Huludao City Research Articles

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Discussion on the Main Types of Diseases and Insect Pests of Ancient Trees and Their Control Techniques in Huludao City

Discussion on the Main Types of Diseases and Insect Pests of Ancient Trees and Their Control Techniques in Huludao City

Isolation and Identification of a Vibrio alginolyticus Bacteriophage Va2001 and Its Application to Oysters

In order to develop the cleaning agent for Vibrio alginolyticus in aquatic products, about 60 pieces of seafood and sewage in their breeding environment were collected from aquatic product market and farmer’s market in Jinzhou City, Bijiashan sea area, supermarkets, an aquaculture farm in Huludao City, and a breeding farm in Anshan City, etc. A virulent phage strain, named Va2001, was obtained by isolating and purifying with double-layer plate method. The biological characteristics of Va2001, such as the lysis spectrum, optimal multiplicity of infection, one-step growth curve, temperature, and pH stability, were studied. In addition, the effect of bacteriophages clearing V. alginolyticus was determined in the oyster infection model. The results showed that the phage Va2001 belongs to the Podoviridae family of order Caudovirales. Va2001 had a narrow lysis spectrum, with a lysis rate of 32%. The optimal multiplicity of infection was 0.0001 and the incubation period was about 20 min. The lytic period was 100 min and the average burst size was 274 PFU/cell. The activity was stable in the range of 4~60 ℃ and pH4~9. The results of the cleaning test using oysters as the infection model showed that the bacteriophage Va2001 could inhibit the growth of V. alginolyticus in the breeding environment and reduce the content of V. alginolyticus in oysters. When the breeding time was extended to 72 hours, the number of V. alginolyticus in the experiment group decreased by about 2 lg. The results of this study indicate that the bacteriophage Va2001 has good application prospects and can be used as a new biological cleaning agent of V. alginolyticus in seafood.

Effects and interaction of meteorological factors on hemorrhagic fever with renal syndrome incidence in Huludao City, northeastern China, 2007-2018.

BackgroundHemorrhagic fever with renal syndrome (HFRS), a rodent-borne disease, is a severe public health threat. Previous studies have discovered the influence of meteorological factors on HFRS incidence, while few studies have concentrated on the stratified analysis of delayed effects and interaction effects of meteorological factors on HFRS.ObjectiveHuludao City is a representative area in north China that suffers from HFRS with primary transmission by Rattus norvegicus. This study aimed to evaluate the climate factors of lag, interaction, and stratified effects of meteorological factors on HFRS incidence in Huludao City.MethodsOur researchers collected meteorological data and epidemiological data of HFRS cases in Huludao City during 2007–2018. First, a distributed lag nonlinear model (DLNM) for a maximum lag of 16 weeks was developed to assess the respective lag effect of temperature, precipitation, and humidity on HFRS incidence. We then constructed a generalized additive model (GAM) to explore the interaction effect between temperature and the other two meteorological factors on HFRS incidence and the stratified effect of meteorological factors.ResultsDuring the study period, 2751 cases of HFRS were reported in Huludao City. The incidence of HFRS showed a seasonal trend and peak times from February to May. Using the median WAT, median WTP, and median WARH as the reference, the results of DLNM showed that extremely high temperature (97.5th percentile of WAT) had significant associations with HFRS at lag week 15 (RR = 1.68, 95% CI: 1.04–2.74) and lag week 16 (RR = 2.80, 95% CI: 1.31–5.95). Under the extremely low temperature (2.5th percentile of WAT), the RRs of HFRS infection were significant at lag week 5 (RR = 1.28, 95% CI: 1.01–1.67) and lag 6 weeks (RR = 1.24, 95% CI: 1.01–1.57). The RRs of relative humidity were statistically significant at lag week 10 (RR = 1.19, 95% CI: 1.00–1.43) and lag week 11 (RR = 1.24, 95% CI: 1.02–1.50) under extremely high relative humidity (97.5th percentile of WARH); however, no statistically significance was observed under extremely low relative humidity (2.5th percentile of WARH). The RRs were significantly high when WAT was -10 degrees Celsius (RR = 1.34, 95% CI: 1.02–1.76), -9 degrees Celsius (1.37, 95% CI: 1.04–1.79), and -8 degrees Celsius (RR = 1.34, 95% CI: 1.03–1.75) at lag week 5 and more than 23 degrees Celsius after 15 weeks. Interaction and stratified analyses showed that the risk of HFRS infection reached its highest when both temperature and precipitation were at a high level.ConclusionsOur study indicates that meteorological factors, including temperature and humidity, have delayed effects on the occurrence of HFRS in the study area, and the effect of temperature can be modified by humidity and precipitation. Public health professionals should pay more attention to HFRS control when the weather conditions of high temperature with more substantial precipitation and 15 weeks after the temperature is higher than 23 degrees Celsius.

Exposure of street sweepers to cadmium, lead, and arsenic in dust based on variable exposure duration in zinc smelting district, Northeast China

Street dust is an important contributor to heavy metal exposure in street sweepers. In this work, the levels of cadmium (Cd), lead (Pb), and arsenic (As) in street dust were evaluated, and the corresponding health implications for street sweepers in the smelting district of Huludao city northeast China were assessed. The contributions of dietary sources and dust to total metal exposure in street sweepers were compared. Because street sweepers are exposed to street dust both during work and nonwork hours, the health risks faced by street sweepers are uncertain. Therefore, variable exposure duration was considered using a deterministic model. A probabilistic risk assessment model was developed to explore the health effects of street dust on street sweepers via Monte Carlo simulation. The various exposure parameters that affect risk were analyzed using sensitivity analysis. The average Cd, Pb, and As levels in the hair of street sweepers were 2.04, 20.12, and 0.52 mg·kg-1, respectively. These values were higher than those for residents (i.e., not street sweepers) of Huludao. Strong correlations were found between the logarithms (base 10) of the Cd, Pb, and As contents in dust and hair (rCd = 0.581, p < 0.01; rPb = 0.428, p < 0.01; rAs = 0.378, p < 0.01; n = 62). Based on analysis using deterministic models, the maximum exposures to Cd and Pb via dust through the alimentary canal were nearly three and six times higher than the dietary exposures, respectively. Sensitivity analysis indicated that exposure duration is an important parameter.

The relationships among job immersion, psychological capital, and life quality in nursing staffs (a STROBE-compliant article).

Nursing services is a high stress job. To improve the life quality of nursing staffs, we explored the relationships among psychological capital, job immersion, and life quality in nursing staffs, and verified that the psychological capital plays an intermediary role between the job immersion and life quality in nursing staffs.General data questionnaire, job immersion scale, psychological capital scale, and life quality scale were performed in nursing staffs who were from 6 third-class hospitals including 2 hospitals in Jinzhou city, 2 hospitals in Chaoyang city, and 2 hospitals in Huludao city. The relationships among psychological capital, job immersion, and life quality, and psychological capital as an intermediary role between the job immersion and life quality were analyzed using SPSS20.0 and AMOS19.0 softwares.In these nursing staffs, the total scores of the job immersion, psychological capital, and life quality were 47.45 ± 9.41, 65.63 ± 10.35, and 72.35 ± 11.24, respectively. The psychological capital was positively correlated with the job immersion (r = 0.452, P < 0.001), the job immersion was positively correlated with the life quality (r = 0.344, P < 0.001) and the psychological capital was positively correlated with the life quality (r = 0.314, P < 0.001). Structural equation models showed that the job immersion could indirectly influence the life quality through the psychological capital. The mediating effect of psychological capital was 0.156 which accounted for 33.19% of the total effects.The psychological capital should be improved, and the psychological capital combined with the job immersion together improves the life quality of nursing staffs.

Metallic elements in human hair from residents in smelting districts in northeast China: Environmental factors and differences in ingestion media

The health of residents in Huludao City is affected by the emissions of heavy metals from smelting, diet and atmospheric precipitation. This study investigated the concentrations of Hg, Cd, Pb, Cu and Zn in scalp hair samples from 259 residents of different ages and genders from five districts in Huludao City and examined the main factors for heavy metal exposure. Cd and Pb concentrations in hair samples exceeded the normal concentration ranges for human hair (Cd < 0.3 mg/kg; Pb < 9.3 mg/kg), and the highest Pb concentrations were found in subjects in the age range 0–15 years. Samples from men were higher in Cd and Pb compared to those for women. Workers from the Huludao zinc plant (HZP) had higher concentrations of all metals in their hair relative to other occupations except for Cu. Geographically, the highest Cd and Pb concentrations in hair were found for residents living in Daochi district (DCD) and the Zn plant district (ZPD), respectively. In smelting regions, the effects of dust ingestion on heavy metal exposure were more important than in non-smelting regions.

Contamination assessment and health risk of arsenic exposure to stairway dust in the zinc smelting district, Northeast China.

Stairway dust samples were collected from residential communities in Huludao city to investigate population health risk of arsenic (As) exposure through stairway dust. ArcGIS software was used to analyze As spatial distribution in Huludao city. Hazard index was applied to assess health risk due to exposure to As in stairway dust. The results were that As concentrations ranged from 13.26 to 237.58mgkg-1, and the mean value was 59.64mgkg-1, which was seven times as high as the background value of Liaoning Province. The pattern of spatial distribution was concentric rings as the center of Huludao zinc plant, with the extension to the northeast and southwest. The average value of Igeo was 2.176, which fell into moderately polluted level. For non-carcinogenic risk, the hazard indexes were less than 1, indicating that there was almost no health risk for residents exposed to stairway dust. But population risk exposure to dust would increase rapidly with exposure time in stairway. The highest contribution to the overall figure of non-carcinogenic risk and carcinogenic risk appeared to be ingestion of substrate particles followed by inhalation pathway and dermal absorption of As in dust samples. And for carcinogenic risk, the risk values were lower than the threshold range of EPA's safe limits (1 × 10-6 and 1 × 10-4), suggesting that potential cancer risk of As due to exposure to stairway dust can be acceptable.

Quality of life among men who have sex with men in China measured using the 36-item Short-Form Health Survey: A cross-sectional study.

The present study was conducted to assess the quality of life (QOL) of Chinese men who have sex with men (MSM) and to explore possible factors associated with QOL among them.A cross-sectional study of 370 MSM in Dalian and Huludao city was conducted to evaluate QOL in MSM using the Chinese version of the 36-item Short-Form Health Survey (SF-36). A t test was used to compare the QOL score of our sample with the Chinese norm. ANOVA, t test, and multivariate linear regression analysis were used to assess the association of QOL with basic characteristics.The QOL score of MSM was lower than the Chinese norm (P < .05). Multivariate analysis showed that marital status and monthly income were factors associated with physical component summary (PCS) and mental component summary (MCS) among MSM population (P < .05). Married MSM had poorer QOL, and respondents with higher income levels had better QOL.The government may need to develop more effective prevention strategies to improve the mental component of QOL in the Chinese MSM population, especially the married MSM population.

A probabilistic method for evaluating wedge stability based on blind data theory

This study proposes a probabilistic approach based on blind data theory and a k-means clustering algorithm to analyze the wedge stability problem considering multiple failure modes. The method evaluates the stability of the wedge by constructing a blind data model that can comprehensively consider the various uncertainties of the wedge parameters. The construction of the blind data evaluation model of wedge stability is described, and the blind evaluation model used to determine the wedge stability with wedge failure dominated by a prone-sliding face and double-face failure is given. The model is applied to analyze the stability of a classical double-face wedge. The results are compared with the probability of failure evaluated by a Monte-Carlo simulation, as well as the results obtained from deterministic analysis, including the mean safety factor and SWEDGE numerical analysis methods. The probability distribution for the safety factor of the wedge determined by this method is fairly consistent with those from the Monte-Carlo simulation method, verifying the reliability and efficiency of the new method. Finally, the method is applied to the stability evaluation of the wedge in Huludao city, Liaoning Province, China. The probability of safety factors less than 1 is 89.8%, and the probability that the safety factor is less than 1.2 is 100%, which is consistent with the actual situation. This result demonstrates that the blind data model for evaluating wedge stability exhibits good generalization performance.

Ecological risk assessment of heavy metals in surface seawater and sediment near the outlet of a zinc factory in Huludao City, Liaoning Province, China

At present, the methods widely applied to assess ecological risk of heavy metals are essentially single-point estimates in which exposure and toxicity data cannot be fully used and probabilities of adverse biological eff ects cannot be achieved. In this study, based on investigation of concentrations of six heavy metals (As, Hg, Pb, Cd, Cu, and Zn) in the surface seawater and sediment near the outlet of a zinc factory, located in Huludao City, Liaoning Province, China, a tiered approach consisting of several probabilistic options was used to refine ecological risk assessment for the individuals. A mixture of various heavy metals was detected in the surface seawater, and potential ecological risk index (PERI) was adopted to assess the potential ecological risk of heavy metals in the surface sediment. The results from all levels of aquatic ecological risk assessment in the tiered framework, ranging from comparison of single eff ects and exposure values to the use of distribution-based Hazard Quotient obtained through Monte Carlo simulation, are consistent with each other. Briefly, aquatic Zn and Cu posed a clear ecological risk, while Cd, Pb, Hg, and As in the water column posed potential risk. As expected, combined ecological risk of heavy metal mixture in the surface seawater was proved significantly higher than the risk caused by any individual heavy metal, calculated using the concept of total equivalent concentration. According to PERI, the severity of pollution by the six heavy metals in the surface sediment decreased in the following sequence: Cd>Hg>As>Pb>Cu>Zn, and the total heavy metals in the sediment posed a very high risk to the marine environment. This study provides a useful mathematical framework for ecological risk assessment of heavy metals.

The influence of social support on quality of life of men who have sex with men in China: a preliminary study.

The quality of life (QOL) of men who have sex with men (MSM) has received increasing attention in recent years. Our study surveyed the QOL and explored the influence of social support on QOL in Chinese MSM. A cross-sectional survey was conducted from September 2013 to March 2014 of 438 MSM in Huludao and Zhengzhou City, China. The results of univariate analysis showed that higher QOL scores were associated with receiving psychosocial counseling, higher health education, younger age and marital status of being single or unmarried p < 0.05). The structural equation model fitted well, with χ2 = 2083.47 (p < 0.05), RMSEA = 0.07, and GFI = 0.88. Among the latent factors, social support, with a factor load of 0.47, had greater impact on QOL than demographic characteristics. Within social support, the item loads for psychosocial counseling and health education were 0.17 and 0.29, respectively. Basic demographic characteristics also influenced social support, with a factor load of -0.65. For demographic characteristics, the greatest item loads were for marital status and age (0.77 and 0.71, respectively). These findings suggest that strengthening social support, especially for older and married individuals, would improve QOL in MSM in China.

First Report of Greenhouse Tomato Wilt Caused by Plectosphaerella cucumerina in China.

Tomato (Lycopersicon esculentum Mill.) is one of the most important vegetable crops in China. In May 2011, root rot and plant wilt were observed on tomato plants (variety Jinguan No. 5 and Meina) in 26 commercial greenhouses in Huludao city, Liaoning Province, China. Disease incidence was 30 to 95%. At beginning of fruit set, symptoms were chlorosis of lower leaves and lack of turgidity in young leaves. Severely affected plants were wilted and stunted as fruit approached maturity. Primary and secondary roots became necrotic with few fine feeder roots. Symptomatic roots were collected and cut into small pieces, disinfested in 2% sodium hypochlorite for 2 min, rinsed with sterile water, and placed on potato dextrose agar. After incubation at 25°C for 5 days, 20 axenic cultures were obtained from single conidia. Colonies were buff or salmon pink, moist, and had appressed, slimy mycelium. Aerial mycelium was sparse with simple or branched conidiophores. Conidia were 4.0 to 8.9 × 2.0 to 4.0 (average 6.9 × 2.8) μm, aggregated in slimy heads, hyaline ellipsoidal and ovoid, smooth, and 0 to 1 septate. Conidia were borne on phialides that were 6.3 to 24.3 × 1.4 to 3.3 (average 15.9 × 2.2) μm. These characteristics are typical of Plectosphaerella cucumerina (Lindf.) W. Gams (1) (anamorph: Fusarium tabacinum) (3). The internal transcribed spacer (ITS) region of the 20 isolates was amplified using the primers ITS1/ITS4 and sequenced. Identical sequences were obtained from all 20 isolates, and the sequence of isolate HLDT15 was submitted to GenBank (Accession No. KC894931). BLAST analysis of the sequence showed 100% similarity to P. cucumerina (AB469880). Pathogenicity tests were conducted with tomato variety Jinguan No. 5. Six 12-liter pots were filled with sterilized potting mix (equal parts sand, peat, and soil) and 200 ml conidial suspension (1 × 105 conidia ml-1). The conidial suspension of the isolate of P. cucumerina was prepared from 7-day-old cultures grown in potato dextrose broth on a shaker (120 rpm) at 25 ± 1°C. Six control pots were filled with potting mix and 200 ml of sterilized potato dextrose broth. Each pot was sown with six surface-sterilized (2% sodium hypochlorite for 2 min) tomato seeds. All the pots were kept in a greenhouse at 23 to 28°C. Three to four weeks after seedling emergence, all inoculated plants were dwarfed and lower leaves were chlorotic. Roots were necrotic and produced fewer fibrous roots. All characteristics were similar to original observations on the host of origin. Control plants remained asymptomatic. The same results were obtained when pathogenicity tests were repeated twice. P. cucumerina was reisolated from inoculated plants and matched the morphological and molecular characteristics of the original isolates. P. cucumerina was reported as a pathogen of tomato in Italy (2) and Australia (4). To our knowledge, this is the first report of P. cucumerina causing tomato wilt in China. So far, we have observed the disease on tomatoes in commercial greenhouses of Pulandian and Panjin city, Liaoning Province, China. The spread of this disease may pose a threat to tomato production in China.

The quality of life of men who have sex with men in China: reliability and validity testing of the SF-36 questionnaire.

ObjectiveThe aim of the study was to assess the psychometric properties of the 36-Item Short Form Health Survey (SF-36) in the men who have sex with men (MSM) population in China. MethodsA cross-sectional survey was conducted among 373 MSM from September to December, 2012, in Zhengzhou and Huludao City, China. Internal reliability of the questionnaire was calculated by Cronbach’s α coefficient. Validity was analyzed through construct validity, divisional validity, and collective validity testing.ResultsThe overall Cronbach’s α coefficient of the SF-36 questionnaire was 0.943, while the Cronbach’s α coefficients for each of the dimensions were all > 0.70. Results showed that the SF-36 questionnaire was reliable and valid. ConclusionsThis study provided evidence that the SF-36 is an acceptable, valid and reliable instrument in evaluating the quality of life of MSM in Mainland China.

Ambient Air Quality Comprehensive Evaluation of Matter-Element Analysis Model Based on the Entropy Weights

Because of the incompatible problems in single index weight ambient air quality previously, five pollution factors (PM10, SO2, NO2, CO, TSP) are chose for evaluation parameters, and then adopt the matter-element analysis model based on entropy weight, refer to the national standards of ambient air quality and compared with the traditional evaluation method, to make a comprehensive assessment of Huludao city in Liaoning province. The evaluation results showed that the study area ambient air quality isⅠlevel in summer, spring forⅡlevel, winter for Ⅲ level , the overall is good except for some area pollution is serious. The results are consistent with the conclusions of the gray system theory and fuzzy comprehensive index method.

Factors Associated with Unprotected Anal Intercourse among Men Who Have Sex with Men in Liaoning Province, China

BackgroundHIV prevalence among men who have sex with men (MSM) has increased rapidly. MSM may play a bridging role in the spread of HIV and other STDs from the high-risk population to the general population. Interventions to reduce high-risk behavior are the key to controlling the spreading of HIV in the MSM population and the primary strategy for reducing the spread of AIDS in China. The purpose of the study was to examine the demographic characteristics of MSM, evaluate the HIV-related knowledge of MSM, and identify factors associated with unprotected anal intercourse (UAI) among MSM to make recommendations for future research.Methodology/Principal FindingA cross-sectional survey was conducted among 293 MSM in Fushun and Huludao City, China. A total of 91 participants (34.0%) reported engagement in UAI with a male partner during the previous six months. The results of univariate analysis showed that UAI was associated with older age, lower levels of education, less knowledge about HIV, and not receiving condoms, lubricant, peer education, AIDS counseling, STD checks, and informational materials (p<0.05). In a multivariate logistic regression model, awareness of the major HIV transmission routes (OR = 2.191; 95% CI: 0.869 to 5.524), receiving condoms (OR = 2.164; 95% CI: 1.149 to 4.076), receiving peer education (OR = 2.632; 95% CI: 1.566 to 4.426), and AIDS counseling (OR = 2.347; 95% CI: 1.260 to 4.372) were independently associated with a lower risk of UAI.Conclusions/SignificanceThe study suggested that UAI could be decreased by improving education about AIDS, increasing the promotion of voluntary counseling and testing (VCT), and improving the accessibility and convenience of service.

Distribution and accumulation characteristics of heavy metals in sediments in southern sea area of Huludao City, China

The southern sea area of the Huludao City, Liaoning Province might be polluted by heavy metals because it is close to the Jinzhou Bay, one of the heaviest sea area polluted by heavy metals in China. The undisturbed modern sediment core can be used to analyze the accumulation and source of the pollutants using 137Cs and 210Pbex. Thirty-five samples of surface sediment and two core sediments were collected from the southern sea area of Huludao City. The concentrations of copper (Cu), lead (Pb), chrome (Cr), zinc (Zn), arsenic (As) and mercury (Hg) in the surface sediments as well as Cu, Pb, Zn, Cr, 137Cs and 210Pbex in the core sediments were determined to research the spatial distribution and accumulation characteristics, and to analyze the sources and the potential risks of heavy metals. The results show that the pollution levels of Zn and Hg are serious, and 26 stations are at moderate or heavy ecological risks. The concentrations of the heavy metals increase from east to west, as well as from open sea to offshore marine area. The concentrations of heavy metals are not high in the sediments adjacent to the Jinzhou Bay, and the influence caused by the seawater exchange with the Jinzhou Bay is little. The concentrations of the heavy metals in the core sediments show low-high-low characteristic, and it coincides with the pollution history of Huludao City. The atmospheric deposition of heavy metals from the Huludao Zinc Plant is likely to be the main source of pollution without direct discharge of wastewater. The high concentrations of heavy metals appear on the upper sediment of 20 cm. The shallow sediment with high heavy metal contents might be exposed to surface when it was disturbed by the ocean engineering and big storm surge, then cause risk to the safety of aquaculture and human healthy.

Distribution and Fractionation of Heavy Metals in Long-Term and Short-Term Contaminated Sediments

Abstract Sequential extraction procedures were used in the present study to investigate the distribution and fractionation patterns of Cu, Zn, Pb, and Cd in sediments collected from Huludao City and the Songhua River, respectively. Results indicate that heavy metals added to the sediments for a short time were present as exchangeable, carbonatic, and Fe/Mn-oxide-bound phases. Heavy metals residing in the sediments for a long time were mainly present in carbonatic, Fe/Mn-oxide-bound, and organic fractions. After being spiked with hydroxylapatite, the metals present in the exchangeable phase in the short-term contaminated sediments were transformed to the carbonatic and Fe/Mn-oxide-bound phases and, to a lesser degree, the organic phase and residues. Cu in the long-term contaminated sediments was inclined to change from both exchangeable and carbonatic phases to an organic phase, and Pb was inclined to change from carbonatic and Fe/Mn-oxide-bound phases to organic and residual phases. Generally, the additio...

Mercury Bioaccumulation and Prediction in Terrestrial Insects from Soil in Huludao City, Northeast China

Mercury accumulation was investigated by constructing and testing empirical equations based on mercury in soil (C s) and in 10 terrestrial insects (C i). C s ranged from 0.13 to 41.01 mg/kg. C i differed with species and the highest was found in dragonfly. C s and C i showed a good linear fit, and a simple equation was used in predicting C i when insects were classified into one Insecta group (r = 0.3399, p = 0.0037). The taxonomy can affect validities of empirical equations, which fit field data well when insects were grouped by feeding habits, and when grouped by species, empirical equations were suitable only for certain insects.

Cd and Pb Contents in Soil, Plants, and Grasshoppers along a Pollution Gradient in Huludao City, Northeast China

Cd and Pb contents in soil, plants, and two grasshopper species (Locusta migratoria manilensis and Acrida chinensis) were examined to quantify the influence ranges of zinc smelting on heavy metal contamination. Samples were collected simultaneously from Huludao City, a chemical and nonferrous smelting base in Northeast China. Cd and Pb contamination in soil and plants were serious. Cd and Pb contents were 13.32 and 8.83 mg/kg in L. migratoria manilensis and 16.67 and 15.00 mg/kg in A. chinensis, respectively. Correlation analysis indicated the same metal source for Cd and Pb in soil, plants, and grasshoppers. Cd and Pb contents in soil, plants, and grasshoppers were all significantly related to distances far from the zinc smelter in good negative logarithm model. The fitting curves indicated that the influence radius of the smelter on heavy metal contamination was about 4,000 m for soil and plants and about 2,000 m for grasshoppers.