Hospitals In Sokoto Research Articles

An Audit of Post-neonatal Infant Morbidity and Mortality from Admissions in an Emergency Unit of a Tertiary Hospital in Sokoto, Northwest Nigeria

Background The first year of life is a critical period of adaptation for a young infant during which the child becomes exposed to a lot of infectious agents and other environmental problems as its immune systems and other organs are developing. Magnitude of deaths within the first year of life is a significant socioeconomic index of any population. Challenges can also be brought to the forefront which can be tackled by appropriate authorities. Objectives To assess the causes of morbidity and mortality amongst infants aged 29 days to 12 months admitted in the emergency Paediatric unit (EPU) of Usmanu Danfodiyo University Teaching Hospital (UDUTH), Sokoto over a 5- year period. Materials and Methods The admission records of children aged 29 days to 12 months were retrieved. Information extracted included socio-demographic data, diagnosis and outcome of admission. These were entered into a study proforma and analysed with SPSS version 23. Results Total admissions were 1776 in the five-year review. Majority were males accounting for 1030 (58%) with M:F ratio of 1.38:1. 972 (55.4%) were aged 6 to 12 months. Top causes of admissions were diarrhoea disease 328 (18.5%), pneumonia 280 (15.8%), sepsis 211 (11.9%), malaria 202 (11.4%) and malnutrition 154 (8.7%). Mortalities were 223 (12.6%). Highest fatalities out of 223 were from sepsis 47 (21.1%), pneumonia 40 (17.9%), malaria 27 (12.1%), malnutrition 25 (11.2%) and diarrhoea disease 20 (9.0%). Higher proportion of the mortalities were in females 14.5% vs 11.2% (X2 = 4.3; p=0.038). Sepsis mortality was high throughout likewise pneumonia but mortality pattern of other disease conditions varied throughout infancy. Conclusion Post-neonatal admissions were mainly due to infections, likewise mortality of which the top causes varied throughout infancy. Females were more proportionately affected by mortality. These insights on the morbidity and mortality patterns calls for more concerted efforts on child survival strategies and targeting this group of infants is imperative.

Molecular Characterization of Human Papilloma Virus among Women Attending Selected Hospitals in Sokoto, Sokoto State, Nigeria

Human Papilloma Virus (HPV) infection is the primary cause of virtually all cervical cancers. Cervical cancer despite being largely preventable is still the leading cause of gynaecological cancer related death among females in developing countries. This study was carried out to molecularly characterized Human Papilloma Virus among women attending selected hospitals in Sokoto, Sokoto State, Nigeria. This study involves the analysis of high vaginal swab obtained from 208 women. The high vaginal swab samples were analysed using PCR, DNA sequencing and phylogenetic analysis of the identified genotypes. Only two Human papilloma virus genotypes (HPV type 18 and 58) were detected in this study with Human papilloma virus type 58 as the most prevalent. This study identified only two Human papilloma virus genotypes (HPV types 18 and 58) in Sokoto, Nigeria which can serve as basis for establishing vaccine in the study area

Evaluation of Co-production of Colistin Resistance and ESBL Genes among Gram-negative Clinical Isolates from Usmanu Danfodiyo University Teaching Hospital Sokoto, Nigeria

Study’s Excerpt/Novelty This study presents a comprehensive evaluation of colistin-resistant and extended-spectrum beta-lactamase (ESBL) gene co-production among Gram-negative clinical isolates from Usmanu Danfodiyo University Teaching Hospital in Sokoto. Notably, 13.9% of the isolates exhibited phenotypic co-production of colistin resistance and ESBL, with a significant presence of blaCTX-M and CTX-M 8 genes among ESBL producers, although no colistin resistance genes (mcr-1 and mcr-2) were detected via PCR. These findings highlight the necessity for integrated molecular and phenotypic investigations to fully elucidate resistance mechanisms in Gram-negative bacteria and underscore the need for further research to uncover alternative pathways contributing to observed resistance phenotypes. Full Abstract The emergence of antimicrobial resistance (AMR) is a major threat to global health. Its effects include high mortality and morbidity rates, treatment failure, and increased treatment costs. This study aimed to evaluate the co-production of colistin-resistant and extended-spectrum beta-lactamase (ESBL) genes among Gram-negative clinical isolates from Usmanu Danfodiyo University Teaching Hospital in Sokoto. Gram-negative bacteria were isolated from clinical specimens, including urine, feces, and wound aspirates. The Double-Disk Synergy Test and the Colistin Agar Test, respectively, were used to phenotypically validate the existence of colistin resistance and ESBL. Polymerase chain reaction (PCR) was used for molecular characterization. Primers were used to target genes linked to colistin resistance (mcr-1 and mcr-2) and ESBL genes (blaCTX-M, CTX-M 1, CTX-M 2, and CTX-M 8). The findings indicated that 13.9% of the isolates displayed co-production of Colistin and ESBL, and of these isolates, 60% had blaCTX-M genes, and 20% had CTX-M 8 linked to ESBL production. However, the presence of colistin resistance genes was not detected by PCR. Therefore, molecular analysis did not confirm the existence of the colistin resistance genes (mcr-1 and mcr-2) in these isolates. Consequently, the findings showed no molecular co-production of the ESBL and colistin resistance genes. This work emphasizes how crucial it is to look into molecular and phenotypic traits to completely comprehend how colistin resistance and ESBL genes coexist in Gram-negative isolates. More research is required to investigate other mechanisms behind the resistance phenotypes identified.

Molecular characterization and epidemiology of methicillin-resistant Staphylococcus aureus isolated from clinical samples in Sokoto, Nigeria

Objectives: Methicillin-resistant Staphylococcus aureus (MRSA) is a major public health threat and a cause of hospital-acquired and community-acquired infections. This study was undertaken to investigate antimicrobial resistance pattern, the genetic lineage, presence of S. aureus protein A (SPA) gene, and staphylococcal chromosomal cassette mec (SCC mec) types of MRSA isolated from clinical samples sent for microbiological test in major government hospitals in Sokoto. Material and Methods: A total of 90 S. aureus MRSA isolates were collected and confirmed using standard microbiological techniques. Antibiotic susceptibility testing was done using the disk diffusion method; mecA detection and sequencing were carried out. Phylogenetic reconstruction was also done using the molecular evolutionary genetics analysis X software and phylogeny tree constructed by Neighbor-Joining method. SCC mec typing and SPA detection were also done. Results: Of the 90 S. aureus isolates, 42 were found to be MRSA using the cefoxitin disk diffusion, the most potent antibiotic against them was quinupristin/dalfopristin with 83.3% followed by rifampicin with 81.0% and 6 clindamycin with a 71.4%. With 78.6% of the isolates showing resistance to the fluoroquinolone antibiotic ciprofloxacin, tetracycline and gentamicin came in second and third, with 64.3% and 61.9% of isolates showing resistance, respectively. Most of the MRSA isolates were resistant to more than three antibiotics. Polymerase chain reaction showed 36 (85.7%) harbored the mecA gene and of the 36 mecA positive isolates, phylogenetic reconstruction of representative MRSA sequences showed that MRSA sequences in this study clustered in two closest clades suggesting a possible horizontal transfer. Of the 36 isolates, 23 were SCC mec type I, ten were type IV, and three were non-typeable, while the SPA gene was detected in all the isolates amplified. Conclusion: The use of phenotypic and molecular methods in this study provided useful information on antibiotic resistance profile, epidemiology, and molecular characteristics of MRSA isolates in Sokoto Nigeria. The information provided could help in monitoring the evolution of MRSA strains in Nigeria over time.

Effect of Bone Pain Vaso-occlusive Crises on Red Blood Cell Parameters of Sickle Cell Anaemia Patients

Background: Sickle Cell Anaemia (SCA) is an inherited haemoglobin disorder characterized by shortened red cell life span and altered red blood cell parameters due to the red cell sickling, vaso-occlusion and chronic haemolysis occasioned by the disease. The occurrence of bone pain vaso-occlusive crises may further alter these parameters; an occurrence that highlights on the pathophysiology of SCA and worth noting in the management of affected patients. Aims and Objectives: This study was performed to determine the effect of bone pain vaso-occlusive crises on red blood cell parameters of SCA patients. Study Design: A longitudinal study. Settings: Fifty SCA patients receiving care at a tertiary hospital in Sokoto, Nigeria were consecutively enrolled while in their steady clinical state and followed up till when they re-presented during the bone pain vaso-occlusive crises state. Materials and Methods: Structured proforma was used for clinical data capturing while red blood cell parameters (red blood cell count (RBC), haemoglobin (Hb) concentration, haematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH), mean corpuscular haemoglobin concentration (MCHC) and red cell distribution width (RDW) were determined via automation using Nortek 3-part haematology analyser. Leishmann stained peripheral blood smears were examined to cross-check morphological details of the red blood cells. Statistics: Data analysis was performed using Statistical Package for the Social Sciences (SPSS) version 21.0 (IBM Corp, Armonk, NY, USA) and further summarized as means ± standard deviations. Comparison of means was performed using paired sample t-test and Anova as appropriate while Pearson’s test was used for correlation analysis. Results were presented in tables while statistical significance was set at p<0.05. Results: Fifty SCA patients were enrolled for the study and consisted of 26 (52%) females and 24 (48%) males. The overall mean age of the study participants was 22.82 ± 6.55 years with the minimum and maximum ages of 18 and 42 respectively. During the bone pain vaso-occlusive crises, 14 (28%), 21 (42%) and 15 (30%) of the patients had mild, moderate and severe bone pains respectively. The red blood cell parameters during the steady and bone pain crises states were RBC count (2.87±0.69 vs. 2.93±0.83; p=0.675); HCT (24.33±5.01 vs. .37±5.61; p=0.373); Hb concentration (8.34±1.53 vs. 7.99±1.54; p=0.228); MCV (87.87±9.13 vs. 82.59±14.64; p=0.021); MCH (29.76±5.61 vs. 30.48±13.54; p =0.729); MCHC (32.89±4.76 vs. 32.10±3.75; p=0.394) and RDW-CV (19.30±6.58 vs. 19.59±5.27; p=0.829) respectively. During bone pain vaso-occlusive crises, the red blood cell parameters based on mild, moderate and severe pains were RBC count (2.82±0.88 vs. 2.78±0.57 and 3.06±0.65; p=0.472); HCT (24.29±6.37 vs. 24.11±5.12 and 24.68±3.53; p=0.947); Hb concentration (8.46±2.01 vs. 8.33±1.57 and 8.24±0.92; p=0.927); MCV (87.60±7.46 vs. 91.03±9.21 and 83.69±9.22, p=0.055); MCH (31.28±7.77 vs. 30.27±4.27 and 27.61±4.51; p=0.185); MCHC (33.05±7.54 vs. 33.07±3.39 and 32.48±3.13; p=0.928) and RDW-CV (19.61±9.65 vs. 19.96±5.61 and 18.10±4.23; p=0.700) respectively. Conclusions: Of all the studied red cell parameters, only MCV significantly differ between the steady and bone pain crises states of SCA. A drop in MCV was recorded during the bone pain crises; probably reflecting depletion of the large reticulocytes and neocytes during the accentuated red cell sickling and vaso-occlusive events characteristic of this clinical state.

Molecular Detection of Epstein Barr Virus Co-Infection in HIV Positive Women Attending Selected Hospitals in Sokoto, Nigeria

Viral infections contribute a larger percentage of all human cancers. Epstein Barr virus (EBV) is a type of herpes virus with no clinical manifestation in majority of individuals. However, when it occurs in adulthood, it causes benign lymph proliferative disease known as mononucleosis. This study investigated the molecular detection of EBV co-infection among HIV positive women attending some selected hospitals in Sokoto, Nigeria. Questionnaires were administered on 80 consenting HIV positive women attending three selected hospitals in Sokoto to gather data on socio-demography and risk factors. Blood samples were aseptically collected by venipuncture from the HIV positive patients and EBV screening done using PCR analysis with primer +5' ACAACCACTCATGATGCCAC (Forward), 5' ACCGTGGTTCTGGACTATCT (Reverse) for Type 1 EBV (EBV-1) and primer +5' GGTAGCCTTAGGACATACTC (Forward), -5' TGGAGGGAGTCCTGTACTAT (Reverse) for Type 2 EBV (EBV-2). Result indicated that majority (63.75%) of the HIV positive women were in the age group of 21-30 years with EBV-1 having the highest occurrences of 60.7%. Co-infection of EBV among HIV positive women attending the selected hospitals in Sokoto, Nigeria was established with EBV-1 having the highest prevalence and in subjects in polygamous relationships.

Molecular Detection of mecA gene among Methicillin Resistant Staphylococcus aureus Isolates from Clinical Samples in Sokoto, Nigeria

Methicillin-resistant S. aureus (MRSA) infections have become a common problem in hospital and community-acquired infections. This study was aimed at detecting the presence of mecA gene among Methicillin Resistant Staphylococcus aureus Isolates from clinical samples obtained from 2 major hospitals in Sokoto, Northwestern Nigeria. A total of 95 non duplicate isolates were screened for confirmation using standard microbiological techniques. Antibiotic sensitivity testing was carried out by disc diffusion using Cefoxitin and resistant isolates were tested with different other antibiotics. All MRSA isolates were subjected to molecular analysis by detection of mecA gene based on PCR technique. Showed that, 42/95 (44.2%) were methicillin resistant. The most potent antibiotic was quinupristin/dalfopristin with 83.3% sensitivity followed by rifampicin with 81.0% and clindamycin with a 71.4%. The least activity was shown to be in fluoroquinolone antibiotic ciprofloxacin with 78.6% of the isolates demonstrating resistance followed by, tetracycline and gentamycin with 64.3%, 61.9% and 61.9% respectively. Most of the MRSA isolates were resistant to more than three antibiotics.PCR showed 36(85.7%) harbored the mecA gene. Although, polymerase chain reaction is the gold standard for determining Methicillin resistance through the detection of the mecA gene, the present study phenotypically established the presence of methicillin resistant S. aureus isolates that are mecA negative. Therefore, interpretation of MRSA detection strictly based on mecA detection should be done with care in the study area.

Prevalence, clinical profile and outcome of children with cardiomyopathy

Background: Cardiomyopathies are myocardial disorders in which the heart muscle is structurally and functionally abnormal, thereby affecting the ventricular systolic function and/or diastolic function. Comprehensive approach to management warrants recognizing the clinical profile in order to strategize to improve outcomes. Aim: To evaluate the types of cardiomyopathies, presentation and outcome among children admitted into a tertiary hospital in Sokoto. Methods. A hospital based prospective study of children aged below 15 years who were seen over an 8.5-year period. A proforma was used to collect the information on their socio-demographics, type of cardiomyopathy, associated presentations and outcome. Data was analysed using IBM SPSS version 25. Results: 71 out of 78,321 children seen that period (0.1%) were diagnosed with CM giving a hospital prevalence of 90.7/100,000. They comprised 40 (56.3%) males and 31 (43.7%) females. Age ranged from 1 month to 15 years (6.2 ± 3.8 years). Dilated CM (DCM) was the commonest in 63 (88.7%), restrictive CM (endomyocardial fibrosis-EMF) in 5 (7.0%) and hypertrophic (HCM) in 3 (4.2%). Forty-six (73%) of DCM had severe systolic dysfunction. DCM also occurred in 2 siblings of 2 patients on follow up. Two of the patients with EMF had recurrent pericardial effusions and all the patients with HCM died in infancy. Thirty (42.2%) of the total patients were lost to follow-up while 27 (38.0%) died. Conclusion: Dilated cardiomyopathy followed by restrictive type are the commonest types seen among children in Sokoto. It is associated with high morbidity and mortality.

Haemodynamic adjustments in third trimester, among pregnant women undergoing antenatal care at a tertiary hospital in Sokoto, Nigeria

Third trimester of pregnancy is characterised by profound changes in the haemodynamic system, predicated by the climax of the pregnancy hormones profiles. The blood pressure (BP) is lower and the haemoglobin levels are lower, necessitating an increased circulatory work to maintain tissue perfusion of the new maternal-fetal placental bed and for the expectant blood loss during childbirth. However, the mechanisms by which this is achieved is poorly understood. The present study aimed to assess the mechanisms by which the mother’s systems adjust to meet its haemodynamic gaps at the third trimester of a normal pregnancy. One hundred and fifty normal third trimester pregnant women undergoing antenatal care at the State Specialist Hospitalist Sokoto were assessed for blood pressure, haemoglobin concentration and anthropometries and the results compared with those of a group comprising 115 non-pregnant control women. While the pregnant group had lower BP parameters, it has significantly higher PR (P<0.0001). The pregnant group also demonstrated higher rate pressure product (RPP) (10,196±1,292bpm.mmHg v 9,429±1,469bpm.mmHg, P=0.0000). However, the non-pregnant group showed significantly higher heart rate reserve (HRR) (108.0±13.0bpm.mmHg/year), compared to the pregnant group (96.0±12bpm.mmHg/year, P=0.0000). Although, after adjusting for age, the pregnant group maintained a significantly higher RPP (397±120bpm.mmHg/year v 358±139bpm.mmHg/year, P =0.0156), the non-pregnant group after adjustment for age failed to maintain a higher HRR, instead the pregnant group showed (4.0±1.0bpm/year v 4.0±2.0bpm/year, P=0.0328). In conclusion, the pregnant woman can adjust haemodynamically by mechanisms of RPP and HRR independent of age, to cope with the stress and requirements of pregnancy. This, in addition to supplementation of haematenics, appropriate treatment of common infections and better nourishment of the pregnant mother, to help improve the anemia during pregnancy.

Patient X-Ray Entrance Surface Dose at a Tertiary Hospital in Sokoto, North-West Nigeria.


 
 
 
 
 Background: The entrance surface dose (ESD) has been used to determine the diagnostic reference levels (DRL) by regulatory bodies to help medical radiation workers to checkmate excessive dose to patients.
 Objective: To peer review practice in our centre using recommended diagnostic reference levels (DRLs) as standard.
 Methods: A prospective cross-sectional study of fifty x-ray patients who had thermoluminescent dosimeters (TLD-100) taped on their skin to quantify entrance surface dose (ESD) during x-ray investigation. The patients appeared in Radiology Department of Usmanu Danfodiyo University Teaching Hospital (UDUTH), Sokoto between 1st August and 30th September 2018. Their weights and heights were measured directly. Thereafter, they were divided into 5 groups of ten each for five specific anatomical areas: PA chest, AP of pelvis, abdomen, lumbosacral spine, and lateral lumbosacral spine. Irradiated TLDs were read, and the mean ESD was calculated.
 Results: Entrance surface dose (ESD) was 0.26 mGy (chest), 0.46 mGy (AP lumbosacral), 0.71 mGy (pelvis), 1.3 mGy (abdomen), and 1.6 mGy (lateral lumbosacral). The ESD values were found to be lower than similar studies carried out in Nigeria, as well as diagnostic reference levels in UK.
 Conclusion: Optimization of patient protection in UDUTH was comparable to recommended practices locally and internationally.
 
 
 
 

Genomic features of an isolate of Empedobacter falsenii harbouring a novel variant of metallo-β-lactamase, blaEBR-4 gene.

Empedobacter falsenii is an emerging opportunistic pathogen that has been occasionally implicated in various human infections. In this study, we described the genomic features of a multidrug resistant E. falsenii Q1655 obtained from a patient attending a public hospital in Sokoto, northwest Nigeria. The isolate, E. falsenii Q1655, was isolated from the stool sample of a patient in Sokoto, Nigeria. The identity of the isolate was confirmed by MALDITOF-MS. The disc diffusion test and modified Carba-NP test were used for phenotypic antibiotic susceptibility test and carbapenemase enzyme production test, respectively. The whole genome of the strain was sequenced using the Illumina MiSeq technique. Resistome analysis was done by annotation of the WGS against the ARG-ANNOT database. The isolate was resistant to all β-lactam antibiotics with the exception of cefepime. The MICs of imipenem and ertapenem as determined by E-test were 12μg/ml and 2μg/ml, respectively. Modified Carba NP test showed that the strain was carbapenemase producing. Resistome analysis revealed the presence of a novel metallo-β-lactamase, a chromosomal blaEBR-4, which exhibited 94.92% and 97.02% nucleotide and protein sequence identities respectively with blaEBR-3 gene of E. falsenii 174,820. Seven and eight amino-acid substitutions were observed with the blaEBR-1 and blaEBR-2, respectively. We reported the first isolation and genomic description of an extensively drug resistant isolate of Empedobacter falsenii in Nigeria. This report broadens our knowledge of carbapenem resistance in E. falsenii and it will serve as a useful guide in the development of antibiotic use policy.

Coarse tremors (Kwashi shakes) occurring in children recovering from severe acute malnutrition: Case series from a tertiary hospital in Sokoto

Kwashi tremors or Kwashi shakes are uncommon neurological complications of unknown etiology seen in edematous forms of severe acute malnutrition (SAM) during rehabilitation phase of treatment. Four patients with SAM seen in our facility within a 30-month period who developed coarse tremors are presented. The aim was to highlight this uncommon presentation of SAM in our setting. Of the four patients, 3 were male and 1 was a female. Their age ranged from 19 months to 2 years and they weighed between 5.5 and 8.7 kg. Their common clinical presentation included body swelling, loss of appetite, fever, and tremors which developed after discharge. All the patients had increased/overzealous protein intake while at home. The tremors resolved completely in all the patients, but more slowly in two of the patients with hypocalcaemia. In conclusion, Kwashi shakes occurring during rehabilitation of edematous SAM with increased protein intake and appears to be worsened with hypocalcemia

Prevalence of Hospital Associated Infections and Health Care Workers Compliance with Hand Hygiene Practices in a Tertiary Hospital in Sokoto, Nigeria

Background: Hospital associated infections (HAIs) remain a significant cause of morbidity and mortality. And despite the simplicity of hand hygiene practice, an important preventive measure that has been proven to reduce the risk of acquiring and transmitting HAIs, Health care workers (HCW) compliance with the recommendations is of serious concern. Aim: The aim of this study was to determine the prevalence of hospital associated infections and HCWs compliance with hand hygiene practice in a tertiary hospital. Methods and material: This was a hospital-based descriptive cross-sectional study among 110 patients on admission selected using universal sampling, and 377 HCWs selected using a multistage sampling technique. Data collected with self-administered questionnaire for HCWs, interviewer-administered proforma for the patients and data extraction sheet for laboratory analysis. Data analyzed for descriptive statistics using SPSS version 20.0. Results: Patients' mean age was 32.8, IQR: 10.5-37.9 years. Majority, 56(50.9%) were females; Hausa/Fulani, 91(82.7%) and 37(33.6%) had only Qur'anic education while only 20(18.2%) had tertiary education. Health care workers' mean age was 31.8 5.3 years. Majority 227(60.2%) are females, and 267(71.8%) of the participants have received training on hospital infection control. Overall prevalence of HAIs was 42.7%, highest in surgical unit. Commonest HAIs being blood stream infections, and the least, Health Care Associated Pneumonia. Most of the infections were due to Staphylococcus aureus, 22(46.8%) and Pseudomonas aeruginosa, 14(29.8%). Highest hand hygiene practice was reported after contact with body fluid and highest non-compliance reported was before touching patient. Hand hygiene compliance rate was 49.6% and main reasons to non-compliance were high work load, lack of running water and soap, and regular use of hand gloves. Conclusions: Prevalence of HAIs was reportedly high, and low hand hygiene compliance and rate despite majority of the HCWs having received training on Hospital infection control. To reduce the prevalence and the associated burden of HAIs, there is need to put in measures to improve compliance to quality hand hygiene practice by health workers.

Socio-demographic and clinical pattern of childhood pneumonia in a tertiary hospital in Sokoto, Nigeria

Context: Pneumonia is the world’s leading infectious killer of children, particularly under- fives. Practical, achievable and affordable key interventions have been identified to reduce morbidity and mortality from Pneumonia. Despite these measures, it still remains a disease that has significant impact on child’s survival.Objectives: To determine the sociodemographic and clinical features of Pneumonia in hospitalized children at Usmanu Danfodiyo University Teaching Hospital (UDUTH), Sokoto, Nigeria.Materials and methods: A retrospective review of records of children admitted for Pneumonia over a 30-month period and relevant information eg. age, gender, symptoms and signs were documented.Results: Of the189 children reviewed, 114(60.3%) were below 1 year of age, males were 108(57.1%) with a M:F ratio of 1.3:1. One hundred and twenty three (65.0%) belonged to the low socio-economic class (SEC) and only 95(50.3%) were fully immunized. Cough and fever were the commonest presenting symptoms while crepitations, chest in drawing and tachypnoea were the commonest signs. Majority 178(94.2%) had Bronchopneumonia while 11(5.8%) had Lobar Pneumonia. 151(79.9%) were discharged, 1(0.5%) absconded and 37(19.6%) died. Cough and fever were seen in more children that died, however it was not significant. Similarly, more children that had crepitations, tachypnoea, chest indrawing and hypoxaemia died, only chest in drawing was significantly associated with mortality (p=0.020).Conclusion: Pneumonia is still a common cause of mortality, socio-demographic and clinical features remain similar to other reports. Despite the availability of preventive measures and treatment guidelines, mortality remains high. We recommend and advocate for equitable access to quality primary health care in order to prevent, diagnose and treat pneumonia.

Emergence of VIM metallo-β-lactamase among carbapenem-resistant Pseudomonas species in northwest Nigeria

BackgroundPseudomonas species are a leading cause of nosocomial infections particularly among the critically ill patients. The increased resistance to broad spectrum antibiotics observed in these strains makes the use of reserve antibiotics such as carbapenems a routine. However, resistance to carbapenems has also been reported worldwide. Here, we reported the first detection of VIM-carbapenemase producing Pseudomonas species in northwest Nigeria. Materials/methodsConsecutive, non-duplicate isolates of Pseudomonas species recovered from clinical samples in two leading hospitals in Sokoto, northwest Nigeria were collected and identified by matrix assisted laser desorption ionization time of flight mass spectrometry. The susceptibility of the isolates to antibiotics was determined using the disc diffusion method. Carbapenem resistant isolates were evaluated for carbapenemase production using the modified Carba-NP test. Carbapenemase encoding genes were investigated using RT-PCR technique and confirmed by conventional PCR and sequencing. ResultsA total of 44 strains of Pseudomonas spp. were isolated from different pathological specimens processed in the two hospitals. The antibiotic susceptibility testing result showed that only 8 (18.2%) of the 44 Pseudomonas spp. were resistant to carbapenems. Five of the carbapenems resistant isolates were found to be carbapenemase producers by the modified Carba-NP test. Carbapenemase genes including blaVIM-5 (n = 4) and blaVIM-2 (n = 1) were identified in the five carbapenemase producing Pseudomonas species. ConclusionsWe reported for the first time, the emergence of clinical Pseudomonas spp. harbouring blaVIM genes in northwest Nigeria. The finding of this study underscores the need for national antibiotic stewardship protocols in order to prevent outbreaks of multi-drug resistant bacterial infections in our hospitals.

Phenotypic and genotypic characterization of clinical carbapenem-resistant Enterobacteriaceae isolates from Sokoto, northwest Nigeria.

Emergence and spread of carbapenemase-producing Enterobacteriaceae (CPE) are two of the major problems currently threatening global public health. In Nigeria, interest in CPE is recent. In Sokoto, northwest Nigeria, there are no data on the prevalence and mechanism underlying carbapenem resistance. In this study, we aimed to investigate the presence of clinical carbapenems-resistant Enterobacteriaceae isolates in two leading hospitals in Sokoto, northwest Nigeria. A total of 292 non-duplicate Enterobacteriaceae isolated from clinical specimens processed in the diagnostic laboratories of two hospitals between January and June 2019 were collected. Of these, 129 (44.2 %) and 19 (6.5%) were resistant to third-generation cephalosporin and carbapenems, respectively. RT-PCR revealed that 10 (7.8%), 19 (14.7%) and 46 (35.7%) of the third-generation cephalosporin-resistant isolates harboured blaSHV, blaTEM and blaCTX-M genes, respectively. The modified Carba NP test result showed that only 7 (36.8 %) of the 19 carbapenem-resistant isolates were carbapenemase producing; among them, blaNDM-5 and blaOXA-181 genes were identified in five and two isolates, respectively. However, none of the carbapenemase genes investigated, including blaVIM, blaKPC and blaIMP, was detected in the remaining carbapenem-resistant isolates, suggesting a non-enzymatic mechanism. This study reports for the first time, the emergence of CPE in Sokoto state and the detection of NDM-producing Citrobacter freundii in Nigeria. The observed CPE in this study is a concern in a country where alternative antibiotics are rarely available.

Evaluation of Antibiotic Prescription and Utilization amongst Hospitalized Children in a Tertiary Facility in Sokoto, North-Western Nigeria

Background: Antibiotics are the most widely utilized therapeutic agents. Inappropriate use causes increase cost and antibiotic resistance. The World Health Organization recommends assessment of antibiotics use to guide prescribing practices.
 Objective: To describe the pattern of antibiotic usage among paediatric inpatients aged > 1 month to 15 years in a tertiary hospital in Sokoto, Nigeria.
 Methods: Febrile children were recruited prospectively by systematic random sampling from January to October 2018. Socio-demographics, diagnosis, antibiotics administered were obtained from case notes. The WHO indicators of use of antibiotics were employed for evaluation. Data was analysed with SPSS version 23.
 Results: Out of 352 children, 318 (90.3%) received antibiotics; commonest being Ceftriaxone in 155/318 (48.7%), Cefuroxime in 74 (23.2%), and Metronidazole in 29 (9.1%). Average number of antibiotics per patient was 2.3±1.1 with treatment duration of 4.3±1.4days. Antibiotic consumption was 937.2 days of antibiotic therapy/1000 patient days (DOT/PD). Generic name was used in 92.3% while 100% of the drugs were on the essential medicine list. Frequent diagnoses were severe malaria 98/352 (27.8%), respiratory infections 39 (11.1%) and severe malnutrition in 38 (10.8%). Only 6 (1.7%) patients had microbiologic evidence of infection.
 Conclusion: Utilization of antibiotics is higher than recommended. There is need for improved diagnostic facilities to avoid antibiotic overuse and its consequences.
 Keywords: antibiotics, prescription, utilization, children, inpatients, DOT

Awareness and Acceptability of Ultrasound Prenatal Sex Determination among Pregnant Women in a Teaching Hospital in Sokoto, North-Western Nigeria

Awareness and Acceptability of Ultrasound Prenatal Sex Determination among Pregnant Women in a Teaching Hospital in Sokoto, North-Western Nigeria

Shapes and Sizes of Sella Turcica Using Computerized Tomography (CT) from Tertiary Hospital in Sokoto, Nigeria

Cephalometry deals with measurement of body parts or radiological specimen. Sella turcica is an important anatomical structure located in the middle cranial fossa, housing the pituitary gland. Various shapes and sizes of the sellae turcica were reported. In this study, using computerized tomographic (CT) scans from a tertiary hospital, one hundred and seventy five (175) scans were analyzed using Radiant version 4.2 (Medixant 2017) for determination of sizes and shapes of the sella. Average dimensions from the study include: Length (12.4 mm), A-P diameter (14.1 mm), depth (9.6 mm) and transverse diameter (13.8 mm). Shapes were classified as being round (56.6%), oval (32%) and flat (11.4%). In another classification of shape variation, the findings are: Normal (68.6%), anterior oblique (9.1%), pyramidal (6.9%), double contour floor (5.7%), notching on the posterior wall (5.1%) and sella bridge (4.6%). Males tend to have higher sella sizes than females and there is statistical significant difference between them especially in respect to A-P diameter and length parameters. However, there is no sex predilection to shapes.

Anaesthetic care for noma (cancrum oris) - the disease, the airway and how to provide anaesthetic care without a clinical safety infrastructure

Noma (Cancrum oris) is an infectious acute disease that is prevalent in Africa, Asia and the American continent. This condition develops as a consequence of deficient nutrition. It is acquired by children between the ages of 1 and 7, and the children who contract it can die from sepsis within 2 weeks. The estimated mortality rate is in the range of 85%. The survivors have disfigurements of the face, massive scarring, open access to the oral and nasal cavities and trismus, which is the inability to open the mouth partially or completely. Noma, the neglected disease is observed among the poorest of the poor.The authors took part in a team effort to treat the sequelae of Noma in the year 2000 in Sokoto, Nigeria. There was no recovery room, intensive care unit, blood chemical laboratory, radiologic or advanced anaesthetic technology in the Noma Hospital in Sokoto as criteria of a clinical safety infrastructure. Flexible optical nasal intubation (FOI) was successful in all 65 Noma patients, where it was attempted. The nasal, cricothyroidotomy and tracheostomy routes in this disease are free, the oral access is obstructed. Supraglottic airways and oral tracheal intubation per conventional or video laryngoscopy are contraindicated.