Human Cytomegalovirus DNA Replication Research Articles

Identification of a leucine-zipper motif in pUL51 essential for HCMV replication and potential target for antiviral development

Human cytomegalovirus (HCMV) can cause serious diseases in immunocompromised patients. Use of current antivirals is limited by their adverse effects and emergence of drug resistance mutations. Thus, new drugs are an urgent need. The terminase complex (pUL56-pUL89-pUL51) represents a target of choice for new antivirals development. pUL51 was shown to be crucial for the cleavage of concatemeric HCMV DNA and viral replication. Its C-terminal part plays a critical role for the terminase complex assembly. However, no interaction domain is clearly identified. Sequence comparison of herpesvirus homologs and protein modelling were performed on pUL51. Importance of a putative interaction domain is validated by the generation of recombinant viruses with specific alanine substitutions of amino acids implicated in the domain. We identified a Leucine-Zipper (LZ) domain involving the leucine residues L126-X6-L133-X6-L140-X6-L147 in C-terminal part of pUL51. These leucines are crucial for viral replication, suggesting the significance for pUL51 structure and function. A mimetic-peptide approach has been used and tested in antiviral assays to validate the interaction domain as a new therapeutic target. Cytotoxicity was evaluated by LDH release measurement. The peptide TAT-HK29, homologous to the pUL51-LZ domain, inhibits HCMV replication by 27% ± 9% at 1.25 μM concentration without cytotoxicity. Our results highlight the importance of a leucine zipper domain in the C-terminal part of pUL51 involving leucines L126, L133, L140 and L147. We also confirm the potential of mimetic peptides to inhibit HCMV replication and the importance to target interaction domains to develop antiviral agents.

Functional regulation of the structure-specific endonuclease FEN1 by the human cytomegalovirus protein IE1 suggests a role for the re-initiation of stalled viral replication forks.

Flap endonuclease 1 (FEN1) is a member of the family of structure-specific endonucleases implicated in regulation of DNA damage response and DNA replication. So far, knowledge on the role of FEN1 during viral infections is limited. Previous publications indicated that poxviruses encode a conserved protein that acts in a manner similar to FEN1 to stimulate homologous recombination, double-strand break (DSB) repair and full-size genome formation. Only recently, cellular FEN1 has been identified as a key component for hepatitis B virus cccDNA formation. Here, we report on a novel functional interaction between Flap endonuclease 1 (FEN1) and the human cytomegalovirus (HCMV) immediate early protein 1 (IE1). Our results provide evidence that IE1 manipulates FEN1 in an unprecedented manner: we observed that direct IE1 binding does not only enhance FEN1 protein stability but also phosphorylation at serine 187. This correlates with nucleolar exclusion of FEN1 stimulating its DSB-generating gap endonuclease activity. Depletion of FEN1 and inhibition of its enzymatic activity during HCMV infection significantly reduced nascent viral DNA synthesis demonstrating a supportive role for efficient HCMV DNA replication. Furthermore, our results indicate that FEN1 is required for the formation of DSBs during HCMV infection suggesting that IE1 acts as viral activator of FEN1 in order to re-initiate stalled replication forks. In summary, we propose a novel mechanism of viral FEN1 activation to overcome replication fork barriers at difficult-to-replicate sites in viral genomes.

In vitro co-infection by cytomegalovirus improves the antiviral activity of ganciclovir against human adenovirus

Human adenovirus (HAdV) infection has an important clinical impact in the immunosuppressed population and is associated with high morbidity and mortality rates. The lack of a specific, safe and effective antiviral treatment against HAdV makes necessary the search for new therapeutic options. The aim of this study was to evaluate the in vitro activity of ganciclovir (GCV) against HAdV in co-infection by human cytomegalovirus (HCMV) and HAdV in cellular cultures. Quantitative real-time polymerase chain reaction (qPCR) was used to measure HAdV and HCMV DNA replication efficiency in monocultures and in co-infection situations in the presence of both cidofovir (CDV) and GCV. The effects of GCV and CDV were also evaluated in a burst assay (used to measure the production of virus particles) for both viruses, alone and in combination. GCV decreased by 1-log the HAdV DNA replication efficiency in co-infection with HCMV compared with its activity in HAdV monoculture. The burst assay showed that the reductions in virus yield in the presence of GCV were higher for HCMV and co-infection than for HAdV in monoculture (145.2±35.5- vs. 116.4±27.3- vs. 23.0±10.0-fold, respectively, P<0.05). The improved anti-HAdV activity of GCV during co-infection may be because of the more efficient phosphorylation of GCV by the HCMV protein kinase, UL97. Patients treated with GCV as pre-emptive therapy for HCMV infection may be considered as low-risk for developing HAdV infections; however, further evaluations are required to confirm these results.

Induction of interleukin-11 mediated by RhoA GTPase during human cytomegalovirus lytic infection

Human cytomegalovirus (HCMV) is a ubiquitous pathogen which periodically reactivates, causing severe clinical consequences in immunosuppressed patients, organ and stem cell transplant recipients or newborn babies with congenital infections. HCMV infection stimulates the expression of several proinflammatory cytokines, which may contribute to the pathogenesis of the infection. Rho GTPases mediate cytokine expression while increasing evidence implicates them in important aspects of HCMV life cycle. Here, we studied the role of RhoA on the interleukin 11 (IL-11) release in HCMV-infected fibroblasts. Human fibroblasts, either endogenously expressing or silenced for RhoA, were infected by HCMV or UV-inactivated virus and IL-11 transcription and secretion were evaluated. We found that HCMV lytic infection increased the IL-11 levels, both in terms of transcription and translation. Both infectious and non-infectious HCMV particles were able to induce the IL-11 production. The depletion of RhoA resulted in an even higher release of IL-11, revealing the implication of this specific Rho isoform in this biological event. Finally, infection of cells in the presence of the HCMV DNA replication inhibitor, ganciclovir, significantly reduced the secretion of IL-11, strongly associating its induction with active viral DNA replication. Collectively, these data demonstrate, for the first time, a novel role of RhoA GTPase during HCMV lytic infection, regulating the activation of an immune response through IL-11.

Characterisation of a human antibody that potentially links cytomegalovirus infection with systemic lupus erythematosus

Human cytomegalovirus (HCMV) is a ubiquitous herpesvirus that has been linked with the development of systemic lupus erythematosus (SLE). Thus far, molecular mimicry has been implicated as the principal mechanism that explains this association. In this study, we characterise a potential alternative process whereby HCMV contributes to SLE. In a cohort of SLE patients, we show a significant association between HCMV infection and SLE through a human antibody response that targets UL44. UL44 is an obligate nuclear-resident, non-structural viral protein vital for HCMV DNA replication. The intracellular nature of this viral protein complicates its targeting by the humoral response – the mechanism remains unresolved. To characterise this response, we present a thorough molecular analysis of the first human monoclonal antibody specific for UL44 derived from a HCMV seropositive donor. This human antibody immunoprecipitates UL44 from HCMV-infected cells together with known nuclear-resident SLE autoantigens – namely, nucleolin, dsDNA and ku70. We also show that UL44 is redistributed to the cell surface during virus-induced apoptosis as part of a complex with these autoantigens. This phenomenon represents a potential mechanism for the bystander presentation of SLE autoantigens to the humoral arm of our immune system under circumstances that favour a break in peripheral tolerance.

Expression of Oncogenic Alleles Induces Multiple Blocks to Human Cytomegalovirus Infection.

In contrast to many viruses, human cytomegalovirus (HCMV) is unable to productively infect most cancer-derived cell lines. The mechanisms of this restriction are unclear. To explore this issue, we tested whether defined oncogenic alleles, including the simian virus 40 (SV40) T antigen (TAg) and oncogenic H-Ras, inhibit HCMV infection. We found that expression of SV40 TAg blocks HCMV infection in human fibroblasts, whereas the replication of a related herpesvirus, herpes simplex virus 1 (HSV-1), was not impacted. The earliest restriction of HCMV infection involves a block of viral entry, as TAg expression prevented the nuclear delivery of viral DNA and pp65. Subsequently, we found that TAg expression reduces the abundance of platelet-derived growth factor receptor α (PDGFRα), a host protein important for HCMV entry. Viral entry into TAg-immortalized fibroblasts could largely be rescued by PDGFRα overexpression. Similarly, PDGFRα overexpression in HeLa cells markedly increased the levels of HCMV gene expression and DNA replication. However, the robust production of viral progeny was not restored by PDGFRα overexpression in either HeLa cells or TAg-immortalized fibroblasts, suggesting additional restrictions associated with transformation and TAg expression. In TAg-expressing fibroblasts, expression of the immediate early 2 (IE2) protein was not rescued to the same extent as that of the immediate early 1 (IE1) protein, suggesting that TAg expression impacts the accumulation of major immediate early (MIE) transcripts. Transduction of IE2 largely rescued HCMV gene expression in TAg-expressing fibroblasts but did not rescue the production of infectious virions. Collectively, our data indicate that oncogenic alleles induce multiple restrictions to HCMV replication. HCMV cannot replicate in most cancerous cells, yet the causes of this restriction are not clear. The mechanisms that restrict viral replication in cancerous cells represent viral vulnerabilities that can potentially be exploited therapeutically in other contexts. Here we found that SV40 T antigen-mediated transformation inhibits HCMV infection at multiple points in the viral life cycle, including through inhibition of proper viral entry, normal expression of immediate early genes, and viral DNA replication. Our results suggest that the SV40 T antigen could be a valuable tool to dissect cellular activities that are important for successful infection, thereby potentially informing novel antiviral development strategies. This is an important consideration, given that HCMV is a leading cause of birth defects and causes severe infection in immunocompromised individuals.

Human cytomegalovirus RL13 protein interacts with host NUDT14 protein affecting viral DNA replication.

The interaction between the host and human cytomegalovirus (HCMV) is important in determining the outcome of a viral infection. The HCMV RL13 gene product exerts independent, inhibitory effects on viral growth in fibroblasts and epithelial cells. At present, there are few reports on the interactions between the HCMV RL13 protein and human host proteins. The present study provided direct evidence for the specific interaction between HCMV RL13 and host nucleoside diphosphate linked moiety X (nudix)‑type motif 14 (NUDT14), a UDP‑glucose pyrophosphatase, using two‑hybrid screening, an in vitro glutathione S‑transferase pull‑down assay, and co‑immunoprecipitation in human embryonic kidney HEK293 cells. Additionally, the RL13 protein was shown to co‑localize with the NUDT14 protein in the HEK293 cell membrane and cytoplasm, demonstrated using fluorescence confocal microscopy. Decreasing the expression level of NUDT14 via NUDT14‑specific small interfering RNAs increased the number of viral DNA copies in the HCMV‑infected cells. However, the overexpression of NUDT14 in a stably expressing cell line did not affect viral DNA levels significantly in the HCMV infected cells. Based on the known functions of NUDT14, the results of the present study suggested that the interaction between the RL13 protein and NUDT14 protein may be involved in HCMV DNA replication, and that NUDT14 may offer potential in the modulation of viral infection.

CTCF binding to the first intron of the major immediate early (MIE) gene of human cytomegalovirus (HCMV) negatively regulates MIE gene expression and HCMV replication.

Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.

Inhibition of human cytomegalovirus DNA replication by small interfering RNAs targeted to UL49

Human cytomegalovirus (HCMV) is a ubiquitous virus. Although the infection in healthy children and adults is usually asymptomatic, in immunocompromised individuals and newborns it is a significant cause of morbidity and mortality. UL49, an essential gene of HCMV, is highly conserved among various HCMV strains. The expression of UL49 is correlated with the production of virions. When UL49 is inhibited in the HCMV, the production of virions is reduced severely. In this study, RNA interference was applied to further investigate the roles of UL49 in viral replication. Two effective small interfering RNAs against UL49 were selected. Silencing of UL49 in HCMV-infected human foreskin fibroblast cells reduced the transcription levels of early and late genes, but not immediate-early ones. In addition, the viral DNA content was significantly reduced. This is the first time to uncover the role of UL49 in viral DNA synthesis, which indicates that UL49 might play an important role in this period. So the down-regulation of UL49 mRNA using RNAi might be a potential clinical therapy against the virus.

Depletion of Cellular Pre-Replication Complex Factors Results in Increased Human Cytomegalovirus DNA Replication

Although HCMV encodes many genes required for the replication of its DNA genome, no HCMV-encoded orthologue of the origin binding protein, which has been identified in other herpesviruses, has been identified. This has led to speculation that HCMV may use other viral proteins or possibly cellular factors for the initiation of DNA synthesis. It is also unclear whether cellular replication factors are required for efficient replication of viral DNA during or after viral replication origin recognition. Consequently, we have asked whether cellular pre-replication (pre-RC) factors that are either initially associated with cellular origin of replication (e.g. ORC2), those which recruit other replication factors (e.g. Cdt1 or Cdc6) or those which are subsequently recruited (e.g. MCMs) play any role in the HCMV DNA replication. We show that whilst RNAi-mediated knock-down of these factors in the cell affects cellular DNA replication, as predicted, it results in concomitant increases in viral DNA replication. These data show that cellular factors which initiate cellular DNA synthesis are not required for the initiation of replication of viral DNA and suggest that inhibition of cellular DNA synthesis, in itself, fosters conditions which are conducive to viral DNA replication.

Cyclophilin A is required for efficient human cytomegalovirus DNA replication and reactivation

Human cytomegalovirus (HCMV) is a large DNA virus belonging to the subfamily Betaherpesvirinae. Haematopoietic cells of the myeloid lineage have been shown to harbour latent HCMV. However, following terminal differentiation of these cells, virus is reactivated, and in an immunocompromised host acute infection can occur. It is currently unknown which viral and cellular factors are involved in regulating the switch between lytic and latent infections. Cyclophilin A (CyPA) is a cellular protein that acts as a major factor in virus replication and/or virion maturation for a number of different viruses, including human immunodeficiency virus, hepatitis C virus, murine cytomegalovirus, influenza A virus and vaccinia virus. This study investigated the role of CyPA during HCMV infection. CyPA expression was silenced in human foreskin fibroblast (HF) and THP-1 cells using small interfering RNA (siRNA) technology, or the cells were treated with cyclosporin A (CsA) to inhibit CyPA activity. Silencing CyPA in HF cells with siRNA resulted in an overall reduction in virus production characterized by delayed expression of immediate-early (IE) proteins, decreased viral DNA loads and reduced titres. Furthermore, silencing of CyPA in THP-1 cells pre- and post-differentiation prevented IE protein expression and virus reactivation from a non-productive state. Interestingly, it was observed that treatment of THP-1 cells with CsA prevented the cells from establishing a fully latent infection. In summary, these results demonstrate that CyPA expression is an important factor in HCMV IE protein expression and virus production in lytically infected HF cells, and is a major component in virus reactivation from infected THP-1 cells.

Possible Roles of UL112-113 Proteins in Human Cytomegalovirus DNA Replication

DNA replication of human cytomegalovirus (HCMV) is a highly regulated process that requires specific interactions between cis-acting lytic origin of replication (oriLyt) and trans-acting viral proteins. Formation of the replication initiation complex is also regulated by specific interactions among viral replication proteins. HCMV replication proteins include origin-binding proteins, core proteins that work in replication forks, and regulatory proteins that modulate host cell functions. This letter describes intriguing questions regarding how HCMV origin-binding proteins interact with oriLyt to initiate DNA replication and how the regulatory UL112-113 proteins, which are found only in beta-herpesviruses, function to promote viral DNA replication.

An E2F1-Mediated DNA Damage Response Contributes to the Replication of Human Cytomegalovirus

DNA damage resulting from intrinsic or extrinsic sources activates DNA damage responses (DDRs) centered on protein kinase signaling cascades. The usual consequences of inducing DDRs include the activation of cell cycle checkpoints together with repair of the damaged DNA or induction of apoptosis. Many DNA viruses elicit host DDRs during infection and some viruses require the DDR for efficient replication. However, the mechanism by which DDRs are activated by viral infection is poorly understood. Human cytomegalovirus (HCMV) infection induces a DDR centered on the activation of ataxia telangiectasia mutated (ATM) protein kinase. Here we show that HCMV replication is compromised in cells with inactivated or depleted ATM and that ATM is essential for the host DDR early during infection. Likewise, a downstream target of ATM phosphorylation, H2AX, also contributes to viral replication. The ATM-dependent DDR is detected as discrete, nuclear γH2AX foci early in infection and can be activated by IE proteins. By 24 hpi, γH2AX is observed primarily in HCMV DNA replication compartments. We identified a role for the E2F1 transcription factor in mediating this DDR and viral replication. E2F1, but not E2F2 or E2F3, promotes the accumulation of γH2AX during HCMV infection or IE protein expression. Moreover, E2F1 expression, but not the expression of E2F2 or E2F3, is required for efficient HCMV replication. These results reveal a novel role for E2F1 in mediating an ATM-dependent DDR that contributes to viral replication. Given that E2F activity is often deregulated by infection with DNA viruses, these observations raise the possibility that an E2F1-mediated mechanism of DDR activation may be conserved among DNA viruses.

Identification of putative functional motifs in viral proteins essential for human cytomegalovirus DNA replication

Six of the eleven genes essential for Human cytomegalovirus (HCMV) DNA synthesis have been analyzed for putative structural motifs that may have a significant functional role in DNA replication. The genes studied encode for the DNA polymerase accessory protein (UL44), single-stranded DNA binding protein (UL57), primase-helicase complex (UL70, UL102, and UL105), and the putative initiator protein (UL84). The full-length open reading frames of these genes were highly conserved between ten isolates with amino acid sequence identity of >97% for all genes. Using ScanProsite software from the Expert Protein Analysis System (ExPASy) proteomics server, we have mapped putative motifs throughout these HCMV replication genes. Interesting motifs identified include casein kinase-2 (CKII) phosphorylation sites, a microbodies signal motif in UL57, and an ATP binding site in the putative UL105 helicase. Our investigations have also elucidated motif-rich regions of the UL44 DNA polymerase accessory protein and identified cysteine motifs that have potential implications for UL57 and UL70 primase. Taken together, these findings provide insights to regions of these HCMV replication proteins that are important for post-translation modification, activation, and overall function, and this information can be utilized to target further research into these proteins and advance the development of novel antiviral agents that target these processes.

Human cytomegalovirus DNA replication: antiviral targets and drugs

Human cytomegalovirus (HCMV) infection is associated with severe morbidity and mortality in immunocompromised individuals, in particular transplant recipients and AIDS patients, and is the most frequent congenital viral infection in humans. There are currently five drugs approved for HCMV treatment: ganciclovir and its prodrug valganciclovir, foscarnet, cidofovir and fomivirsen. These drugs have provided a major advance in HCMV disease management, but they suffer from poor bioavailability, significant toxicity and limited effectiveness, mainly due to the development of drug resistance. Fortunately, there are several novel and potentially very effective new compounds which are under pre-clinical and clinical evaluation and may address these limitations. This review focuses on HCMV proteins that are directly or indirectly involved in viral DNA replication and represent already established or potential novel antiviral targets, and describes both currently available drugs and new compounds against such protein targets.

Human cytomegalovirus inhibits a DNA damage response by mislocalizing checkpoint proteins

The DNA damage checkpoint pathway responds to DNA damage and induces a cell cycle arrest to allow time for DNA repair. Several viruses are known to activate or modulate this cellular response. Here we show that the ataxia-telangiectasia mutated checkpoint pathway, which responds to double-strand breaks in DNA, is activated in response to human cytomegalovirus DNA replication. However, this activation does not propagate through the pathway; it is blocked at the level of the effector kinase, checkpoint kinase 2 (Chk2). Late after infection, several checkpoint proteins, including ataxia-telangiectasia mutated and Chk2, are mislocalized to a cytoplasmic virus assembly zone, where they are colocalized with virion structural proteins. This colocalization was confirmed by immunoprecipitation of virion proteins with an antibody that recognizes Chk2. Virus replication was resistant to ionizing radiation, which causes double-strand breaks in DNA. We propose that human CMV DNA replication activates the checkpoint response to DNA double-strand breaks, and the virus responds by altering the localization of checkpoint proteins to the cytoplasm and thereby inhibiting the signaling pathway.

Human Cytomegalovirus UL84 Is a Phosphoprotein That Exhibits UTPase Activity and Is a Putative Member of the DExD/H Box Family of Proteins

Human cytomegalovirus (HCMV) UL84 is required for lytic DNA replication and is proposed to be the key factor in initiation of viral DNA synthesis. We now show that UL84 has a high degree of homology to the DExD/H (where x can be any amino acid) box family of helicases, displays UTPase activity, and is phosphorylated at serine residues. Affinity column-purified UL84-FLAG fusion protein was used in an in vitro nucleoside triphosphatase (NTPase) assay to show that UL84 has NTPase activity, preferring UTP. This UTPase activity was linear with respect to enzyme concentration and slightly enhanced by the addition of nucleic acid substrates. UL84 UTPase was the highest at low salt concentrations, a pH of 7.5, and a temperature of 45 degrees C. The enzyme preferred Mg2+ as the divalent cation but was also able to catalyze the UTPase reaction in the presence of Mn2+, Ca2+, and Zn2+ albeit at lower levels. The evidence presented here suggests that the UL84 UTPase activity may be part of an energy-generating system for helicase activity associated with the initiation of HCMV DNA replication.

3,4′,5-Trihydroxy- trans-stilbene (resveratrol) inhibits human cytomegalovirus replication and virus-induced cellular signaling

Resveratrol is a polyphenolic natural product that is present in red wine and peanuts and has inhibitory activity against inflammation, heart disease, and cancer. Here we describe its inhibition of human cytomegalovirus replication (IC 50 = 1–2 μM). At least 50-fold higher concentrations of compound were required to produce cytotoxicity against growing or stationary human embryonic lung fibroblasts. Mechanism of action studies determined that resveratrol blocked virus-induced activation of the epidermal growth factor receptor (EGFR) and phosphatidylinositol-3-kinase signal transduction as well as NF-κB and Sp1 transcription factor activation shortly following infection. Resveratrol prevented the appearance of immediate-early, early, and late viral proteins. Human cytomegalovirus DNA replication was reduced to undetectable levels by treatment with resveratrol, as were the second (late) phases of virus-induced phosphatidylinositol-3-kinase signaling and transcription factor activation. Resveratrol lost substantial antiviral activity when its addition was delayed until 4 h postinfection. Compound reversibility and preincubation studies were inconsistent with a virucidal mechanism of action. These data indicated that this compound likely operated during attachment and entry. We hypothesize that the primary molecular target for resveratrol may be blockage of epidermal growth factor receptor activation and its downstream effectors.

3,4$prime;,5-Trihydroxy-trans-stilbene (resveratrol) inhibits human cytomegalovirus replication and virus-induced cellular signaling

Resveratrol is a polyphenolic natural product that is present in red wine and peanuts and has inhibitory activity against inflammation, heart disease, and cancer. Here we describe its inhibition of human cytomegalovirus replication (IC 50 = 1–2 μM). At least 50-fold higher concentrations of compound were required to produce cytotoxicity against growing or stationary human embryonic lung fibroblasts. Mechanism of action studies determined that resveratrol blocked virus-induced activation of the epidermal growth factor receptor (EGFR) and phosphatidylinositol-3-kinase signal transduction as well as NF-κB and Sp1 transcription factor activation shortly following infection. Resveratrol prevented the appearance of immediate-early, early, and late viral proteins. Human cytomegalovirus DNA replication was reduced to undetectable levels by treatment with resveratrol, as were the second (late) phases of virus-induced phosphatidylinositol-3-kinase signaling and transcription factor activation. Resveratrol lost substantial antiviral activity when its addition was delayed until 4 h postinfection. Compound reversibility and preincubation studies were inconsistent with a virucidal mechanism of action. These data indicated that this compound likely operated during attachment and entry. We hypothesize that the primary molecular target for resveratrol may be blockage of epidermal growth factor receptor activation and its downstream effectors.

Downregulation of the epidermal growth factor receptor by human cytomegalovirus infection in human fetal lung fibroblasts.

Epidermal growth factor plays a key role in late fetal lung development and differentiation as well as in regulating surfactant protein A synthesis, which is involved in innate immunity of the lung. Here we show that human cytomegalovirus (HCMV), a known lung pathogen in connatal and postnatal infection of neonates as well as transplant recipients, completely down-regulates EGF receptor (EGF-R) on the surface of human fetal lung fibroblasts. Inhibition of EGF-R synthesis occurs on the transcriptional rather than on the posttranscriptional level. The effect essentially depends on expression of viral immediate early and/or early genes, as binding of ultraviolet light-inactivated virus to the cells had no effect on EGF-R expression. Furthermore, the anti-HCMV drug ganciclovir, which blocks HCMV DNA replication and late gene expression, cannot overcome HCMV-mediated inhibition of EGF-R, suggesting that immediate early or early gene products may be responsible for down-regulation of EGF-R. Interestingly, the glucocorticoid dexamethasone, which is used for its antiinflammatory action to prevent chronic lung disease in preterm infants, promotes HCMV-associated downregulation of the EGF-R by stimulation of viral gene expression. From these data it can be hypothesized that the pathogenesis of HCMV lung infection involves down-regulation of EGF-R and that congenital HCMV infection may cause retardation in lung maturation and surfactant protein synthesis.