Human C3 Research Articles

A Novel Immunocompetent Rat Model of HCV Infection and Hepatitis

Hepatitis C virus (HCV) infects millions of people worldwide. Therapy is limited, and treatment does not produce a sustained response in the majority of patients. Development of new agents has been hampered by the lack of a convenient animal model. The aim of this study was to determine whether an immunocompetent rat, tolerized and transplanted with a human hepatoma cell line (Huh 7 cells), could be used to sustain an HCV infection. Fetal rats were tolerized in utero with 10(5) Huh 7 cells. One day after birth, rats were transplanted with 5 x 10(6) Huh 7 cells and, a week later, inoculated with HCV, genotype 1. In tolerized, transplanted, and HCV-infected rats, Huh 7 cells were found in the liver, and HCV viral replication was detected by the presence of negative strand HCV RNA. HCV levels in serum were measured at 11,000 copies/mL at week 4, peaked at 22,500 copies/mL by week 12. In tolerized, transplanted, inoculated rats, but not controls, serum alanine aminotransferase (ALT) values increased to 60 IU/L by week 4 and reached a peak of approximately 120 IU/L by week 13. Histology showed foci of mononuclear infiltrates in portal and central regions. HCV-inoculated immunocompetent rats tolerized and transplanted with Huh 7 cells support HCV gene expression, viral replication, and develop biochemical and histologic evidence of hepatitis.

Crystal Structure of Human Cystatin D, a Cysteine Peptidase Inhibitor with Restricted Inhibition Profile

Cystatins are natural inhibitors of papain-like (family C1) and legumain-related (family C13) cysteine peptidases. Cystatin D is a type 2 cystatin, a secreted inhibitor found in human saliva and tear fluid. Compared with its homologues, cystatin D presents an unusual inhibition profile with a preferential inhibition cathepsin S > cathepsin H > cathepsin L and no inhibition of cathepsin B or pig legumain. To elucidate the structural reasons for this specificity, we have crystallized recombinant human Arg(26)-cystatin D and solved its structures at room temperature and at cryo conditions to 2.5- and 1.8-A resolution, respectively. Human cystatin D presents the typical cystatin fold, with a five-stranded anti-parallel beta-sheet wrapped around a five-turn alpha-helix. The structures reveal differences in the peptidase-interacting regions when compared with other cystatins, providing plausible explanations for the restricted inhibitory specificity of cystatin D for some papain-like peptidases and its lack of reactivity toward legumain-related enzymes.

407. Complement Blockade Prevents Several Innate Toxicities Rapidly Induced after Intravenous Adenovirus (Ad) Vector Administration

Toxicities resulting from Ad capsid interactions with the innate immune system present numerous challenges for adenoviral gene transfer in vivo. In 2004: Mol. Ther. 10(6):1140-2, we demonstrated that Ads can initiate the human complement pathway via activation of the alternative complement pathway, and that the Ad capsid can directly bind to human C3 protein. After initial pathogen engagement by proteins of the classical and/or alternative complement pathways, C3 acts as a pivotal protein, initiating the subsequent activation of the common complement pathway. Activated complement proteins interact with Kupffer cells, platelets, and endothelial cells, and modulate several innate and adaptive immune response systems. Since several of these same systems have been implicated with Ad associated toxicities, we hypothesized that these toxicities may be significantly diminished by pre-emptive complement system blockade.

Treatment with recombinant human C1 inhibitor [rhC1INH]* produces rapid improvements in hereditary angioedema attacks,

Treatment with recombinant human C1 inhibitor [rhC1INH]* produces rapid improvements in hereditary angioedema attacks,

Suppression of NF-κB and NF-κB-regulated gene expression by sulforaphane and PEITC through IκBα, IKK pathway in human prostate cancer PC-3 cells

Recent studies indicate that natural isothiocyanates, such as sulforaphane (SFN) and phenethyl isothiocyanate (PEITC) possess strong antitumor activities in vitro and in vivo. The nuclear factor kappa B (NF-kappaB) is believed to play an important role in cancer chemoprevention due to its involvement in tumor cell growth, proliferation, angiogenesis, invasion, apoptosis, and survival. In this study, we investigated the effects and the molecular mechanisms of SFN and PEITC on NF-kappaB transcriptional activation and NF-kappaB-regulated gene expression in human prostate cancer PC-3 C4 cells. Treatment with SFN (20 and 30 microM) and PEITC (5 and 7.5 microM) significantly inhibited NF-kappaB transcriptional activity, nuclear transloction of p65, and gene expression of NF-kappaB-regulated VEGF, cylcin D1, and Bcl-X(L) in PC-3 C4 cells. To further elucidate the mechanism, we utilized the dominant-negative mutant of inhibitor of NF-kappaB alpha (IkappaBalpha) (SR-IkappaBalpha). Analogous to treatments with SFN and PEITC, SR-IkappaBalpha also strongly inhibited NF-kappaB transcriptional activity as well as VEGF, cylcin D1, and Bcl-X(L) expression. Furthermore, SFN and PEITC also inhibited the basal and UVC-induced phosphorylation of IkappaBalpha and blocked UVC-induced IkappaBalpha degradation in PC-3 C4 cells. In examining the upstream signaling, we found that the dominant-negative mutant of IKKbeta (dnIKKbeta) possessed inhibitory effects similar to SFN and PEITC on NF-kappaB, VEGF, cylcin D1, Bcl-X(L) as well as IkappaBalpha phosphorylation. In addition, treatment with SFN and PEITC potently inhibited phosphorylation of both IKKbeta and IKKalpha and significantly inhibited the in vitro phosphorylation of IkappaBalpha mediated by IKKbeta. Taken together, these results suggest that the inhibition of SFN and PEITC on NF-kappaB transcriptional activation as well as NF-kappaB-regulated VEGF, cyclin D1, and Bcl-X(L) gene expression is mainly mediated through the inhibition of IKK phosphorylation, particularly IKKbeta, and the inhibition of IkappaBalpha phosphorylation and degradation, as well as the decrease of nuclear translocation of p65 in PC-3 cells.

Roles for Nicotinic Acetylcholine Receptor Subunit Large Cytoplasmic Loop Sequences in Receptor Expression and Function

To evaluate possible physiological roles of the large cytoplasmic loops (C2) and neighboring transmembrane domains of nicotinic acetylcholine receptor (nAChR) subunits, we generated novel fusion constructs in which human nAChR alpha4, beta2, or beta4 subunit C2 or C2 and neighboring sequences were replaced by corresponding sequences from the mouse serotonin type 3A (5-HT3A) receptor subunit. Following stable expression in human SH-EP1 cells, we found that extensive sequence substitutions involving third and fourth transmembrane domains and neighboring "proximal" C2 sequences (e.g., beta2 H322-V335 and V449-R460) did not allow functional expression of nAChR containing chimeric subunits. However, expression of functional nAChR was achieved containing wild-type alpha4 subunits and chimeric beta2 (beta2chi) subunits whose "nested" C2 domain sequences K336-S448 were replaced with the corresponding 5-HT3A subunit sequences. Whereas these findings suggested indispensable roles for M3/M4 transmembrane and/or proximal C2 sequences in alpha4beta2-nAChR function, nested C2 sequences in the beta2 subunit are not essential for functional receptor expression. Ligand-binding analyses also revealed only subtle differences in pharmacological profiles of alpha4beta2-nAChR compared with alpha4beta2chi-nAChR. Nevertheless, there was heightened emergence of agonist-mediated self-inhibition of alpha4beta2chi function, greater sensitivity to functional blockade by a number of antagonists, and faster and more complete acute desensitization of alpha4beta2chi-nAChR than for alpha4beta2-nAChR. These studies are consistent with unexpected roles of nested C2 sequences in nAChR function.

The enhancement effect of CaCl 2 on solid substrate room temperature phosphorescence of polyhalogenated derivatives of fluorescein and application in immunoassay

It was found that the solid substrate room temperature phosphorescence (SS-RTP) signal of some polyhalogenated derivatives of fluorescein (including eosin5-isothiocyanate) on a polyamide membrane can be enhanced obviously when an external inorganic salt was introduced into the system. The enhancement effect (RTP intensity and the ratio of signal to noise) of CaCl 2 was much more notable than those of typical heavy atom perturbers in phosphorimetry, such as Pb(AC) 2 and Hg(NO 3) 2, etc. According to that, a solid substrate room temperature phosphorescence immunoassay (SS-RTP-IA) with eosin5-isothiocyanate as a marker and CaCl 2 as an enhancer for the determination of human complement 3 was developed. On a polyamide membrane, SS-RTP signals ( λ ex/ λ em = 532 nm/685 nm) of the immune complex are in linear correlation to the amount of human C3 in the range of 0.156–5.00 pg/spot (the sample volume was 0.4 μL/spot, corresponding concentration was 0.391–12.5 ng/mL). The regression equation of working curve can be expressed as Δ I p (Δ I p = I sample − I blank) = 1.57 + 0.633 m C3 (pg/spot), correlation coefficient r = 0.998. The detection limit calculated as 3 S b/ k is 0.12 pg/spot. The method was directly applied to the determination of human complement 3 in human serums with satisfactory results. These results proved sufficiently that eosin-ITC is a good phosphorescent marker, while CaCl 2 was used as the enhancer. Obviously, the results will expand the application area of these luminescent molecules, and using CaCl 2 instead of Pb(AC) 2 as a phosphorescence enhancer is more favorable for environment.

Regulation of Complement C3 Expression by the Bile Acid Receptor FXR

The farnesoid X receptor (FXR; NR1H4) is an intracellular bile acid-sensing transcription factor that plays a critical role in the regulation of synthesis and transport of bile acids as well as lipid metabolism. Although the reciprocal relationship between bile acid and triglyceride levels is well known, the mechanism underlying this link is not clearly defined. In this study, we demonstrate that FXR regulates the expression of at least two secreted factors, complement component C3 and FGF15, the rat ortholog of FGF19, known to influence lipid metabolism. The analysis of the human complement C3 gene reveals the presence of functional FXR response elements in the proximal promoter of C3. Furthermore, rats given a single dose of an FXR agonist exhibit an increase in the plasma concentration of complement C3 protein. These studies demonstrate a mechanism by which FXR, a nuclear receptor with a limited tissue expression pattern, regulates secretion of factors that ultimately can affect lipid metabolism in an endocrine or paracrine manner.

Functional Insights from the Structure of the Multifunctional C345C Domain of C5 of Complement

The complement protein C5 initiates assembly of the membrane attack complex. This remarkable process results in lysis of target cells and is fundamental to mammalian defense against infection. The 150-amino acid residue domain at the C terminus of C5 (C5-C345C) is pivotal to C5 function. It interacts with enzymes that convert C5 to C5b, the first step in the assembly of the membrane attack complex; it also binds to the membrane attack complex components C6 and C7 with high affinity. Here a recombinant version of this C5-C345C domain is shown to adopt the oligosaccharide/oligonucleotide binding fold, with two helices packed against a five-stranded beta-barrel. The structure is compared with those from the netrin-like module family that have a similar fold. Residues critical to the interaction with C5-convertase cluster on a mobile, hydrophobic inter-strand loop that protrudes from the open face of the beta-barrel. The opposite, helix-dominated face of C5-C345C carries a pair of exposed hydrophobic side chains adjacent to a striking negatively charged patch, consistent with affinity for positively charged factor I modules in C6 and C7. Modeling of homologous domains from complement proteins C3 and C4, which do not participate in membrane attack complex assembly, suggests that this provisionally identified C6/C7-interacting face is indeed specific to C5.

Molecular cloning of TRPC3a, an N-terminally extended, store-operated variant of the human C3 transient receptor potential channel

AK032317 is the GenBank accession no. of a full-length RIKEN mouse cDNA. It encodes a putative variant of the C3-type TRPC (transient receptor potential channel) that differs from the previously cloned murine TRPC3 cDNA in that it has a 5' extension stemming from inclusion of an additional exon (exon 0). The extended cDNA adds 62 aa to the sequence of the murine TRPC3. Here, we report the cloning of a cDNA encoding the human homologue of this extended TRPC3 having a highly homologous 73-aa N-terminal extension, referred to as hTRPC3a. A query of the GenBank genomic database predicts the existence of a similar gene product also in rats. Transient expression of the longer TRPC3a in human embryonic kidney (HEK) cells showed that it mediates Ca2+ entry in response to stimulation of the Gq-phospholipase C beta pathway, which is similar to that mediated by the shorter hTRPC3. However, after isolation of HEK cells expressing hTRPC3 in stable form, TRPC3a gave rise to Ca2+-entry channels that are not only activated by the Gq-phospholipase C beta pathway (receptor-activated Ca entry) but also by thapsigargin triggered store depletion. In conjunction with findings from our and other laboratories that TRPC1, TRPC2, TRPC4, TRPC5, and TRPC7, can each mediate store-depletion-activated Ca2+ entry in mammalian cells, our findings with hTRC3a support our previous proposal that TRPCs form capacitative Ca-entry channels.

Exposure to Organic Dust Causes Activation of Human Plasma Complement Factors C3 and B and the Synthesis of Factor C3 by Lung Epithelial Cells In Vitro

Exposure in swine confinement buildings induces an intense airway inflammation. Twenty-two volunteers, of whom eleven wore a half-mask, were exposed for 3 hr in a swine barn. Blood samples were drawn before and after exposure. The ratio C3b/totalC3 in plasma decreased from 6.8 to 5.0% (p = 0.02) without mask and from 6.6 to 5.9% (p = 0.01) with mask (p = 0.67 between groups). The ratio Bb/totalB decreased from 14.5 to 13.5% (p < 0.01) without and 14.6-13.3% (p = 0.09) with mask (p = 0.25 between groups). Epithelial cells (A549) incubated up to 24 hr with 0.1 mg/mL dust suspensions were analysed for C3, IL-6 and IL-8 secretion. Cumulative C3 synthesis of dust stimulated cell cultures was 43,000 pg/mL compared to 25,000 pg/mL in unstimulated cells. Cumulative dust-induced IL-6 and IL-8 secretion was 200 and 3000 pg/mL, respectively and below detection in unstimulated cells. The activation of complement in vivo and induced C3 synthesis by epithelial cells suggests a role of complement in the airway reaction to organic dust exposure.

Clinical studies of recombinant human C1 inhibitor in subjects with hereditary angioedema

RATIONALE: Recurrent attacks of subcutaneous and/or submucosal angioedema in subjects with hereditary angioedema (HAE) results from uncontrolled activation of the contact and complement systems due to a congenital deficiency of functional C1 inhibitor in plasma. Recombinant human C1 inhibitor (rhC1INH) was isolated from the milk of transgenic rabbits for replacement therapy in subjects with HAE. RhC1INH was highly similar to plasma-derived C1INH and appeared safe in preclinical studies.

Pharmacologic C5-Complement Suppression Reduces Blood Loss During On-Pump Cardiac Surgery

Inflammation contributes to morbidity following on-pump cardiac surgery. Complement activation during cardiopulmonary bypass has been associated with the postoperative bleeding and tissue injury. This study examines the pharmacology and impact on blood loss of complement C5 suppression with pexelizumab in patients undergoing cardiac surgery with cardiopulmonary bypass. Pexelizumab, a humanized monoclonal antibody single-chain fragment that binds to the human C5 complement component, was studied in a Phase II multicentered clinical trial. CABG (n = 800) and CABG with concomitant valve surgery (n = 114) patients were evaluated. Patients were randomized to either: pexelizumab bolus (2.0 mg/kg) + placebo infusion; pexelizumab bolus (2.0 mg/kg) + pexelizumab infusion (0.05 mg/kg/hour for 24 hours); or placebo bolus + placebo infusion. Pharmacology, chest tube drainage, and transfusion requirements were assessed. Mean maximum pexelizumab serum concentration was similar for bolus and bolus + infusion-treated patients. Complement-dependent serum hemolytic activity was completely suppressed within 1 hour following pexelizumab bolus, however, suppression was maintained for a longer duration in the bolus + infusion compared to the bolus-only treated patients. A reduction in chest tube drainage was observed for all pexelizumab-treated patients, although transfusion of blood products was similar across all study groups. Pexelizumab administration inhibits complement-dependent hemolytic activity and is associated with a reduction in postoperative chest tube drainage in patients undergoing cardiac surgery requiring cardiopulmonary bypass. Further, clinical studies are needed to assess the value of complement attenuation in this setting.

The ancient origin of the complement system

The complement system has been thought to originate exclusively in the deuterostomes. Here, we show that the central complement components already existed in the primitive protostome lineage. A functional homolog of vertebrate complement 3, CrC3, has been isolated from a 'living fossil', the horseshoe crab (Carcinoscorpius rotundicauda). CrC3 resembles human C3 and shows closest homology to C3 sequences of lower deuterostomes. CrC3 and plasma lectins bind a wide range of microbes, forming the frontline innate immune defense system. Additionally, we identified CrC2/Bf, a homolog of vertebrate C2 and Bf that participates in C3 activation, and a C3 receptor-like sequence. Furthermore, complement-mediated phagocytosis of bacteria by the hemocytes of horseshoe crab was also observed. Thus, a primitive yet complex opsonic complement defense system is revealed in the horseshoe crab, a protostome species. Our findings demonstrate an ancient origin of the critical complement components and the opsonic defense mechanism in the Precambrian ancestor of bilateral animals.

Recombinant Adenovirus Vectors Activate the Alternative Complement Pathway, Leading to the Binding of Human Complement Protein C3 Independent of Anti-Ad Antibodies

Recombinant adenoviruses are one of the most common gene transfer vectors utilized in human clinical trials, but it is also clear that systemic administration of this virus will be met by host innate and adaptive antiviral immune responses. One element of innate immunity is the complement system, a group of proteins that has evolved to rapidly recognize foreign microbes and viruses and to clear them from the circulatory system prior to their gaining entry to vulnerable host cells. Excessive complement activation can initiate or propagate a number of deleterious inflammatory responses, by release of potent cytokines and anaphylatoxins and/or by direct cellular toxicity. These reactions can progress rapidly and are factors important in serious complications, including the systemic inflammatory response syndrome and the adult respiratory distress syndrome.

Blocking Complement-Mediated Hemolysis of PNH Erythrocytes by RNA Aptamers to C8 and C9.

Paroxysmal nocturnal hemoglobinuria (PNH) is an acquired hematopoietic stem cell disorder characterized by intravascular hemolysis, venous thrombosis, and bone marrow failure. The lack of GPI-anchored complement regulatory proteins, such as CD55 (DAF) but especially CD59 (MIRL), results in complement-mediated hemolysis and hemoglobinuria, which are major clinical manifestations of PNH and an important cause of morbidity and mortality. Recent results from a pilot study in patients with PNH, using a humanized monoclonal antibody (eculizumab) that binds to human complement C5 and inhibits terminal complement activation, suggested that blocking complement activation is a new potential therapeutic option for PNH that could control hemolysis, reduce transfusion dependency, and possibly reduce the risk of thrombosis (N Engl J Med , 350:552, 2004). RNA aptamer inhibitors of human complement protein C5 have already been identified using a combinatorial RNA library and an in vitro selection method (SELEX) (Immunopharmacology , 42:219, 1999). We previously synthesized a known C5-binding aptamer (TCTCATGCGCCGAGTGTGAGTTTACCTTCGT) and found that it inhibited human serum hemolytic activity (Blood , 102:510a, 2003). However, since C5 is critical not only for complement activation, but also for proper regulation of inflammatory processes, prolonged C5 inhibition could have undesired side effects that would limit its utility in PNH. Terminal complement proteins C8 and C9 represent potentially better targets, since CD59 inhibits C9 binding to the C5b8 complex, and is critically important in protecting erythrocytes from complement-mediated lysis. Individuals deficient in C9 are usually healthy, although inherited deficiencies in other complement proteins typically lead to various degrees of illness. Thus, C8 or C9 may be the ideal targets to protect PNH erythrocytes from complement-mediated lysis without adverse side effects. Using the SELEX procedure against purified C8 and C9 proteins, high affinity, nuclease-resistant RNA ligands were identified that bind specifically to C8 or C9. After 6 rounds of SELEX, C8 aptamers bound C8 with a Kd of 1 nM and a Bmax of 83%, and inhibited human serum hemolytic activity similar to or greater than C5 aptamers. After 16 rounds of SELEX, C9 aptamers bound C9 with a Kd of 12 nM and a Bmax of 58%, and also inhibited human serum hemolytic activity similar to or greater than C5 aptamers. C8 aptamers after 6 rounds, and C9 aptamers after 16 rounds, of SELEX have been cloned, sequenced, and categorized. All ten C8 aptamer clones had a similar sequence, while nine C9 aptamer clones had two families of similar sequences (n=5 and n=3, respectively). These clones are currently been synthesized for testing in both the binding and hemolytic inhibition assays. Selected high-affinity and high inhibitory aptamers will be modified in preparation for future in vivo studies in PNH. The development of blocking RNA aptamers, using the SELEX procedure against terminal complement proteins C8 and C9, represents a novel potential therapeutic option for patients with PNH.

Treatment with an Anti-C3b/iC3b Monoclonal Antibody as an Adjuvant to Rituximab Enhances the Killing of Non-Hodgkin's Lymphoma and Chronic Lymphocytic Leukemia Cells.

Complement-dependent cytotoxicity (CDC) is a key mechanism of Rituximab® (RTX) action in killing Non-Hodgkin's Lymphoma (NHL) cells both in vitro and in vivo. Here we present studies of a mouse/human chimeric monoclonal antibody (Mab), ETI-210, specific for human complement C3 cleavage products C3b and iC3b, in enhancing RTX- mediated killing in vitro and ex vivo. Raji (NHL), primary NHL, and CLL cells were treated with RTX and ETI-210 in the presence of normal human serum (NHS) as a source of complement. Cell death was determined by propidium iodide staining or reduction of Alamar Blue®. After 1 hour of treatment, the killing of Raji cells by RTX plus ETI-210 plus NHS was observed to be 30–70% greater than that of RTX alone plus NHS by either detection method. The enhancing effect of ETI-210 was also seen in longer-term treatment (1 – 2 days). The killing by RTX plus ETI-210 was much lower in the absence of NHS than in the presence of NHS. ETI-210 was also tested ex vivo against primary cells from 12 NHL and 9 CLL patients. In 5 NHL samples, ETI-210 significantly enhanced RTX-mediated killing; in the remaining samples RTX alone already caused killing above 90%. The Mab also increased RTX-mediated killing in 4 out of 9 CLL samples. A pilot study examining the safety of administrating ETI-210 (5 and 30 mg/kg) with or without RTX was performed in cynomolgus monkeys. There were no cardiovascular changes. Clinical chemistry (potassium, glucose, sodium), liver function (alkaline phosphatase, ALT, albumin, total protein), kidney function (BUN, creatine, serum electrolytes) and hematological parameters (CBC profile, hemoglobin, MCV, MCH, MCHC) were not changed significantly. There was a transient reduction in CH50 values in the 30mg/kg ETI-210 group, which was independent of RTX administration. Serum concentrations of C3 and C4 were not affected. Because, ETI-210, a chimeric anti-C3b/iC3b Mab, was able to substantially enhance RTX-mediated killing of lymphoma cells via complement-mediated lysis and did not cause toxicity in monkeys, ETI-210 is being developed as a therapeutic agent for NHL and CLL treatment.

Differential Immunodominance of Human and Porcine Factor VIII in Hemophilia A Mice.

Hemophilia A inhibitor patients and patients with acquired hemophilia A recognize immunodominant epitopes in the A2 and C2 domains of human factor VIII (fVIII). Hemophilia A mice also recognize A2 and C2 domain epitopes when immunized with human fVIII using a dosing schedule that mimics clinical use. We compared the immune responses of hemophilia A mice to human and porcine fVIII using a domain specific ELISA. In this assay, monoclonal antibodies are tested against a panel of six single human fVIII domain hybrid human/porcine fVIII molecules that contain the human A1, A2, ap, A3, C1 or C2 domains. With anti-human antibodies, a positive signal with one of the single human domain proteins identifies domain specificity, whereas loss of signal indicates domain specificity of anti-porcine fVIII antibodies. Exon16 (E16) - disrupted hemophilia A mice (n = 3) received six weekly μ10 g/kg intravenous injections of recombinant B-domain deleted human fVIII and a final 25 μg/kg boost. To obtain comparable inhibitor titers, E16 mice (n = 3) received six weekly injections of μ40 g/kg of recombinant B-domain deleted porcine fVIII. Spleens from high titer mice were fused with NS1 mouse myeloma cells and 485 of the resulting hybridomas were analyzed for fVIII domain specificity (Table). Only two hybridomas secreted antibodies specific for the ap domain. Human fVIII elicited a significantly greater number of antibodies to the A2 domain, whereas porcine fVIII elicited a significantly greater number of antibodies to the A1 and A3 domains (p < 0.01, chi square test). The greater number of anti-C2 antibodies to human fVIII was not significant at the 95% confidence level (p = 0.08). The differential immunodominance of human and porcine fVIII epitopes suggests that it may be possible to design a recombinant hybrid human/porcine fVIII molecule that is less immunogenic than human fVIII in the treatment of patients with hemophilia A.Domain Specificity of Anti-FVIII MAbsMouse ID: ImmunogenNo. of MAbsA1A2A3C1C2CR & MD1- Human fVIII95216272123 & 242- Human fVIII1261323122739 & 213- Human fVIII5411521109 & 154- Porcine fVIII1233971981633 & 05- Porcine fVIII271350042 & 36- Porcine fVIII6096121913 & 10CR: Cross Reactive MD: Multidomain

Engineering of human complement component C3 for catalytic inhibition of complement

As a novel therapeutic approach in complement-mediated pathologies, we recently developed a human C3 derivative capable of obliterating functional complement by a catalytic, non-inhibitory mechanism. In this derivative, the C-terminal region of hC3 was substituted by a 275 amino acid sequence derived from the corresponding sequence of cobra venom factor (CVF), a complement-activating C3b homologue from snake venom. In this study, we replaced shorter C-terminal sequences of hC3 by corresponding CVF sequences to further reduce potential immunogenicity and to identify domains essential for the formation of functionally stable C3 convertases. In one of these derivatives that is still capable of obliterating functional complement in vitro, the non-human portion could be reduced to a small domain located in the C-terminus of different complement proteins. This conserved NTR/C345C motif is known to be involved in assembly of different convertases of the complement system. These results suggest a major role of the C345C domain in the regulation of the half-life of the C3 convertase. Moreover, its overall identity of 96% to human C3 renders this derivative a promising candidate for therapeutic intervention in complement-mediated pathologies.

Human Leukotriene C4 Synthase at 4.5 Å Resolution in Projection

Leukotriene (LT) C(4) synthase, an 18 kDa integral membrane enzyme, conjugates LTA(4) with reduced glutathione to form LTC(4), the parent compound of all cysteinyl leukotrienes that play a crucial role in the pathobiology of bronchial asthma. We have calculated a projection map of recombinant human LTC(4) synthase at a resolution of 4.5 A by electron crystallography, which shows that the enzyme is a trimer. A map truncated at 7.5 A visualizes four transmembrane alpha helices per protein monomer. The densities in projection indicate that most of the alpha helices run nearly perpendicular to the plane of the membrane. At this resolution, LTC(4) synthase is strikingly similar to microsomal glutathione S-transferase 1, which belongs to the same gene family but bears little sequence identity and no resemblance in substrate specificity to the LTC(4) synthase. These results provide new insight into the structure and function of membrane proteins involved in eicosanoid and glutathione metabolism.