific activity of GM-CSF. The cDNA of woodchuck GM-CSF was cloned using reverse transcription-polymerase chain reaction (RT-PCR) with primers deriving from highly conserved regions of GM-CSF genes from other species. The deduced amino acids, including the signal peptide, is 138 in length and its identities to human, murine, canine and bovine GM-CSFs are 63, 49, 63, and 63% respectively. The genomic DNA of woodchuck GM-CSF was also cloned by PCR. Its organization is highly homologous to that of human and murine GM-CSF genes, consisting of four exons and three introns. Cloned woodchuck GM-CSF was expressed transiently in 293T cells. The recombinant protein expressed was found to stimulate the growth and differentiation of woodchuck bone marrow cells, indicating the protein expressed by the cloned gene is functional. These results pave the way for future studies on the potential role of GM-CSF for the treatment of chronic hepatitis B by using this animal model.

Oncogene-dependent engraftment of human myeloid leukemia cells in immunosuppressed mice

We have developed an in vivo model of differentiated human acute myeloid leukemia (AML) by retroviral infection of the cytokine-dependent AML cell line TF-1 with the v-Src oncogene. When injected either intravenously or intraperitoneally into 300 cGy irradiated SCID mice, animals formed multiple granulocytic sarcomas involving the adrenals, kidneys, lymph nodes and other organs. The mean survival time was 34+/-10 days (n = 40) after intravenous injection and 24+/-3 days (n = 5) after intraperitoneal injection of 20 million cells. The cells recovered from leukemic animals continued to express interleukin-3 receptors and remained sensitive to the diphtheria fusion protein DT388IL3. Further, these granulocytic sarcoma-derived cells grew again in irradiated SCID mice (n = 10). The cytogenetic abnormalities observed prior to inoculation in mice were stably present after in vivo passage. Similar to the results with v-Src transfected TF-1 cells, in vivo leukemic growth was observed with TF-1 cells transfected with the human granulocyte-macrophage colony-stimulating factor gene (n = 5) and with TF-1 cells recovered from subcutaneous tumors in nude mice (n = 5). In contrast, TF-1 cells expressing v-Ha-Ras (n = 5), BCR-ABL (n = 5), or activated Raf-1 (n = 44) did not grow in irradiated SCID mice. This is a unique, reproducible model for in vivo growth of a differentiated human acute myeloid leukemia and may be useful in the assessment of anti-leukemic therapeutics which have human-specific molecular targets such as the interleukin-3 receptor.

Co-transfer of human wild-type p53 and granulocyte-macrophage colony-stimulating factor genes via recombinant adenovirus induces apoptosis and enhances immunogenicity in laryngeal cancer cells

Co-transfer of immunomodulatory and anti-proliferative genes may be the basis for new strategies to enhance tumor regression. The purpose of this study was to develop a combination gene therapy strategy for the treatment of laryngeal cancer. Human wild-type p53 and granulocyte-macrophage colony-stimulating factor (GM-CSF) genes were transferred into human laryngeal cancer cells mediated by adenovirus type 5 vector co-expressing human wild-type p53 and GM-CSF (Ad-p53/GM-CSF). By the introduction of the wild-type p53 gene, the growth of human laryngeal cancer Hep-2 cells was inhibited and their apoptosis was induced. By the introduction of the GM-CSF gene, the immunogenicity of cancer cells was enhanced. Significant proliferation of tumor infiltrating lymphocytes and tumor-specific cytotoxicity of cytotoxic T lymphocytes were induced by Ad-p53/GM-CSF-infected cancer cells in vitro. The results suggest that the co-transfer of human wild-type p53 and GM-CSF genes into tumor cells via recombinant adenovirus may be further developed into an effective and practical combination gene therapy strategy for laryngeal cancer.

The human granulocyte-macrophage colony- stimulating factor gene is autonomously regulatedin vivoby an inducible tissue-specific enhancer

The granulocyte-macrophage colony-stimulating factor (GM-CSF) gene is part of a cytokine gene cluster and is directly linked to a conserved upstream inducible enhancer. Here we examined the in vitro and in vivo functions of the human GM-CSF enhancer and found that it was required for the correctly regulated expression of the GM-CSF gene. An inducible DNase I-hypersensitive site appeared within the enhancer in cell types such as T cells, myeloid cells, and endothelial cells that express GM-CSF, but not in nonexpressing cells. In a panel of transfected cells the human GM-CSF enhancer was activated in a tissue-specific manner in parallel with the endogenous gene. The in vivo function of the enhancer was examined in a transgenic mouse model that also addressed the issue of whether the GM-CSF locus was correctly regulated in isolation from other segments of the cytokine gene cluster. After correction for copy number the mean level of human GM-CSF expression in splenocytes from 11 lines of transgenic mice containing a 10.5-kb human GM-CSF transgene was indistinguishable from mouse GM-CSF expression (99% +/- 56% SD). In contrast, a 9.8-kb transgene lacking just the enhancer had a significantly reduced (P = 0.004) and more variable level of activity (29% +/- 89% SD). From these studies we conclude that the GM-CSF enhancer is required for the correct copy number-dependent expression of the human GM-CSF gene and that the GM-CSF gene is regulated independently from DNA elements associated with the closely linked IL-3 gene or other members of the cytokine gene cluster.

AUUUA sequences direct mRNA deadenylation uncoupled from decay during Xenopus early development.

To study the regulation of AUUUA-mediated RNA deadenylation and destabilization during Xenopus early development, we microinjected chimeric mRNAs containing Xenopus or mammalian 3' untranslated region (3'-UTR) sequences into Xenopus oocytes, mature eggs, or fertilized embryos. We found that the AU-rich elements (ARE) of Xenopus c-myc II and the human granulocyte-macrophage colony-stimulating factor gene (GMCSF) both direct deadenylation of chimeric mRNAs in an AUUUA-dependent manner. In the case of the Xenopus c-myc II ARE, mutation of a single AUUUA within an absolutely conserved 11-nucleotide region in c-myc 3'-UTRs prevents ARE-mediated deadenylation. AUUUA-specific deadenylation appears to be developmentally regulated: low deadenylation activity is observed in the oocyte, whereas rapid deadenylation occurs following egg activation or fertilization. Deadenylation results in the accumulation of stable deadenylated RNAs that become degraded only following mid-blastula transition. We conclude that ARE-mediated mRNA deadenylation can be uncoupled from ARE-mediated mRNA decay and that AUUUAs directly signal deadenylation during Xenopus early development.

Bioactivity of Autologous Irradiated Renal Cell Carcinoma Vaccines Generated by Ex Vivo Granulocyte-Macrophage Colony-Stimulating Factor Gene Transfer

Granulocyte-macrophage colony-stimulating factor (GM-CSF) gene-transduced, irradiated tumor vaccines induce potent, T-cell-mediated antitumor immune responses in preclinical models. We report the initial results of a Phase I trial evaluating this strategy for safety and the induction of immune responses in patients with metastatic renal cell carcinoma (RCC). Patients were treated in a randomized, double-blind dose-escalation study with equivalent doses of autologous, irradiated RCC vaccine cells with or without ex vivo human GM-CSF gene transfer. The replication-defective retroviral vector MFG was used for GM-CSF gene transfer. No dose-limiting toxicities were encountered in 16 fully evaluable patients. GM-CSF gene-transduced vaccines were equivalent in toxicity to nontransduced vaccines up to the feasible limits of autologous tumor vaccine yield. No evidence of autoimmune disease was observed. Biopsies of intradermal sites of injection with GM-CSF gene-transduced vaccines contained distinctive macrophage, dendritic cell, eosinophil, neutrophil, and T-cell infiltrates similar to those observed in preclinical models of efficacy. Histological analysis of delayed-type hypersensitivity responses in patients vaccinated with GM-CSF-transduced vaccines demonstrated an intense eosinophil infiltrate that was not observed in patients who received nontransduced vaccines. An objective partial response was observed in a patient treated with GM-CSF gene-transduced vaccine who displayed the largest delayed-type hypersensitivity conversion. No replication-competent retrovirus was detected in vaccinated patients. This Phase I study demonstrated the feasibility, safety, and bioactivity of an autologous GM-CSF gene-transduced tumor vaccine for RCC patients.

Bioactivity of Autologous Irradiated Renal Cell Carcinoma Vaccines Generated by Ex Vivo Granulocyte-Macrophage Colony-Stimulating Factor Gene Transfer

Granulocyte-macrophage colony-stimulating factor (GM-CSF) gene-transduced, irradiated tumor vaccines induce potent, T-cell-mediated antitumor immune responses in preclinical models. We report the initial results of a Phase I trial evaluating this strategy for safety and the induction of immune responses in patients with metastatic renal cell carcinoma (RCC). Patients were treated in a randomized, double-blind dose-escalation study with equivalent doses of autologous, irradiated RCC vaccine cells with or without ex vivo human GM-CSF gene transfer. The replication-defective retroviral vector MFG was used for GM-CSF gene transfer. No dose-limiting toxicities were encountered in 16 fully evaluable patients. GM-CSF gene-transduced vaccines were equivalent in toxicity to nontransduced vaccines up to the feasible limits of autologous tumor vaccine yield. No evidence of autoimmune disease was observed. Biopsies of intradermal sites of injection with GM-CSF gene-transduced vaccines contained distinctive macrophage, dendritic cell, eosinophil, neutrophil, and T-cell infiltrates similar to those observed in preclinical models of efficacy. Histological analysis of delayed-type hypersensitivity responses in patients vaccinated with GM-CSF-transduced vaccines demonstrated an intense eosinophil infiltrate that was not observed in patients who received nontransduced vaccines. An objective partial response was observed in a patient treated with GM-CSF gene-transduced vaccine who displayed the largest delayed-type hypersensitivity conversion. No replication-competent retrovirus was detected in vaccinated patients. This Phase I study demonstrated the feasibility, safety, and bioactivity of an autologous GM-CSF gene-transduced tumor vaccine for RCC patients.

Adjacent, Cooperative Elements Form a Strong, Constitutive Enhancer in the Human Granulocyte-Macrophage Colony-Stimulating Factor Gene

Both copies of a repeated sequence CATT(A/T), located between bp -53 and -39 in the upstream region of the human GM-CSF gene, are required for mitogen-inducible promoter activity in T lymphocytes. However, the proteins that recognize this region of the granulocyte-macrophage colony-stimulating factor (GM-CSF) promoter, and are responsible for its transcriptional regulatory activity, have not been clearly identified. Using transient transfection assays, we demonstrate that a 19-bp oligonucleotide containing the CATT(A/T) repeats has strong constitutive enhancer activity in both T cell and non-T-cell lines, even though GM-CSF is not normally constitutively expressed by these cells. A 12-bp oligonucleotide, containing only the sequence CATTAATCATTT, lacks enhancer activity indicating that the nucleotides surrounding these sequences are critical for this enhancer activity. The sequence TTTCCT, which can bind members of the ets family of transcription factors, is located just 3' of these CATT(A/T) repeats, and mutagenesis of the CCT sequence abolishes (1) the constitutive (and mitogen inducible) enhancer activity of the 19-bp GM-CSF sequences, (2) the responsiveness to transactivation by ets-1, and (3) the ability to specifically bind ets-1 and elf-1 in electrophoretic mobility shift assays (EMSA). We demonstrate that although T cells contain nuclear proteins capable of independently recognizing the ets binding site and the CATT(A/T) repeats in EMSAs, both of these regulatory elements are required for enhancer function. The strong constitutive activity of this 19-bp region suggests that negative regulation of the GM-CSF promoter is critical for the restricted expression pattern of GM-CSF mRNA.

Characterization of the human granulocyte-macrophage colony-stimulating factor gene promoter: an AP1 complex and an Sp1-related complex transactivate the promoter activity that is suppressed by a YY1 complex.

It is well documented that a repeated CATT element in the human granulocyte-macrophage colony-stimulating factor (GM-CSF) gene promoter is required for promoter activity. However, the transcription factors that are able to transactivate this enhancer element remain unidentified. Recently, we have found that nuclear factor YY1 can interact with the enhancer element. Here, we report that in addition to YY1, two other nuclear factors have been identified in the DNA-protein complexes formed by the CATT oligonucleotide and the Jurkat T-cell nuclear protein. One of these factors is AP1, and the other one is an Sp1-related protein. Results from transient transfection of Jurkat T cells have revealed that formation of both AP1 and the Sp1-related complex is required for the full enhancer activity of the CATT element. This result is supported by cotransfection of a c-jun expression vector and mutational analysis of the AP1 site or the Sp1-related protein binding site. In contrast, formation of the YY1 complex suppresses enhancer activity, since deletion of the YY1 complex induces an augmentation of the enhancer activity and overexpression of YY1 results in an attenuation of the enhancer activity. Results from the mechanism study have revealed that YY1 is able to inhibit transactivation mediated by either AP1 or the Sp1-related protein, and YY1 suppressive activity is DNA binding dependent. Taken together, these data support the ideas that AP1 and the Sp1-related nuclear protein are required for transactivation of the human GM-CSF gene promoter and that YY1 can suppress transactivation of the promoter even under inducible conditions.

Multiple signals are required for function of the human granulocyte-macrophage colony-stimulating factor gene promoter in T cells.

The human granulocyte-macrophage CSF (GM-CSF) gene is expressed in T cells in response to TCR activation that can be mimicked by treatment of the cells with PMA and Ca2+ ionophore. The gene contains a proximal functional promoter region (-620 to +34), as well as a powerful enhancer located 3 kb upstream, both of which are involved in the response of the gene to TCR activation. The proximal promoter contains a region termed CLEO (-54 to -31) that consists of a purine-rich element abutting an activator protein-1 (AP-1)-like site, as well as an upstream nuclear factor-kappa B (NF-kappa B) site (-85 to -76) and a CK-1 element (-101 to -92). We show in this work that mutations in either the purine-rich region of the CLEO element or the NF-kappa B site result in reduced PMA/Ca2+ activation of a 620-bp human GM-CSF promoter-luciferase reporter construct in Jurkat T cells by 65% and 50%, respectively. The major inducible protein complex that binds to the human CLEO (hCLEO) element is an AP-1-like complex that is inducible by PMA alone, but shows increased binding in response to PMA together with Ca2+ ionophore. Although the binding of this complex is not cyclosporin-sensitive, promoter induction is inhibited by cyclosporin treatment. A second weak inducible complex resembling nuclear factor of activated T cells (NF-AT) was also observed binding to the hCLEO region. By using recombinant proteins, we confirmed that AP-1, NF-ATp, and a higher order NF-ATp/AP-1 complex could all form with the hCLEO element, and we have also defined the sequence requirements for binding of each of these complexes. We found that expression of a constitutively active form of calcineurin could substitute for Ca2+ ionophore and synergize with PMA to activate the GM-CSF promoter, and conversely that mutant-activated Ras could substitute for PMA and cooperate with Ca2+ ionophore. Co-expression of Ras and calcineurin, however, did not activate the GM-CSF promoter, but required the additional expression of NF-kappa B p65. These results imply that at least three signals are required to activate the GM-CSF proximal promoter, and that the signals impinge on distinct transcription factors that bind to the hCLEO and NF-kappa B regions of the promoter.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Human Granulocyte-Macrophage Colony-Stimulating Factor Enhancer Function Is Associated with Cooperative Interactions between AP-1 and NFATp/c

The promoter of the human granulocyte-macrophage colony-stimulating factor gene is regulated by an inducible upstream enhancer. The enhancer encompasses three previously defined binding sites for the transcription factor NFAT (GM170, GM330, and GM550) and a novel NFAT site defined here as the GM420 element. While there was considerable redundancy within the enhancer, the GM330, GM420, and GM550 motifs each functioned efficiently in isolation as enhancer elements and bound NFATp and AP-1 in a highly cooperative fashion. These three NFAT sites closely resembled the distal interleukin-2 NFAT site, and methylation interference assays further defined GGA(N)9TCA as a minimum consensus sequence for this family of NFAT sites. By contrast, the GM170 site, which also had conserved GGA and TCA motifs but in which these motifs were separated by 15 bases, supported strong independent but no cooperative binding of AP-1 and NFATp, and this site functioned poorly as an enhancer element. While both the GM330 and GM420 elements were closely associated with the inducible DNase I-hypersensitive site within the enhancer, the GM420 element was the only NFAT site located within a 160-bp HincII-BalI fragment defined by deletion analysis as the essential core of the enhancer. The GM420 element was unusual, however, in containing a high-affinity NFATp/c-binding sequence (TGGAAAGA) immediately upstream of the sequence TGACATCA which more closely resembled a cyclic AMP response-like element than an AP-1 site. We suggest that the cooperative binding of NFATp/c and AP-1 requires a particular spacing of sites and that their cooperativity and induction via independent pathways ensure very tight regulation of the granulocyte-macrophage colony-stimulating factor enhancer.

Development and in vitro characterization of a GM-CSF secreting human ovarian carcinoma tumor vaccine.

A human ovarian carcinoma cell line (UCI-107) was genetically engineered to secrete the cytokine granulocyte-macrophage colony stimulating factor (GM-CSF), by retroviral medicated gene transduction. This line was transduced with the LXSN retroviral vector containing the human GM-CSF gene and the neomycin resistance selection marker. Numerous GM-CSF secreting clones were randomly isolated and one clone, termed UCI-107M GM-CSF-MPS, extensively characterized. This clone was shown to constitutively secrete high levels of GM-CSF (ie 420-585 pg ml-1 105 cells-1 48 h-1 for over 35 passages and 6 months of study. Like the parental cell line UCI-107, UCI-107M GM-CSF-MPS cells expressed MHC class I and Her2/Neu surface antigens but did not express detectable MHC class II, ICAM-1 or CA-125. No change in the expression of these surface proteins was noted between the parental cells and this GM-CSF secreting clone. The morphology of UCI-107M GM-CSF-MPS did not differ from that of the parental or LXSN vector control cells; however, parental cells had a slightly faster growth rate than the transductants. UCI-107M GM-CSF-MPS was sensitive to gamma irradiation, since as little as 2500 rads killed the cells within 10 days of irradiation. However, even after higher doses of irradiation (ie 10000 rads), GM-CSF secretion continued in vitro until about day 8. Interestingly, irradiation induced up-regulation of the surface antigens previously expressed, and they remained up-regulated for as long as the cells remained viable. The potential use of these GM-CSF secreting ovarian carcinoma cells as vaccines for women with advanced ovarian cancer will be discussed.