High Plains Virus Research Articles

Development of a Multiplex RT-PCR Assay for Simultaneous Detection of Ten Major Viral Pathogens of Wheat

Triticum mosaic virus (TriMV) and High plains virus (HPV), identified recently, have been considered among the major viruses that affect wheat. Carried by the same vector, wheat curl mite, both of these viruses cause yellowing and stunting of plants which are very similar to many other viruses attacking wheat. This makes it difficult to detect these viruses in different wheat lines, posing a major problem in the yield. This paper highlights the addition of these two viruses to a multiplex RT-PCR based method which already detected the presence of barley and cereal yellow dwarf viruses (B/CYDVs), soil-borne wheat mosaic virus (SBWMV), wheat spindle streak mosaic virus (WSSMV), and wheat streak mosaic virus (WSMV). The method uses specific sets of primers that detect the target viruses TriMV and HPV at 560 bp and 490 bp, respectively, in the presence of other distinct viruses such as B/CYDVs -PAV, -MAV, -SGV, -RPV, -RMV, WSSMV, SBWMV, and WSMV at 295, 175, 237, 400, 365, 154, 219, and 193 bp, respectively. The forward primer for each specific virus was fluorescently tagged to detect it in a higher throughput manner in capillary electrophoresis. All ten viruses may be viewed as peaks in an electropherogram from the capillary electrophoresis corresponding to their product sizes in base pairs. This advancement in the protocol allows detection of all ten wheat viruses in a single test, thus improving the diagnostic capability with only a slight increase in cost.

High Plains wheat mosaic virus: An enigmatic disease of wheat and corn causing the High Plains disease.

Brief historyIn 1993, severe mosaic and necrosis symptoms were observed on corn (maize) and wheat from several Great Plains states of the USA. Based on the geographical location of infections, the disease was named High Plains disease and the causal agent was tentatively named High Plains virus. Subsequently, researchers renamed this virus as maize red stripe virus and wheat mosaic virus to represent the host and symptom phenotype of the virus. After sequencing the genome of the pathogen, the causal agent of High Plains disease was officially named as High Plains wheat mosaic virus. Hence, High Plains virus, maize red stripe virus, wheat mosaic virus, and High Plains wheat mosaic virus (HPWMoV) are synonyms for the causal agent of High Plains disease.TaxonomyHigh Plains wheat mosaic virus is one of the 21 definitive species in the genus Emaravirus in the family Fimoviridae.VirionThe genomic RNAs are encapsidated in thread‐like nucleocapsids in double‐membrane 80–200 nm spherical or ovoid virions.Genome characterizationThe HPWMoV genome consists of eight single‐stranded negative‐sense RNA segments encoding a single open reading frame (ORF) in each genomic RNA segment. RNA 1 is 6,981‐nucleotide (nt) long, coding for a 2,272 amino acid protein of RNA‐dependent RNA polymerase. RNA 2 is 2,211‐nt long and codes for a 667 amino acid glycoprotein precursor. RNA 3 has two variants of 1,439‐ and 1,441‐nt length that code for 286 and 289 amino acid nucleocapsid proteins, respectively. RNA 4 is 1,682‐nt long, coding for a 364 amino acid protein. RNA 5 and RNA 6 are 1,715‐ and 1,752‐nt long, respectively, and code for 478 and 492 amino acid proteins, respectively. RNA 7 and RNA 8 are 1,434‐ and 1,339‐nt long, code for 305 and 176 amino acid proteins, respectively.Biological propertiesHPWMoV can infect wheat, corn (maize), barley, rye brome, oat, rye, green foxtail, yellow foxtail, and foxtail barley. HPWMoV is transmitted by the wheat curl mite and through corn seed.Disease managementGenetic resistance against HPWMoV in wheat is not available, but most commercial corn hybrids are resistant while sweet corn varieties remain susceptible. Even though corn hybrids are resistant to virus, it still serves as a green bridge host that enables mites to carry the virus from corn to new crop wheat in the autumn. The main management strategy for High Plains disease in wheat relies on the management of green bridge hosts. Cultural practices such as avoiding early planting can be used to avoid mite buildup and virus infections.

Occurrence of Viruses and Clavibacter michiganensis in Winter Wheat in Illinois, 2009 to 2011 and 2019 to 2020

Field surveys in 2009, 2010, 2011, 2019, and 2020 determined the incidence and diversity of viruses present in fields of soft red winter wheat (Triticum aestivum) in Illinois. In addition, the putative presence of the bacterial mosaic pathogen, Clavibacter michiganensis subsp. tessellarius (Cmt), was evaluated. A total of 341 fields were sampled across years, and plants were tested for barley yellow dwarf virus (BYDV-PAV; BYDV-MAV), barley stripe mosaic virus (BSMV), brome mosaic virus (BMV), cereal yellow dwarf virus (CYDV-RPV), High Plains virus (HPV), Potyvirus group (POTY), soil-borne wheat mosaic virus (SBWMV), tobacco mosaic virus (TMV), wheat spindle streak mosaic virus (WSSMV), wheat streak mosaic virus (WSMV), and Cmt using ELISA. Average field incidence across years varied by virus with BYDV-PAV (22%), WSSMV (16%), CYDV-RPV (7%), WSMV (3%), and HPV (0.5%) detected in samples. The bacterial mosaic pathogen (Cmt), or potentially a related species of Clavibacter, was detected the most frequently in each year, with an average incidence of 77%. The consistent detection of Cmt warrants further study to determine the nature of the organisms associated with positive Cmt tests and their role in Illinois wheat production systems.

Seed-Transmitted Wheat Mosaic Virus in Sweet Corn in Utah

Wheat mosaic virus (WMoV) (syn. High Plains virus) causes chlorotic streaks and mosaic on corn foliage, and it stunts ear development. In 2016 and 2017, plants in a sweet corn crop in northern Utah developed chlorotic streaking on leaves, and the plants remained stunted throughout the growing season but did not die after emergence. Symptoms ranged from bright yellow to nearly white streaks in stunted plants to faint chlorosis in plants that grew to normal height but only developed one ear or no ears. The symptoms resembled those caused by WMoV. Imaging using an unmanned aerial vehicle with a near-infrared camera showed that infected plants were scattered randomly across the field, a pattern often observed with seed-transmitted pathogen. All five symptomatic plants tested positive for WMoV. To confirm that no other virus was present, two samples of symptomatic plants were sent to a commercial laboratory, where they were screened for 11 viruses. They only tested positive for WMoV. In greenhouse grow-out tests, 83% of the seed germinated, and six plants developed symptoms in the first 5 weeks after emergence. The symptomatic seedlings were tested for WMoV, confirming infection. This study confirmed WMoV can be seed transmitted under field conditions.

Wheat Genotypes With Combined Resistance to Wheat Curl Mite, Wheat Streak Mosaic Virus, Wheat Mosaic Virus, and Triticum Mosaic Virus.

The wheat curl mite, Aceria tosichella Keifer, (WCM) is a global pest of bread wheat that reduces yields significantly. In addition, WCM carries Wheat streak mosaic virus (WSMV, family Potyviridae, genus Tritimovirus), the most significant wheat virus in North America; High Plains wheat mosaic virus (HPWMoV, genus Emaravirus, formerly High plains virus); and Triticum mosaic virus (TriMV, family Potyviridae, genus Poacevirus). Viruses carried by WCM have reduced wheat yields throughout the U.S. Great Plains for >50 yr, with average yield losses of 2-3% and occasional yield losses of 7-10%. Acaricides are ineffective against WCM, and delayed planting of winter wheat is not feasible. Five wheat breeding lines containing Cmc4, a WCM resistance gene from Aegilops tauschii, and Wsm2, a WSMV resistance gene from wheat germplasm CO960293-2 were selected from the breeding process and assessed for phenotypic reaction to WCM feeding, population increase, and the degree of WSMV, HPWMoV, and TriMV infection. Experiments determined that all five lines are resistant to WCM biotype 1 feeding and population increase, and that two breeding lines contain resistance to WSMV, HPWMoV, and TriMV infection as well. These WCM-, WSMV-, HPWMoV-, and TriMV-resistant genotypes can be used improve management of wheat yield losses from WCM-virus complexes.

Role of Viral Diagnostics in Quarantine for Plant Genetic Resources and Preparedness

International exchange of plant genetic resources (PGR) and trade play an important role in the long-distance dissemination of destructive viruses/strains. The ICAR-NBPGR has been empowered for quarantine processing of imported PGR including transgenics meant for research purposes. Adopting a workable strategy of post-entry quarantine growing/inspection followed by use of combination of detection techniques viz., electron microscopy, ELISA and RT-PCR, 45 viruses of great economic and quarantine importance were intercepted in imported PGR in the last three decades (1985–2016). The interceptions include 19 viruses not yet reported from India viz., Barley stripe mosaic virus, Bean mild mosaic virus, Bean pod mottle virus, Broad bean mottle virus, Broad bean stain virus, Broad bean true mosaic virus, Cherry leaf roll virus, Cowpea mottle virus, Cowpea severe mosaic virus, Dioscorea latent virus, Garlic virus C, High plains virus, Maize chlorotic mottle virus, Pea enation mosaic virus, Peanut sunt virus, Pepino mosaic virus, Raspberry ringspot virus, Tomato ringspot virus and Wheat streak mosaic virus. Besides, 21 viruses not known to occur on particular host(s) in India were intercepted and 23 viruses were intercepted in germplasm imported from CGIAR centres. Fourteen viruses including nine viruses not reported from India have been intercepted in transgenic germplasm. Even though some of the intercepted viruses are not known to occur in India, their potential vectors exist and also congenial conditions to multiply, disseminate and spread destructive exotic viruses/strains. India also need to establish a strong network of interconnected accredited laboratories able to quickly diagnose new viruses/strains; enhance surveillance capacity and develop early warning systems. This makes it imperative that India should put in place a “National Plant Pests Diagnostic and Certification Network” to enhance preparedness.

Occurrence of Viruses and Associated Grain Yields of Paired Symptomatic and Nonsymptomatic Tillers in Kansas Winter Wheat Fields.

Vector-borne virus diseases of wheat are recurrent in nature and pose significant threats to crop production worldwide. In the spring of 2011 and 2012, a state-wide sampling survey of multiple commercial field sites and university-managed Kansas Agricultural Experiment Station variety performance trial locations spanning all nine crop-reporting regions of the state was conducted to determine the occurrence of Barley yellow dwarf virus-PAV (BYDV-PAV), Cereal yellow dwarf virus-RPV, Wheat streak mosaic virus (WSMV), High plains virus, Soilborne wheat mosaic virus, and Wheat spindle streak mosaic virus using enzyme-linked immunosorbent assays (ELISA). As a means of directly coupling tiller infection status with tiller grain yield, multiple pairs of symptomatic and nonsymptomatic plants were selected and individual tillers were tagged for virus species and grain yield determination at the variety performance trial locations. BYDV-PAV and WSMV were the two most prevalent species across the state, often co-occurring within location. Of those BYDV-PAV- or WSMV-positive tillers, 22% and 19%, respectively, were nonsymptomatic, a finding that underscores the importance of sampling criteria to more accurately assess virus occurrence in winter wheat fields. Symptomatic tillers that tested positive for BYDV-PAV produced significantly lower grain yields compared with ELISA-negative tillers in both seasons, as did WSMV-positive tillers in 2012. Nonsymptomatic tillers that tested positive for either of the two viruses in 2011 produced significantly lower grain yields than tillers from nonsymptomatic, ELISA-negative plants, an indication that these tillers were physiologically compromised in the absence of virus-associated symptoms. Overall, the virus survey and tagged paired-tiller sampling strategy revealed effects of virus infection on grain yield of individual tillers of plants grown under field conditions and may provide a complementary approach toward future estimates of the impact of virus incidence on crop health in Kansas.

The Effect of Temperature, Relative Humidity, and Virus Infection Status on off-host Survival of the Wheat Curl Mite (Acari: Eriophyidae).

The wheat curl mite, Aceria tosichella Keifer, is an eriophyid pest of wheat, although its primary economic impact on wheat is due to the transmission of Wheat streak mosaic (WSMV), Wheat mosaic (also known as High Plains virus), and Triticum mosaic (TriMV) viruses. These viruses cause significant annual losses in winter wheat production throughout the western Great Plains. Temperature and humidity are factors that often influence arthropod survival, especially during dispersal from their hosts, yet the impact of these two factors on off-host survival has not been documented for wheat curl mite. Pathogen-infected host plants often influence the biology and behavior of vectors, yet it is not known if virus-infected wheat affects off-host survival of wheat curl mite. The objectives of this study were to 1) determine if temperature, relative humidity, and mite genotype impact off-host survival of wheat curl mite and 2) determine the effect of WSMV- and TriMV-infected host plants on off-host survival of wheat curl mite. Temperature and relative humidity significantly affected off-host survival of wheat curl mite. Length of survival decreased with increasing temperature (106.2 h at 10°C and 17.0 h at 30°C) and decreasing relative humidity (78.1 h at 95 and 21.3 h at 2%). Mites from TriMV-infected host plants had ∼20% reduction in survival at 20°C compared with those from WSMV-infected plants. The duration of off-host survival of wheat curl mite is influenced by environmental conditions. Management strategies that target a break in host presence will greatly reduce mite densities and virus spread and need to account for these limits.

Differential Transmission of Triticum mosaic virus by Wheat Curl Mite Populations Collected in the Great Plains.

Wheat is an important food grain worldwide and the primary dryland crop in the western Great Plains. A complex of three wheat curl mite (WCM)-transmitted viruses (Wheat streak mosaic virus, High plains virus, and Triticum mosaic virus [TriMV]) is a cause of serious loss in winter wheat production in the Great Plains. TriMV was first reported in Kansas in 2006 and later found in most other Great Plains states. Currently, three populations of WCM have been identified by genetic characterization and differential responses to mite resistance genes in wheat. In this study, we examined TriMV transmission by these three WCM populations: 'Nebraska' (NE), 'Montana' (MT), and 'South Dakota' (SD). Mite transmission using single-mite transfers revealed that the NE WCM population transmitted TriMV at 41%, while the MT and SD WCM populations failed to transmit TriMV. In multi-mite transfers, the NE WCM population transmitted TriMV at 100% level compared with 2.5% transmission by MT and SD WCM populations. Interestingly, NE mites transferred during the quiescent stages following the first and second instar transmitted TriMV at a 39 to 40% rate, suggesting that immature mites were able to acquire the virus and maintain it through molting. In addition, mite survival for single-mite transfers was significantly lower for NE mites when transferred from TriMV-inoculated source plants (60%) compared with mock-inoculated source plants (84%). This demonstrates potentially negative effects on WCM survival from TriMV. TriMV transmission differences demonstrated in this study underscore the importance of identification of mite genotypes for future studies with TriMV.

First Report of Wheat mosaic virus Infecting Wheat in Western Australia.

In eastern Australia, there have been several as yet unconfirmed reports of Wheat mosaic virus (WMoV) infecting wheat (3). WMoV, previously known as High plains virus (HPV), is transmitted by the wheat curl mite (WCM, Aceria tosichella). It is often found in mixed infections with Wheat streak mosaic virus (WSMV), also transmitted by WCM (2,3). WSMV was first identified in Australia in 2003 (3). In October 2012, stunted wheat plants with severe yellow leaf streaking were common in a field experiment near Corrigin in Western Australia consisting of nine wheat cultivars. These symptoms were also common in two commercial crops of wheat cv. Mace near Kulin. Leaf samples (one per plant) from each location were tested by ELISA using specific antiserum to WMoV (syn. HPV 17200, Agdia, Elkhart, IN). At the field experiment, 20 leaf samples were collected at random from each wheat plot (4 replicates) and tested individually by ELISA. WMoV incidence was 5% for cv. Yipti, 16% for cvs Emu Rock, Wyalkatchem and Mace, 22% for cvs. Corack, Fortune, Calingiri, and Magenta, and 55% for cv. Cobra. From the two commercial wheat crops, 100 leaf samples were collected at random from each and tested by ELISA. WMoV incidence was 2 and 4%. In addition, 50 leaf samples of Hordeum leporinum (barley grass) and 20 of Lolium rigidum (annual ryegrass) were collected and tested by ELISA. WMoV incidence was 2% in H. leporinum, but 0% in L. rigidum. Infected H. leporinum plants were symptomless. Symptomatic wheat leaf samples from both sites were tested by RT-PCR using WMoV specific primers designed from its RNA3 sequence (1). The PCR products (339 bp) were sequenced and lodged in GenBank (Accession Nos KC337341 and KC337342). WMoV isolates from Corrigin (WA-CG12) and Kulin (WA-KU12) had identical sequences. When the nucleic acid sequences of WA-CG12 and WA-KU12 were compared with those of the three other WMoV isolates on GenBank, they had 100% nucleotide sequence identity with a Nebraska isolate (U60141), and 99.7% identity to two United States sweet corn isolates (AY836524 and AY836525). Ten symptomatic wheat plants were collected from each location, transplanted into pots and leaf samples tested individually for WMoV and WSMV (07048, Loewe, Germany) by ELISA. All were infected with both viruses and infested with WCM. WCM-infested glumes (>10 WCM/glume) were placed on the leaf sheaths of 60 wheat plants cv. Calingiri (35 with WA-CG12 and 25 with WA-KU12) and 13 sweet corn plants cv. Snow Gold (WA-CG12 only). In addition, 20 wheat and 10 sweet corn plants were left without infested glumes to be uninoculated controls. All 60 WCM-inoculated wheat plants became stunted with severe leaf streaking. When leaf samples from each plant were tested by ELISA 18 to 30 days later, both viruses were detected. WMoV was detected in all 13 WCM-inoculated sweet corn plants and WSMV in two of them. Plants with WMoV alone initially had short chlorotic leaf streaks that subsequently combined, causing broad streaks. These are typical WMoV symptoms for sweet corn (1). No symptoms developed and no virus was detected in any of the uninoculated wheat or sweet corn control plants. The WMoV nucleotide sequence obtained from an infected sweet corn plant was identical to those of WA-CG12 and WA-KU12. To our knowledge, this is the first confirmed report of WMoV presence in Australia.

Quantification of Yield Loss Caused by Triticum mosaic virus and Wheat streak mosaic virus in Winter Wheat Under Field Conditions.

Triticum mosaic virus (TriMV) and Wheat streak mosaic virus (WSMV) infect winter wheat (Triticum aestivum) in the Great Plains region of the United States. The two viruses are transmitted by wheat curl mites (Aceria tosichella), which also transmit High Plains virus. In a field study conducted in 2011 and 2012, winter wheat cultivars Millennium (WSMV-susceptible) and Mace (WSMV-resistant) were mechanically inoculated with TriMV, WSMV, TriMV+WSMV, or sterile water at the two-leaf growth stage. Chlorophyll meter (soil plant analysis development [SPAD]) readings, area under the SPAD progress curve (AUSPC), grain yield (=yield), yield components (spikes/m2, kernels/spike, 1,000-kernel weight), and aerial dry matter were determined. In Millennium, all measured variables were significantly reduced by single or double virus inoculation, with the greatest reductions occurring in the double-inoculated treatment. Among the yield components, the greatest reductions occurred in spikes/m2. In Mace, only AUSPC was significantly reduced by the TriMV+WSMV treatment in 2012. There was a significant (P ≤ 0.05), negative linear relationship between SPAD readings and day of year in all inoculation treatments in Millennium and in the TriMV+WSMV treatment in Mace. There were significant (P ≤ 0.05), positive linear relationships between yield and SPAD readings and between yield and aerial dry matter in Millennium but not in Mace. The results from this study indicate that under field conditions, (i) Mace, a WSMV-resistant cultivar, is also resistant to TriMV, and (ii) double inoculation of winter wheat by TriMV and WSMV exacerbates symptom expression and yield loss in a susceptible cultivar.

Wheat mosaic virus (WMoV), the Causal Agent of High Plains Disease, is Present in Ohio Wheat Fields.

High Plains disease was first described in wheat (Triticum aestivum) in Nebraska, Idaho, Texas, and other High Plains states in 1993 to 1994 (1). The causal agent is a negative sense RNA virus in the genus Emaravirus with at least three genome segments, which is transmitted by the wheat curl mite (Aceria tosichella Keifer) (2). This virus is variously referred to as High Plains virus (HPV), Maize red stripe virus (MRSV/MRStV), or Wheat mosaic virus (WMoV) in the literature. We adopt the name WMoV based on the latest recommendation (3). The presence of WMoV in Ohio was revealed through a comprehensive survey conducted in early spring 2012. Specifically, wheat plants exhibiting virus-like symptoms including chlorosis, reddening, stunting, spotting, or striping were collected from 27 wheat fields in 14 counties throughout Ohio, between March 20 and April 15, 2012. Total RNA was extracted from individual leaf samples, then pooled prior to ribosomal RNA removal and high throughput RNA-sequencing (RNA-Seq) using the Illumina HiSeq2000 platform (University of Illinois Biotechnology Center, Champaign-Urbana, IL). The resulting sequences were assembled and analyzed using CLC Genomics Workbench 5.5 software (CLC Bio, Cambridge, MA). One 983-nt contig was 99% identical to the nucleocapsid protein (NP)-coding RNA segment of WMoV (GenBank Accession DQ324466). We used reverse transcription (RT)-PCR to determine the distribution of WMoV in individual samples using WMoV-specific primers: WMoV NPf1 (TGCTATGTCATTGTTCAGGTGGTC), and WMoV NPr1 (TTAGGCAGTCCTTGATTGTGCTG). WMoV was identified in one sample each from Miami, Auglaize, and Paulding Counties, which are all in western Ohio. The WMoV-positive plants were chlorotic, with varying degrees of stunting and leaf striping. The presence of WMoV in the three samples was confirmed using protein A sandwich (PAS)-ELISA with WMoV-specific antiserum. Vascular puncture inoculation (VPI) (4) was used to inoculate germinating maize seed (cv. Spirit) with the extracts from the WMoV-positive samples. WMoV was detected in two of 378 surviving inoculated plants by RT-PCR and PAS-ELISA. These two WMoV-positive maize plants developed flecking mosaic symptoms on upper uninoculated leaves, consistent with reported WMoV symptoms. The WMoV-positive sample from Auglaize County also contained Wheat streak mosaic virus (WSMV), and 60 of the 120 surviving plants inoculated with this sample were positive for WSMV. This result suggests that, even with VPI, mechanical transmission of WMoV remains a great challenge. To our knowledge, this is the first report of WMoV in Ohio, and demonstrates that WMoV is more widespread than previously thought, reaching at least the eastern edge of the Midwest wheat production region. The expanding distribution of this emerging virus is significant because of its potential to cause additional yield losses in wheat.

Occurrence and Distribution of Triticum mosaic virus in the Central Great Plains.

Wheat curl mite (WCM)-transmitted viruses-namely, Wheat streak mosaic virus (WSMV), Triticum mosaic virus (TriMV), and the High Plains virus (HPV)-are three of the wheat-infecting viruses in the central Great Plains of the United States. TriMV is newly discovered and its prevalence and incidence are largely unknown. Field surveys were carried out in Colorado, Kansas, Nebraska, and South Dakota in spring and fall 2010 and 2011 to determine TriMV prevalence and incidence and the frequency of TriMV co-infection with WSMV or HPV in winter wheat. WSMV was the most prevalent and was detected in 83% of 185 season-counties (= s-counties), 73% of 420 season-fields (= s-fields), and 35% of 12,973 samples. TriMV was detected in 32, 6, and 6% of s-counties, s-fields, and samples, respectively. HPV was detected in 34, 15, and 4% of s-counties, s-fields, and samples, respectively. TriMV was detected in all four states. In all, 91% of TriMV-positive samples were co-infected with WSMV, whereas WSMV and HPV were mainly detected as single infections. The results from this study indicate that TriMV occurs in winter wheat predominantly as a double infection with WSMV, which will complicate breeding for resistance to WCM-transmitted viruses.

Multiple Categories of Resistance to Wheat Curl Mite (Acari: Eriophyidae) Expressed in Accessions of <I>Aegilops tauschii</I>

The wheat curl mite, Aceria tosichella Keifer, is an important pest in the western plains of the United States as well as in most major wheat-growing regions of the world. This mite is a vector of the economically important diseases wheat streak mosaic virus (WSMV), Triticum mosaic virus (TriMV), and High Plains virus (HPV). This study looked at seven accessions of Aegilops tauschii (Coss) Schmal to determine if they exhibit antibiosis, tolerance, and/or antixenosis to the wheat curl mite using 'Jagger', a known wheat curl mite-susceptible variety, and OK05312, a known wheat curl mite-resistant variety, as controls. Four of the seven tested accessions showed antibiotic effects on the population growth of wheat curl mite, as demonstrated by low number of wheat curl mite adults and nymphs at the end of the experiment. Three accessions and the commercial wheat variety Jagger showed some level of tolerance to wheat curl mite infestations, as demonstrated by a significantly reduced percentage proportional tissue dry weight and by tolerance index values. Four accessions demonstrated a strong antixenotic effect on the wheat curl mite, as demonstrated by significantly reduced numbers of mite adults at the end of the experiment. This study also established an effective method for determining antixenosis to the wheat curl mite in wheat that can be used for future experiments. All accessions demonstrated at least one type of plant resistance that could provide a genetic source for control of the wheat curl mite that may have the potential to be transferred into commercial wheat varieties.

Genetic Characterization of North American Populations of the Wheat Curl Mite and Dry Bulb Mite

The wheat curl mite, Aceria tosichella Keifer, transmits at least three harmful viruses, wheat streak mosaic virus (WSMV), high plains virus (HPV), and Triticum mosaic virus (TriMV) to wheat (Triticum aestivum L.) throughout the Great Plains. This virus complex is considered to be the most serious disease of winter wheat in the western Great Plains. One component of managing this disease has been developing mite resistance in wheat; however, identification of mite biotypes has complicated deployment and stability of resistance. This biotypic variability in mites and differential virus transmission by different mite populations underscores the need to better understand mite identity. However, A. tosichella has a history of serious taxonomic confusion, especially as it relates to A. tulipae Keifer, the dry bulb mite. Molecular techniques were used to genetically characterize multiple A. tosichella populations and compare them to populations of A. tulipae. DNA from these populations was polymerase chain reaction amplified and the ribosomal ITS2 region sequenced and compared. These results indicated limited variability between these two species, but two distinct types within A. tosichella were found that corresponded to previous work with Australian mite populations. Further work using sequencing of several mitochondrial DNA genes also demonstrated two distinct types of A. tosichella populations. Furthermore, the separation between these two A. tosichella types is comparable to their separation with A. tulipae, suggesting that species scale differences exist between these two types ofA. tosichella. These genetic differences correspond to important biological differences between the types (e.g., biotypic and virus transmission differences). In light of these differences, it is important that future studies on biological response differences account for these mite differences.

Emaravirus: A Novel Genus of Multipartite, Negative Strand RNA Plant Viruses

Ringspot symptoms in European mountain ash (Sorbus aucuparia L.), fig mosaic, rose rosette, raspberry leaf blotch, pigeonpea sterility mosaic (Cajanus cajan) and High Plains disease of maize and wheat were found to be associated with viruses that share several characteristics. They all have single-stranded multipartite RNA genomes of negative orientation. In some cases, double membrane-bound virus-like particles of 80 to 200 nm in diameter were found in infected tissue. Furthermore, at least five of these viruses were shown to be vectored by eriophyid mites. Sequences of European mountain ash ringspot-associated virus (EMARaV), Fig mosaic virus (FMV), rose rosette virus (RRV), raspberry leaf blotch virus (RLBV), pigeonpea sterility mosaic virus and High Plains virus strongly support their potential phylogenetic relationship. Therefore, after characterization of EMARaV, the novel genus Emaravirus was established, and FMV was the second virus species assigned to this genus. The recently sequenced RRV and RLBV are supposed to be additional members of this new group of plant RNA viruses.

Occurrence and Yield Effects of Wheat Infected with Triticum mosaic virus in Kansas.

Triticum mosaic virus (TriMV) infects wheat (Triticum aestivum) in the Great Plains region of the United States. This study determined the occurrence of TriMV at three locations over 3 years and yield effects of wheat mechanically infected with TriMV. Wheat infection with TriMV, Wheat streak mosaic virus (WSMV), and the High Plains virus (HPV) was verified using enzyme-linked immunosorbent assay. Both wheat singly infected with TriMV and doubly infected with TriMV and WSMV occurred at three, two, and one locations in 2007, 2008, and 2009, respectively. Wheat singly infected with HPV occurred at one and two locations in 2008 and 2009, respectively. Wheat doubly infected with WSMV and HPV occurred at one location in 2008 and 2009. Infection with TriMV declined at two locations each year and, at the third location, it increased the second year and was not detected the third year. WSMV infection increased, except for a decline the third year at one location. In contrast to 3.0% infection of wheat with TriMV and WSMV at one location, 85% of the wheat 1.6 km from that site was infected with TriMV and WSMV in 2009. Infection of wheat with TriMV caused significant yield and volume weight reductions in Danby, RonL, and Jagalene but not KS96HW10-3 wheat.

Identification of Variants of the High Plains virus Infecting Wheat in Kansas.

The properties of two virus isolates (U04-82 and U04-83) obtained from two wheat (Triticum aestivum) plants expressing mosaic symptoms were investigated using enzyme-linked immunosorbent assay (ELISA), sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), time-of-flight mass spectrometry (TOFMS), and infection of wheat with resistance to Wheat streak mosaic virus (WSMV). The coat protein mass was estimated by SDS-PAGE as approximately 32 kDa for U04-82 and 30 kDa for U04-83. The amino acid sequence of the coat protein of U04-82 was 99.6 and 85.5% identical to two isolates, ABC58222 and TX96, respectively, of High Plains virus (HPV) described from Texas. U04-82 was transmitted by wheat curl mites and caused significant yield reductions in wheat resistant to WSMV. U04-83 was actually two distinct virus isolates whose capsid protein amino acid sequences were only 57 and 50% similar to that of TX96. Antiserum prepared to a synthetic peptide from the sequence of the U04-83 isolate recognized the two U04-83 isolates, but not the U04-82 isolate.

Occurrence of Viruses in Wheat in the Great Plains Region, 2008

Field surveys in 2008 determined the prevalence and diversity of viruses present in the Great Plains wheat crops. Symptomatic plants (n = 754) in nine states were tested for Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV, formerly known as High Plains virus), Triticum mosaic virus (TriMV), Barley yellow dwarf virus-PAV (BYDV-PAV), and Cereal yellow dwarf virus-RPV (CYDV-RPV), using indirect ELISA. Virus prevalence varied greatly, with average frequency of detection highest for WSMV (47%), followed by WMoV (19%), TriMV (17%), BYDV-PAV (7%), and lowest for CYDV-RPV (2%). Most positive plant samples (37%) had one virus present, with decreasing frequencies for co-infection by two (19%), three (5%), or four viruses (1%). TriMV was detected for the first time in Colorado, Nebraska, Oklahoma, South Dakota, Texas, and Wyoming. WMoV was identified for the first time in Montana and Wyoming. Chlorotic streaks were more frequently associated with WSMV, WMoV, and TriMV (R = 0.166 to 0.342; P < 0.05), and stunting was more frequently associated with WMoV (R = 0.142; P = 0.004) or TriMV (R = 0.107; P = 0.033) than WSMV. Symptom severity did not increase with co-infection as compared to single virus infections, with the exception of plants co-infected with mite transmitted viruses in Texas. Accepted for publication 1 May 2009. Published 6 July 2009.

New Zealand perspective on ISO 17025 accreditation of a plant diagnostic laboratory1

Four plant diagnostic laboratories in New Zealand have obtained ISO 17025 accreditation since 2001: Linnaeus Laboratory; PestLab, AsureQuality Ltd; Horticulture and Food Research Institute of New Zealand Ltd; and the Ministry of Agriculture and Forestry's (MAF) Plant Health and Environment Laboratory (PHEL). The challenge of pursuing ISO 17025 accreditation for PHEL emerged in late 2003 when a review of a MAF diagnostic standard made ISO 17025 accreditation a mandatory requirement for approval. The accreditation project took three years from initiation to accreditation in 2007. The scope of PHEL's accreditation covers tests (e.g. PCR, RT‐PCR, or ELISA) for the Carlavirus group, High plains virus, Iris yellow spot virus, Pepino mosaic virus, Plum pox virus, Raspberry ringspot virus, phytoplasmas, Potato spindle tuber viroid, and Xylella fastidiosa and morphological identifications of fungi and invertebrates. This article provides a brief overview of ISO 17025 accreditation of plant diagnostic laboratories in New Zealand, describes PHEL's scope of accreditation, and discusses some of the issues and challenges PHEL faced during the process of attaining accreditation and still faces post‐accreditation.