Homopurine-homopyrimidine Sequence Research Articles

The ability of a triplex-forming oligonucleotide to recognize T-A and C-G base pairs in a DNA duplex is enhanced by incorporating N-acetyl-2,7-diaminoquinoline

A triplex-forming oligonucleotide (TFO) can recognize the homopurine-homopyrimidine sequence in DNA duplexes and inhibit the transcription of targeted mRNAs. Recently, we reported that N-acetyl-2,7-diamino-1,8-naphthyridine (DANac), incorporated into a TFO, has high binding ability and base recognition selectivity for the pyrimidine bases in the purine-rich chain of the DNA duplex at pH 7.4. However, it was found in this study that the difference in the Tm values between the pyrimidine bases and purine bases decreased by more than 4 °C at pH 6.0–7.0. To improve the low base recognition selectivity of the TFO, we designed a new artificial base, DAQac, with a quinoline skeleton. The Tm values of the triplexes containing DAQac:T-A or DAQac:C-G were more than 13 °C higher than those of the triplexes containing DAQac:A-T or DAQac:G-C at pH 7.4. We also observed that under more acidic conditions (pH 6.0–7.0), the base recognition selectivity of DAQac in a triplex was higher than that of DANac, although the binding ability of DAQac in a triplex was similar to that of DANac. Additionally, we found that DAQac, incorporated into the TFO, could accurately recognize the MeC-G base pair in the hairpin DNA, similar to the C-G base pair.

24 Interference of PNA binding to the non-template strand with transcription supports the general model for transcription blockage by R-loop formation

Transcription blockage can strongly affect various DNA and RNA transactions (reviewed in Hanawalt & Spivak, 2008; Belotserkovskii, Mirkin, & Hanawalt, 2013). Thus, it is of interest to study the various factors that can cause transcription blockage and to elucidate mechanisms of their action. Peptide Nucleic Acids (PNAs) are artificial DNA mimics with superior nucleic acid binding capabilities. The effect of PNA binding to the (GAA/CTT)n sequence within the transcribed DNA region upon T7 RNA polymerase transcription was studied in vitro. In the case of the PNA binding to the template strand, the blockage signals concentrated primarily in the narrow area close to the upstream flank of the PNA-bound sequence, consistent with the blockage being caused by RNA polymerase “bumping” into the PNA/DNA hybrid (Belotserkovskii, Liu, & Hanawalt, 2009). In contrast, for PNA binding to the non-template strand, a characteristic pattern of blockage signals was observed, extending downstream from the PNA binding site (Belotserkovskii and Hanawalt, 2014), similar to that produced by G-rich homopurine-homopyrimidine sequences (Belotserkovskii et al, 2010, 2013). This striking similarity between transcription blockage patterns caused by two seemingly unrelated factors suggests a common mechanism of blockage. This common mechanism likely involves R-loop formation, which is facilitated both by PNA binding to the non-template strand and by G-rich homopurine-homopyrimidine sequences, due to sequestration of the non-template strand or due to formation of an extra-stable RNA/DNA hybrid, respectively. We suggest that there is a general mechanism of transcription blockage by R-loop formation, which presumably involves destabilization of the transcription complex, making it more prone to spontaneous pausing or termination.

PNA binding to the non-template DNA strand interferes with transcription, suggesting a blockage mechanism mediated by R-loop formation.

Peptide Nucleic Acids (PNAs) are artificial DNA mimics with superior nucleic acid binding capabilities. T7 RNA polymerase (T7 RNAP) transcription upon encountering PNA bound to the non-template DNA strand was studied in vitro. A characteristic pattern of blockage signals was observed, extending downstream from the PNA binding site, similar to that produced by G-rich homopurine-homopyrimidine (hPu-hPy) sequences and likely caused by R-loop formation. Since blocked transcription complexes in association with stable R-loops may interfere with replication and in some cases trigger apoptosis, targeted R-loop formation might be employed to inactivate selected cells, such as those in tumors, based upon their unique complement of expressed genes.

Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks

The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation.

A model for triple helix formation on human telomerase reverse transcriptase (hTERT) promoter and stabilization by specific interactions with the water soluble perylene derivative, DAPER

The promoter of human telomerase reverse transcriptase (hTERT) gene, in the region from − 1000 to + 1, contains two homopurine–homopyrimidine sequences (− 835/− 814 and − 108/− 90), that can be considered as potential targets to triple helix forming oligonucleotides (TFOs) for applying antigene strategy. We have chosen the sequence (− 108/− 90) on the basis of its unfavorable chromatin organization, evaluated by theoretical nucleosome positioning and nuclease hypersensitive sites mapping. On this sequence, anti-parallel triplex with satisfactory thermodynamic stability is formed by two TFOs, having different lengths. Triplex stability is significantly increased by specific interactions with the perylene derivative N,N′-bis[3,3′-(dimethylamino) propylamine]-3,4,9,10-perylenetetracarboxylic diimide (DAPER). Since DAPER is a symmetric molecule, the induced Circular Dichroism (CD) spectra in the range 400–600 nm allows us to obtain information on drug binding to triplex and duplex DNA. The drug-induced ellipticity is significantly higher in the case of triplex with respect to duplex and, surprisingly, it increases at decreasing of DNA. A model is proposed where self-stacked DAPER binds to triplex or to duplex narrow grooves.

Recognition of Base Pair Inversions in Duplex by Chimeric (α,β) Triplex-Forming Oligonucleotides

DNA recognition by triplex-forming oligonucleotides (TFOs) is usually limited by homopurine-homopyrimidine sequence in duplexes. Modifications of the third strand may overcome this limitation. Chimeric alpha-beta TFOs are expected to form triplex DNA upon binding to non-regular sequence duplexes. In the present study we describe binding properties of chimeric alpha-beta oligodeoxynucleotides in the respect to short DNA duplexes with one, three, and five base pair inversions. Non-natural chimeric TFO's contained alpha-thymidine residues inside (GT) or (GA) core sequences. Modified residues were addressed to AT/TA inversions in duplexes. It was found in the non-denaturing gel-electrophoresis experiments that single or five adjacent base pair inversions in duplexes may be recognized by chimeric alpha-beta TFO's at 10°C and pH 7.8. Three dispersed base pair inversions in the double stranded DNA prevented triplex formation by either (GT) or (GA) chimeras. Estimation of thermal stability of chimeric alpha-beta triplexes showed decrease in Tm values as compared with unmodified complexes.

End invasion of peptide nucleic acids (PNAs) with mixed-base composition into linear DNA duplexes

Peptide nucleic acid (PNA) is a synthetic DNA mimic with valuable properties and a rapidly growing scope of applications. With the exception of recently introduced pseudocomplementary PNAs, binding of common PNA oligomers to target sites located inside linear double-stranded DNAs (dsDNAs) is essentially restricted to homopurine–homopyrimidine sequence motifs, which significantly hampers some of the PNA applications. Here, we suggest an approach to bypass this limitation of common PNAs. We demonstrate that PNA with mixed composition of ordinary nucleobases is capable of sequence-specific targeting of complementary dsDNA sites if they are located at the very termini of DNA duplex. We then show that such targeting makes it possible to perform capturing of designated dsDNA fragments via the DNA-bound biotinylated PNA as well as to signal the presence of a specific dsDNA sequence, in the case a PNA beacon is employed. We also examine the PNA–DNA conjugate and prove that it can initiate the primer-extension reaction starting from the duplex DNA termini when a DNA polymerase with the strand-displacement ability is used. We thus conclude that recognition of duplex DNA by mixed-base PNAs via the end invasion has a promising potential for site-specific and sequence-unrestricted DNA manipulation and detection.

Antigene-block strategy: Effective regulation of gene expression by 2′,4′-BNA-modified TFOs with an additional stem-loop structure

Antigene strategy is promising technology to regulate gene expression. We have previously reported that 2'-O,4'-C-methylene bridged nucleic acid (2',4'-BNA) modification of triplex-forming oligonucleotides (TFOs) significantly enhanced the binding affinity towards the target dsDNA. In spite of its usefulness, the TFO-binding site may not completely overlay the protein-binding site because of the limitation of TFOs targeting sequences. To overcome this problem, we developed an antigene-based new methodology called "antigene-block" strategy. In this methodology, the TFOs bearing a bulky hairpin tail are used for efficient inhibition of protein-DNA interaction. The antigene-block TFOs having 2',4'-BNA modifications formed stable triplexes with the homopurine-homopyrimidine sequence which partially overlap the transcription factor NF-kappaB binding site. In addition, the antigene-block TFOs significantly reduced the expression level of the target-gene in living cells, while conventional 2',4'-BNA-modified or unmodified TFOs showed no effect on the target-gene expression.

Modified Triplexes from Oligonucleotides Bridged by Two Cholane-3,24-diol (3α, 5β) Units

Since the first discovery of triple helix (triplex), 1 it has been suggested that a biologically important three-stranded complex could be constructed from single-stranded RNA and double-stranded DNA. In general, a triplex is formed when a third strand binds in the major groove of a B-form double helix (duplex). The duplex must be composed of a homopurine-homopyrimidine sequence, which represents up to 1% of eukaryotic genomes. 2 Although direct evidence of the participation of triplexes in biological processes has yet to be obtained, a growing body of data suggests that triplexes are involved in the regulation of DNA replication, transcription (“antigene therapy”), recombination, and development. 3 In addition, triplexes have been demonstrated to be stable under physiological conditions and to inhibit various enzymes, including RNA polymerase, 4 DNase, and RNase. 5

Structure of gene flanking regions and functional analysis of sequences upstream of the rat hsp70.1 stress gene

We present structural and comparative analysis of the flanking regions of the rat hsp70.1 stress gene. Several repetitive sequences, microsatellites and short interspersed repetitive elements (SINEs) were found, as well as a significant gap in the 3′ UTR, as compared to the orthologous mouse gene. We also show that the complex microsatellite region composed of partially overlapping inverted repeat and long homopurine–homopyrimidine sequence, which is localized 1.8 kbp upstream of the transcription start site, is capable to adopt non-B DNA structures (an H-DNA and a cruciform structure) in vitro . Functional analysis performed with the use of various fragments of the 5′end flanking regions ligated to the chloramphenicol acetyltransferase (CAT) reporter gene revealed a crucial role of cooperation between heat shock element (HSE) regulatory sequences, while none of the three HSEs alone is able to drive efficient heat induced transcription of the reporter gene. We also found that the microsatellite region does not influence transcription by itself, however, it abolishes the effect of the adjacent putative silencing element. To our knowledge, this is a first extensive structural and functional analysis of the promoter region of the mammalian heat inducible hsp70i gene localized distally to the hsp70-related spermatid-specific gene in the major histocompatibility complex III.

Stable oligonucleotide-directed triplex formation at target sites with CG interruptions: strong sequence-specific recognition by 2',4'-bridged nucleic-acid-containing 2-pyridones under physiological conditions.

A sequence of double-stranded DNA (dsDNA) which can be recognized by a triplex-forming oligonucleotide (TFO) is limited to a homopurine-homopyrimidine sequence. To develop novel nucleoside analogues which recognize CG interruption in homopurine-homopyrimidine dsDNA, we synthesized a novel 2'-O,4'-C-methyleneribonucleic acid (2'-O,4'-C-methylene bridged nucleic acid; 2',4'-BNA) that bears the unnatural nucleobases, 2-pyridone (PB) or its 5-methyl congener (mPB); these analogues were introduced into pyrimidine TFOs using a DNA synthesizer. A TFO with a 2'-deoxy-beta-D-ribofuranosyl-2-pyridone (P) or 2',4'-BNA abasic monomer (HB) was also synthesized. The triplex-forming ability of various synthesized 15-mer TFOs and the corresponding homopurine-homopyrimidine dsDNA, which contained a single pyrimidine-purine (PyPu) interruption, was examined in UV melting experiments. It was found that PB and mPB in the TFOs successfully recognized CG interruption under physiological conditions (7 mM sodium phosphate, 140 mM KCl, 5 mM spermine, pH 7.0). Furthermore, triplex formation between the dsDNA target which contained three CG interruptions and the TFO with three PB units was also confirmed. Additional four-point 2',4'-BNA modifications of the TFO containing three PB units significantly enhanced its triplex-forming ability towards the dsDNA and had a Tm value of 43 degrees C under physiological conditions. These results indicate that a critical inherent problem of TFOs, namely, the sequence limitation of the dsDNA target, may be overcome to a large extent and this should promote antigene applications of TFOs in vitro and in vivo.

Site-resolved energetics in DNA triple helices containing G*TA and T*CG triads.

Recognition of specific sites in double-helical DNA by triplex-forming oligonucleotides has been limited until recently to sites containing homopurine-homopyrimidine sequences. G*TA and T*CG triads, in which TA and CG base pairs are specifically recognized by guanine or by thymine, have now extended this recognition code to DNA target sites of mixed base sequences. In the present work, we have obtained a characterization of the stabilities of G*TA and T*CG triads, and of the effects of these triads upon canonical triads, in triple-helical DNA. The three DNA triplexes investigated are formed by the folding of the 31-mers d(GAAXAGGT(5)CCTYTTCT(5)CTTZTCC) with X = G, T, or C, Y = C, A, or G, and Z = C, G, or T. We have measured the exchange rates of imino protons in each triad of the three triplexes using nuclear magnetic resonance spectroscopy. The exchange rates are used to map the local free energy of structural stabilization in each triplex. The results indicate that the stability of Watson-Crick base pairs in the G*TA and T*CG triads is comparable to that of Watson-Crick base pairs in canonical triads. The presence of G*TA and T*CG triads, however, destabilizes neighboring canonical triads, two or three positions removed from the G*TA/T*CG site. Moreover, the long-range destabilizing effects induced by the T*CG triad are larger than those induced by the G*TA triad. These findings reveal the molecular basis for the lower overall stability of G*TA- and T*CG-containing triplexes.

Evidence for a DNA triplex in a recombination-like motif: I. Recognition of Watson-Crick base pairs by natural bases in a high-stability triplex.

Data are presented on a triplex type with two parallel homologous strands for which triplex formation is almost as strong as duplex formation at least for some sequences and even at pH 7 and 0.2 M NaCl. The evidence mainly rests upon comparing thermodynamic properties of similar systems. A paperclip oligonucleotide d(A12C4T12C4A12) with two linkers C4 obviously can form a triplex with parallel back-folded adenine strand regions, because the single melting transition of this complex splits in two transitions by introducing mismatches only in the third strand region. Respectively, a hairpin duplex d(A12C4T12) and a single strand d(A12) form a triplex as a 1:1 complex in which the second adenine strand is parallel oriented to the homologous one in the Watson-Crick paired duplex. In this system the melting temperature T(m) of the triplex is practically the same as that of the duplex d(A12)-d(T12), at least within a complex concentration range of 0.2-4.0 microM. The melting behaviour of complexes between triplex stabilizing ligand BePI and the system hairpin duplex plus single strand supports the triplex model. Non-denaturing gel electrophoresis suggests the existence of a triplex for a system in which five of the twelve A-T*A base triads are substituted by C-G*C base triads. The recognition between any substituted Watson-Crick base pair (X-Y) in the hairpin duplex d(A4XA7C4T7YT4) and the correspondingly replaced base (Z) in the third strand d(A4ZA7) is mutually selective. All triplexes with matching base substitutions (Z = X) have nearly the same stability (T(m) values from 29 to 33.5 degrees C), whereas triplexes with non-matching substitutions (Z not equal X) show a clearly reduced stability (T(m) values from 15 to 22 degrees C) at 2microM equimolar oligonucleotide concentration. Most nucleic acid triple helices hitherto known are limited to homopurine-homopyrimidine sequences in the target duplex. A stable triplex formation is demonstrated for inhomogeneous sequences tolerating at least 50% pyrimidine content in the homologous strands. On the basis of the surprisingly similar thermodynamic parameters for duplex and triplex, and of the fact that this triplex type seems to be more stable than many other natural DNA triplexes known, and on the basis of semiempirical and molecule mechanical calculations, we postulate bridging interactions of the third strand with the two other strands in the triplex according to the recombination motif. This triplex, denoted by us 'recombination-like form', tolerates heterogeneous base sequences.

Inhibition of gene expression and cell proliferation by triple helix-forming oligonucleotides directed to the c-myc gene.

Triple helix-forming oligonucleotides (TFOs) bind with high affinity and specificity to homopurine-homopyrimidine sequences in DNA and have been shown to inhibit transcription of target genes in various experimental systems. In the present study, we evaluated the ability of 3'-amino-modified phosphodiester TFOs directed to four sites in the c-myc gene to inhibit gene expression and proliferation of human leukemia (CEM, KG-1, and HL-60) and lymphoma (Raji and ST486) cells. GT-rich TFOs were designed to target sequences located either upstream (myc1 and -2) or downstream (myc3 and -4) of the P2 promoter, which is the major c-myc promoter. Myc2, which was directed to a site immediately upstream of this promoter, inhibited c-myc expression and proliferation of CEM cells. The effects of this TFO were sequence- and target-specific, since control oligonucleotides and TFOs directed to other sites were less or not active. Myc2 was also effective in KG-1, HL-60, and Raji cells. In contrast, ST486 cells were more sensitive to myc3, which targets a sequence in intron 1 upstream of the P3 promoter, than myc2. As result of a chromosomal translocation, P3 is the active promoter in ST486 cells. This study demonstrates the activity and specificity of TFOs designed to act as repressors of c-myc gene expression in human leukemia and lymphoma cells. Our results suggest that this is a valid approach to selectively inhibit gene expression and cancer cell growth, and encourage further investigation of its potential applications in cancer therapy.

Activation volume of DNA duplex formation.

The denaturation-renaturation thermal hysteresis was used to investigate the kinetics of the helix-coil equilibrium of four 22-base pair homopurine-homopyrimidine duplex oligonucleotides with fractional G x C base pair content (f(G x C)) between 0.14 and 0.5. In 20 mM NaCl and 20 mM Tris-HCl at pH 7.0 and at hydrostatic pressures up to 200 MPa, a two-state bimolecular reaction mechanism adequately described the observed kinetics. At 1 MPa and 47 degrees C, the rate constant for helix formation, k1, increased by a factor of 210, and the reverse rate constant, k(-1), decreased by a factor of 420 upon increasing f(G x C) from 0.14 to 0.5. The activation energies for formation of the duplexes were negative and relatively insensitive to f(G x C). The pressure-induced change in the rate constants is related to the activation volume of the reaction step. Pressure causes k1 to become larger, and the magnitude of the change in k1 with pressure increases the lower the f(G x C) value. Thus, when f(G x C) = 0.14, the activation volume for forward reaction, delta V++(1), equals -20 mL/mol, while when f(G x C) = 0.5, delta V++(1) = -6.7 mL/mol. The rate constant for strand separation, k(-1), decreases at high pressure. The activation volume for this step, delta V++(1), varies from 17 to 1.6 mL/mol when f(G x C) = 0.14 and 0.5, respectively. The delta V for helix formation calculated from the activation parameters changed from -23 mL/mol when f(G x C) = 0.14 to -5.8 mL/mol when f(G x C) = 0.5. From extrapolation, it is estimated that the molar volume change for formation of G x C base pairs in homopurine-homopyrimidine sequences is approximately 0 mL/mol. Parameters calculated from kinetics of other two duplex molecules, when f(G x C) = 0.23 and 0.32, lie between these extremes.

A particular DNA structure is required for the function of a cis-acting component of the Epstein-Barr virus OriLyt origin of replication.

OriLyt, thecis-acting element of Epstein-Barr virus lytic origin of replication, consists of upstream and downstream components. The upstream component plays a dual role in transcription and replication. The downstream component contains a homopurine-homopyrimidine sequence which forms an H palindrome. We show that the downstream component can adopt a triple helix structure in vitro, that the 5' border of the homopyrimidine sequence is sensitive to P1 nuclease when carried by a supercoiled plasmid and that an oligonucleotide complementary to the homopyrimidine strand is taken up by a plasmid carrying the OriLyt H palindrome. We also show that all mutations which alter the H palindrome impair both oligonucleotide uptake and OriLyt-dependent replication. Interestingly, compensatory mutations which restore an H palindrome also restore oligonucleotide uptake by the mutated plasmids and their OriLyt-dependent replication. Thus, there is a strong correlation between the inability of the OriLyt H palindrome to form a non-B-DNA structure in vitro and impairment of OriLyt-dependent replication. This suggests that the presence of a non-B-DNA structure in the OriLyt downstream component is required for OriLyt-dependent replication.

DNA isolation using avidin-coated magnetic nanoclusters

Using simple colloidal processing techniques, we have produced stable suspensions of avidin-coated magnetic nanoclusters and demonstrated their efficacy in magnetic triple-helix affinity capture. A mixture of target and non-target DNA is incubated with a biotinylated oligonucleotide containing a triple-helix sequence that binds to the homopurine-homopyrimidine sequence in the target under mild acidic conditions. The target DNA is then “magnetized” by contact with avidin-coated magnetic nanoclusters through the avidin-biotin linkage. Exposure to a magnetic field gradient selectively moves the target and immobilizes the particles in the region of the highest magnetic field, leaving the non-target DNA dispersed in the remaining solution. This solution is withdrawn in the presence of the magnetic field gradient. The immobilized particle-target clusters are then exposed to mild basic conditions. The triple helix dissociates, releasing the magnetized oligonucleotides without affecting the double-stranded DNA. A second application of the magnetic field gradient is used to separate the magnetic particles from the DNA. The double-stranded target DNA is then available directly for further processing.

(A,G)-oligonucleotides form extraordinary stable triple helices with a critical R.Y sequence of the murine c-Ki-ras promoter and inhibit transcription in transfected NIH 3T3 cells.

The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.

Characterization of the DNA triplex formed by d(TGGGTGGGTGGTTGGGTGGG) and a critical R · Y sequence located in the promoter of the murine Ki- ras proto-oncogene

The binding of the G-rich oligonucleotide d(TGGGTGGGTGGTTGGGTGGG) to a critical homopurine-homopyrimidine sequence located in the promoter of the murine Ki- ras proto-oncogene has been investigated. The duplex and the oligonucleotide form a triple helix as evidenced by band-shift electrophoresis, hydroxyapatite (HA) chromatography, UV-melting and circular dichroism (CD) experiments. Upon thermal denaturation in 50 mM Tris-acetate, pH 7.4, 50 mM NaCl, 10 mM MgCl 2, 0.1 mM spermine the triplex exhibits two cooperative transitions: one of these is attributed to the triplex-to-duplex transformation, the other to the duplex-to-coil transformation. The thermodynamic parameters of triplex formation have been determined by a van't Hoff analysis of the UV-melting curves which provided values of ΔH = 79 ± 8 kcal/mol, δS = 224 22 e.u., ΔG 298 = 12.2 ± 1.2 kcal/mol. These data are compared with those reported for the YRY triplex motif.

Trapping DNA polymerases using triplex-forming oligodeoxyribonucleotides.

Triplexes (triple helices) formed within DNA templates prior to or during DNA synthesis cause DNA polymerase to terminate [Samadashwily et al., EMBO J. 13 (1993) 4975-4983]. Here, we show that triplex-forming oligodeoxyribonucleotides (oligos) efficiently trap DNA polymerases at target DNA sequences within single-stranded (ss) templates. This was observed for all studied DNA polymerases, including Sequenase and the thermophilic Taq and Vent polymerases. The termination rate depends on the fine structure of a triplex, as well as on ambient conditions such as temperature and the concentration of magnesium ions. Inhibition of DNA synthesis was observed not only when triplexes blocked the path of DNA polymerase, but also when a polymerization primer was involved in triplex formation. Escherichia coli ss-binding (SSB) protein helps DNA polymerase overcome the triplex barrier, but with an efficiency dramatically dependent on the triplex configuration. These results describe a novel method for blocking DNA replication at target homopurine-homopyrimidine sequences by means of triplex-forming oligos in direct analogy with similar results during transcription.