High Molecular Weight Genomic DNA Research Articles

Single-Molecule Sequencing of the C9orf72 Repeat Expansion in Patient iPSCs.

A hexanucleotide GGGGCC repeat expansion in the C9orf72 gene is the most frequent genetic cause of amyotrophic lateral sclerosis (ALS) and frontal temporal dementia (FTD). C9orf72 repeat expansions are currently identified with long-range PCR or Southern blot for clinical and research purposes, but these methods lack accuracy and sensitivity. The GC-rich and repetitive content of the region cannot be amplified by PCR, which leads traditional sequencing approaches to fail. We turned instead to PacBio single-molecule sequencing to detect and size the C9orf72 repeat expansion without amplification. We isolated high molecular weight genomic DNA from patient-derived iPSCs of varying repeat lengths and then excised the region containing the C9orf72 repeat expansion from naked DNA with a CRISPR/Cas9 system. We added adapters to the cut ends, capturing the target region for sequencing on PacBio's Sequel, Sequel II, or Sequel IIe. This approach enriches the C9orf72 repeat region without amplification and allows the repeat expansion to be consistently and accurately sized, even for repeats in the thousands. Key features • This protocol is adapted from PacBio's previous "no-amp targeted sequencing utilizing the CRISPR-Cas9 system." • Optimized for sizing C9orf72 repeat expansions in patient-derived iPSCs and applicable to DNA from any cell type, blood, or tissue. • Requires high molecular weight naked DNA. • Compatible with Sequel I and II but not Revio.

Method for isolation of high molecular weight genomic DNA from Botryococcus biomass.

The development of high molecular weight (HMW) genomic DNA (gDNA) extraction protocols for non-model species is essential to fully exploit long-read sequencing technologies in order to generate genome assemblies that can help answer complex questions about these organisms. Obtaining enough high-quality HMW gDNA can be challenging for these species, especially for tissues rich in polysaccharides such as biomass from species within the Botryococcus genus. The existing protocols based on column-based DNA extraction and biochemical lysis kits can be inefficient and may not be useful due to variations in biomass polysaccharide content. We developed an optimized protocol for the efficient extraction of HMW gDNA from Botryococcus biomass for use in long-read sequencing technologies. The protocol utilized an initial wash step with sorbitol to remove polysaccharides and yielded HMW gDNA concentrations up to 220 ng/μL with high purity. We then demonstrated the suitability of the HMW gDNA isolated from this protocol for long-read sequencing on the Oxford Nanopore PromethION platform for three Botryococcus species. Our protocol can be used as a standard for efficient HMW gDNA extraction in microalgae rich in polysaccharides and may be adapted for other challenging species.

P-529 Optical Genomic Mapping (OGM) enable cryptic chromosomal rearrangements in a couple with recurrent miscarriages undergoing preimplantation genetic diagnosis

Abstract Study question Could Optical Genomic Mapping (OGM) detect chromosomal structural variations (SVs) below the detection limit of conventional cytogenetic diagnostics in couples with recurrent miscarriages? Summary answer The Next-generation cytogenetics of Optical Genomic Mapping confirmed a cryptic chromosomal translocation in a couple with recurrent miscarriages undergoing preimplantation genetic testing for aneuploidies (PGT-A). What is known already Chromosomal structural variants (SVs) significantly contribute to infertility, recurrent pregnancy losses and congenital defects... Approximately 2-4% of couples facing recurrent miscarriages carry chromosomal abnormalities. Currently, their detection is based on convencional cytogenetic methods (karyotyping, FISH or array-CGH), however cryptic chromosomal rearrangements are difficult to identify. Next-generation cytogenetics such as OGM is able to detect SVs with a resolution of < 500 kb, allowing a better understanding of the cause of patient’s infertility. In our study, we utilized OGM to confirm a cryptic translocation in a couple experiencing recurrent miscarriages, aiming to enhance our understanding of the underlying causes of their infertility. Study design, size, duration Our study focuses on a non-consanguineous couple diagnosed with recurrent pregnancy loss that attended to our private fertility clinic to undergo assisted reproductive treatment (ART) with their autologous semen, oocytes and PGT-A. Conventional cytogenetic technique was performed on both partners by G-banding karyotyping. PGT-A was performed by NGS (Veriseq, Illumina). Optical Genomic Mapping (OGM) served as a diagnostic tool, complemented by lymphocyte FISH analysis to confirm chromosomal structural variations in these infertile patients. Participants/materials, setting, methods Ultra High Molecular Weight genomic DNA (UHMW gDNA) was extracted from frozen human peripheral blood of both partners. UHMW gDNA was quantified using Qubit dsDNA assay BR kit and Qubit 4 Fluorometer (Thermo Fisher Scientific). We used Saphyr system (Bionano Genomics) for cytogenetic diagnosis. The consensus genomic map was constructed by de novo assembly in the Bionano Solve data analysis software. SVs were identified by aligning Optical Genomic Map with the reference genome GRCh38/hg38. Main results and the role of chance The couple had suffered four prior miscarriages and undergoing three PGT-A cycles. Both partners provided a normal karyotype. Among 13 biopsied embryos, four showed CNVs on chromosomes 2(p24.3è25.3, 12Mb) and 6(p24.1è25.3, 11Mb). Following this result we suspected that the couple might has a cryptic chromosomal structural abnormalities. To test our hypothesis, we performed OGM. We analysed UHMW gDNA samples from both partners. OGM generated an average of 823.67Gb. The average N50 molecule length (≥150kb) was 318kb. The average mapping rate was 90.75% and the average labeling rate was 15.30 labels per 100kb. The average effective coverage depth was 242X. OGM successfully identified a cryptic translocation in the male partner ogm[GRch38]t(2;6)(p24.3;24.1), while the female partner showed no abnormalities. Translocation breakpoints identified by OGM were Chr2:12.560.508 and Chr6:11.622.593. The translocated segments were near to the detection limit of conventional cytogenetic analysis and with similar pattern that could be the reason for missed detection by karyotyping. Importantly, we identified one gene disrupted by OGM rearrangement breakpoint: MIR3681HG. A previous study considered that CNV loci of 2p24.3, including MIR3681HG gene, could be associated with spermatogenesis. The lymphocyte FISH analysis finding corroborated the OGM result. Limitations, reasons for caution OGM is a very powerful method for detecting chromosomal structural variants in human genomes and is able to detect cryptic structural variants. However, this is a very new diagnostic application, so there is limited experience with OGM for correlating structural variations results to infertility diagnosis in couples with recurrent miscarriages. Wider implications of the findings A balanced cryptic translocation has been identified in a couple with recurrent miscarriages. Our case report demonstrates the high diagnostic capability of Optical Genomic Mapping for cryptic SVs. OGM technology allows a more accurate cytogenetic diagnosis by detecting cryptic structural variants with high resolution in infertile patients with recurrent miscarriages. Trial registration number not applicable

De novo assembly of a chromosome-level reference genome for the California Scrub-Jay, Aphelocoma californica.

We announce the assembly of the first de novo reference genome for the California Scrub-Jay (Aphelocoma californica). The genus Aphelocoma comprises four currently recognized species including many locally adapted populations across Mesoamerica and North America. Intensive study of Aphelocoma has revealed novel insights into the evolutionary mechanisms driving diversification in natural systems. Additional insights into the evolutionary history of this group will require continued development of high-quality, publicly available genomic resources. We extracted high molecular weight genomic DNA from a female California Scrub-Jay from northern California and generated PacBio HiFi long-read data and Omni-C chromatin conformation capture data. We used these data to generate a de novo partially phased diploid genome assembly, consisting of two pseudo-haplotypes, and scaffolded them using inferred physical proximity information from the Omni-C data. The more complete pseudo-haplotype assembly (arbitrarily designated "Haplotype 1") is 1.35 Gb in total length, highly contiguous (contig N50 = 11.53 Mb), and highly complete (BUSCO completeness score = 97%), with comparable scaffold sizes to chromosome-level avian reference genomes (scaffold N50 = 66.14 Mb). Our California Scrub-Jay assembly is highly syntenic with the New Caledonian Crow reference genome despite ~10 million years of divergence, highlighting the temporal stability of the avian genome. This high-quality reference genome represents a leap forward in publicly available genomic resources for Aphelocoma, and the family Corvidae more broadly. Future work using Aphelocoma as a model for understanding the evolutionary forces generating and maintaining biodiversity across phylogenetic scales can now benefit from a highly contiguous, in-group reference genome.

Identification of sex-specific markers and ZW-chromosome DNA clones from the genomic BAC library of the Chinese mitten crab Eriocheir sinensis

A ZW-ZZ sex determination system was previously proposed based on sex linkage analysis in the Chinese mitten crab, Eriocheir sinensis. In this study, we successfully identified a sex-specific marker from sex-linked markers in the genetic map and verified in different wild populations of E. sinensis. To further identify ZW chromosome DNA, we constructed a highly redundant genomic bacterial artificial chromosome (BAC) library for the Chinese mitten crab. The library was generated from high-molecular weight genomic DNA isolated from hemocytes and muscle in a female crab, which was comprising of 153,984 clones arrayed in 401,384-well microtiter plates. The average inserts size is 72 kb, representing 8.7-fold haploid genome coverage. By using sex specific markers, PCR-based screening was performed to identify ZW-derived BAC clones. Three W and Z-derived BAC clones were isolated, respectively. One of W-derived (P282E18) BAC clones was sequenced and assembled into a 43 kb contig without any gap. The W-derived BAC inserts can be mapped to an assembled contig of E. sinensis genome with 95% similarity in the aligned region, demonstrating that the BAC library is a valuable resource for discriminating Z and W chromosome contigs in the assembled haploid genome. The sex-specific marker provides a powerful tool not only for distinguishing the gender of larval or early juvenile E. sinensis without sexual dimorphism and sex-reversed individuals in monosex crab breeding, but also for identification of ZW-derived BAC clones used in the assembly of Z and W chromosomes in E. sinensis.

Quantitative PCR–Based Method to Assess Cell-Free DNA Quality, Adjust Input Mass, and Improve Next-Generation Sequencing Assay Performance

Cell-free (cf)DNA-based testing has undergone increasingly wide adoption, including assays for the detection of circulating tumor DNA. Due to nucleosome protection, cfDNA has a distinctive fragment size of 160 to 180 bp. However, cfDNA can be contaminated with high molecular weight genomic DNA from blood cells released in plasma during sample collection. Such contamination can lead to decreased sensitivity or inconsistent results in cfDNA next-generation sequencing assays. This article describes a technical advancement in which a quantitative PCR method is used for high molecular weight contamination assessment and input mass adjustment, and has been demonstrated to improve consistency of performance in a circulating tumor DNA next-generation sequencing workflow.

Automated phenol-chloroform extraction of high molecular weight genomic DNA for use in long-read single-molecule sequencing.

Background: Automation has increasingly become more commonplace in the research laboratory workspace. The introduction of articulated robotic arms allows the researcher more flexibility in the tasks a single piece of automated machinery can perform. We set out to incorporate automation in processing of genomic DNA organic extractions to increase throughput and limit researchers to the exposure of organic solvents. Methods: In order to automate the genome sequencing pipeline in our laboratory, we programmed a dual-arm anthropomorphic robot, the Robotic Biology Institute's Maholo LabDroid, to perform organic solvent-based genomic DNA extraction from cell lysates. To the best of our knowledge, this is the first time that automation of phenol-chloroform extraction has been reported. Results: We achieved routine extraction of high molecular weight genomic DNA (>100 kb) from diverse biological samples including algae cultured in sea water, bacteria, whole insects, and human cell lines. The results of pulse-field electrophoresis size analysis and the N50 sequencing metrics of reads obtained from Nanopore MinION runs verified the presence of intact DNA suitable for direct sequencing. Conclusions: We present the workflow that can be used to program similar robots and discuss the problems and solutions we encountered in developing the workflow. The protocol can be adapted to analogous methods such as RNA extraction, and there is ongoing work to incorporate further post-extraction steps such as library construction. This work shows the potential for automated robotic workflows to free molecular biological researchers from manual interventions in routine experimental work. A time-lapse movie of the entire automated run is included in this report.

Purpose, Partnership, and Possibilities: The Implementation of the Dog Aging Project Biobank.

Biobanks have been supporting longitudinal prospective and retrospective studies by providing standardized services for the acquisition, transport, processing, storage, and distribution of high-quality biological material and associated data. Here, we describe how the Dog Aging Project (DAP), a large-scale longitudinal study of the domestic dog (Canis familiaris) with translational applications for humans, developed a biobank of canine biospecimens and associated data. This was accomplished by working with the Cornell Veterinary Biobank, the first biobank in the world to receive accreditation to ISO 20387:2018-General Requirements for Biobanking. The biobank research team was involved in the early collection stages of the DAP, contributing to the development of appropriate workflows and processing fit-for-purpose biospecimens. In support of a dynamic strategy for real-time adjustment of processes, a pilot phase was implemented to develop, test, and optimize the biospecimen workflows, followed by an early phase of collection, processing, and banking of specimens from DAP participants. During the pilot and early phases of collection, the DAP Biobank stored 164 aliquots of whole blood, 273 aliquots of peripheral blood mononuclear cells, 130 aliquots of plasma, and 70 aliquots of serum, and extracted high molecular weight genomic DNA suitable for whole-genome sequencing from 109 whole blood specimens. These specimens, along with their associated preanalytical data, have been made available for distribution to researchers. We discuss the challenges and opportunities encountered during the implementation of the DAP Biobank, along with novel strategies for promoting biobanking sustainability such as partnering with a DAP quality assurance manager and a DAP marketing and communication specialist and developing a pilot grant structure to fund small innovative research projects.

Platelet Factor 4 (PF4) Modulates the Prothrombotic Nature of Neutrophil-Extracellular Traps (NETs): Therapeutic Implications of a NET-Stabilization Strategy

Sepsis is a dysregulated response to infection leading to life-threating organ damage. Although it remains one of the most common causes of mortality worldwide, it lacks targeted treatments. Neutrophils play a crucial role in sepsis by releasing NETs, webs of DNA complexed with histones and antimicrobial proteins that capture pathogens and prevent bacterial dissemination. However, when NETs are degraded by circulating nucleases they release NET-degradation products (NDPs) including cell-free (cf) DNA, histones and myeloperoxidase, which trigger coagulation, induce complement activation, and cause oxidative tissue damage. We proposed a novel NET-directed therapy in sepsis, in which NETs are stabilized by the platelet chemokine PF4. Binding of PF4 enhances NET DNase-resistance, promotes NDP sequestration and increases bacterial capture, improving survival in murine sepsis.As NETs are considered prothrombotic, we were concerned that NET stabilization may increase the risk of clot formation. We therefore sought to determine the effect of PF4-NET stabilization on the thrombogenicity of NETs to learn if this strategy is safe for clinical application. To that end, we examined the effect of PF4 on the thrombotic potential of DNA and NET fragments at different states of nuclease digestion. High molecular weight (hmw) genomic DNA (hmwDNA, >50kbp) was isolated from human whole blood. hmwDNA was digested with restriction enzymes (EcoRI and AluI) for 15min to generate DNA fragments of ~4kbp and ~250bp, respectively. Neutrophils were also isolated from human blood and stimulated with 100 nM PMA to produce neutrophil-adherent NETs, which were cleaved from cell bodies by treatment with 4U/mL DNase I for 20 minutes, releasing NETs >50kbp (hmwNETs). Additional incubation of hmwNETs with DNase I yielded smaller NET fragments. We assessed in vitro activation of coagulation by DNA and NETs by measuring thrombin generation and fibrin formation in platelet-poor plasma using fluorogenic substrate and turbidity assays.Neutrophil-adherent NETs induced far less thrombin generation and fibrin formation in plasma than hmwDNA and hmwNETs. PF4 significantly increased lag time and reduced peak thrombin formation induced by both hmwDNA and hmwNETs. Binding of PF4 also delayed clot initiation time and reduced the rate of fibrin generation. Digestion of hmwDNA and hmwNETs to smaller fragments markedly enhanced thrombogenicity.We posited that shorter DNA fragments are more thrombogenic because they have a greater proportion of end-fragment DNA that exposes more single-stranded DNA. To test this hypothesis, we subjected hmwDNA and digested DNA to heat denaturation at 95°C and rapid cooling to generate single stranded DNA and found that this accelerated fibrin generation. Although the anti-thrombotic effect of PF4 was most pronounced with longer DNA and NET fragments, it continued to significantly reduce fibrin generation induced by shorter DNA fragments, perhaps by stabilizing the fragments to prevent exposure of single-stranded DNA.In conclusion, although prior studies have shown that NETs increase the risk of thrombosis in sepsis, we propose the counter-intuitive concept that PF4-stabilization decreases the risk of NET-mediated prothrombotic state by (1) inhibiting DNase cleavage of intact NETs and subsequent liberation of prothrombotic cfDNA from non-thrombogenic neutrophil-adherent NETs, and (2) preventing further digestion of circulating cfDNA into shorter and more prothrombotic fragments. Although NETs are a double-edged sword: capable of capturing pathogens but inducing host-tissue damage and thrombosis when degraded, treatment with PF4 tips the balance, limiting the capacity of NETs to induce fibrin generation and thrombosis, while enhancing their ability to fight infection by microbial entrapment. These studies add support to our hypothesis that PF4 stabilization of NETs is protective in sepsis and merits further investigation in translational studies. DisclosuresNo relevant conflicts of interest to declare.

Characterization of integration frequency and insertion sites of adenovirus DNA into mouse liver genomic DNA following intravenous injection.

While generally referred to as "non-integrating" vectors, adenovirus vectors have the potential to integrate into host DNA via random, illegitimate (nonhomologous) recombination. The present study provides a quantitative assessment of the potential integration frequency of adenovirus 5 (Ad5)-based vectors following intravenous injection in mice, a common route of administration in gene therapy applications particularly for transgene expression in liver. We examined the uptake level and persistence in liver of first generation (FG) and helper-dependent (HD) Ad5 vectors containing the mouse leptin transgene. As expected, the persistence of the HD vector was markedly higher than that of the FG vector. For both vectors, the majority of the vector DNA remained extrachromosomal and predominantly in the form of episomal monomers. However, using a quantitative gel-purification-based integration assay, a portion of the detectable vector was found to be associated with high molecular weight (HMW) genomic DNA, indicating potential integration with a frequency of up to ~44 and 7000 integration events per μg cellular genomic DNA (or ~0.0003 and 0.05 integrations per cell, respectively) for the FG and HD Ad5 vectors, respectively, following intravenous injection of 1 × 1011 virus particles. To confirm integration occurred (versus residual episomal vector DNA co-purifying with genomic DNA), we characterized nine independent integration events using Repeat-Anchored Integration Capture (RAIC) PCR. Sequencing of the insertion sites suggests that both of the vectors integrate randomly, but within short segments of homology between the vector breakpoint and the insertion site. Eight of the nine integrations were in intergenic DNA and one was within an intron. These findings represent the first quantitative assessment and characterization of Ad5 vector integration following intravenous administration in vivo in wild-type mice.

Abstract 575: Enhancing cell-free DNA mutation detection with novel liquid-phase extraction

Abstract Background: Low yields of extracted cell-free DNA (cfDNA) from plasma limit further development of liquid biopsies for early-stage cancer diagnostics and cancer screening applications. Conventional nucleic acid extraction methods have limitations in capturing low levels of cfDNA and risk capturing high levels of high molecular weight contaminating genomic DNA. We developed a liquid-phase based DNA extraction method (PHASIFY™ ENRICH; Phase Scientific International Ltd., Kwun Tong, Hong Kong) that leverages aqueous two-phase systems (ATPS) to purify, concentrate, and enrich for cfDNA to improve mutant signal detection. Methods: The PHASIFY ATPS consists of unique formulations that are optimized to drive cfDNA into one liquid phase and plasma contaminants into the other, achieving simultaneous target isolation and concentration. In a previous study using the PHASIFY technique, we demonstrated improved cfDNA and mutant copy yield over solid-phase methods. We further developed an additional size-selection feature (PHASIFY ENRICH) to remove high molecular weight genomic DNA (>500 bp) and to reduce signal noise for molecular diagnostics. We compared cfDNA recovery and mutation detection from plasma samples extracted with the industry standard QIAamp Circulating Nucleic Acid kit (QCNA; Qiagen, Hilden, Germany) and PHASIFY ENRICH cfDNA extraction kit. According to the respective kit protocols, the cfDNA was extracted from plasma from patients with advanced cancers, including those known to shed low amounts of cfDNA into circulation (e.g., low grade serious ovarian, appendiceal, thyroid, and pancreatic cancer), with known tissue mutation status. Total DNA recovery was determined with the Quant-iT PicoGreen dsDNA Assay Kit. Mutation status was determined with probe-based Droplet Digital PCR (ddPCR; Bio-Rad, Hercules, CA). In a follow up study, we tested a similar cohort of plasma samples that were previously tested negative for cfDNA mutation status when using QCNA cfDNA extraction, despite known positive mutation status from corresponding tumor tissue genotyping. Results: In the head-to-head study against QCNA, 57 plasma samples from 23 unique patients with diverse advanced cancers with known tissue mutation status were used for cfDNA extraction. The PHASIFY ENRICH method resulted in a 153% increase in median mutant copy recovery compared to QCNA (P = 0.01 Wilcoxon Signed-Rank). In the follow up study, 47 plasma samples from 31 patients with diverse advanced cancers and prior cfDNA negative mutation status with tissue positive mutation status were used for extraction. Of the 47samples extracted by PHASIFY ENRICH, 9 samples resulted in a conversion to positive cfDNA mutation status compared to no mutant signals when previously using QCNA. Conclusion: Our results indicate that PHASIFY ENRICH provides improved cfDNA mutation detection by increasing cfDNA recovery and reducing contaminating genomic DNA background. Citation Format: Filip Janku, Helen Huang, David Y. Pereira, Masae Kobayashi, Steven G. Call, Kristen T. Woodbury, Felix Chao, Daniel R. Marshak, Ricky Y. Chiu. Enhancing cell-free DNA mutation detection with novel liquid-phase extraction [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 575.

Abstract PO013: SNP rs1982 in the 3’UTR of placenta-specific protein 1 (PLAC1) is associated with endometrial cancer survival

Abstract Placenta-specific protein 1 (PLAC1) is a small (212aa) secreted protein normally only expressed on the apical surfaces of syncytiotrophoblasts. However, over the past two decades we and other investigators have shown that human cancers and, in particular, cancers of the human reproductive tract, induce PLAC1 expression. In gynecologic cancers, PLAC1 expression has been shown to be associated with risk, histology and TP53 mutation status. A previously unassessed informative SNP rs1982 (A>C) lies in the 3’ untranslated region of the PLAC1 gene. We have begun to explore the utility of this SNP by genotyping a panel of 75 endometrial cancers. The panel is composed of 29 endometrial adenocarcinomas, 10 papillary serous adenocarcinomas, 9 mixed Mullerian tumors, 6 mixed histologies, 2 tumors identified as displaying complex atypia and 1 neuroendocrine tumor. High molecular weight genomic DNA was extracted from these tumors and SNP genotypes determined by directly sequencing a 312bp PCR amplicon generated by the primers: rs1982for: GAGGATTGGTCTCTTCACACAG; rs1982rev: ACAATGTCTGGCCCATACTAAA SNP genotypes were then evaluated against a variety of clinical variables including age, BMI, tobacco use, Charlson Index, co-morbidities, stage, grade, myometrial invasion, recurrence, and death by cancer using both univariate and multivariate logistic regression. Progression-free and overall survival were assessed by Cox Proportional Hazard ratio. Results show that CC homozygotes have increased progression-free and overall survival though neither reached statistical significance. However, several clinical variables were statistically associated with different rs1982 genotypes. Charlson co-morbidity Index was positively associated with presence of the wild-type A allele (OR = 1.61; 1.06 - 2.69; p<0.05), while death from disease was negatively associated (OR = 0.15; 0.03 – 0.64; p<0.02). These differences hold when accounting for other co-variates in the multivariate analysis. These data support further exploration of this SNP in gynecologic cancers. Citation Format: Eric J. Devor, Jesus Gonzalez-Bosquet, Kimberly K. Leslie. SNP rs1982 in the 3’UTR of placenta-specific protein 1 (PLAC1) is associated with endometrial cancer survival [abstract]. In: Proceedings of the AACR Virtual Special Conference: Endometrial Cancer: New Biology Driving Research and Treatment; 2020 Nov 9-10. Philadelphia (PA): AACR; Clin Cancer Res 2021;27(3_Suppl):Abstract nr PO013.

Sequencing and Reconstructing Helminth Mitochondrial Genomes Directly from Genomic Next-Generation Sequencing Data.

We present a detailed method for extraction of high-molecular weight genomic DNA suitable for numerous DNA sequencing applications, and a straightforward in silico approach for reconstructing novel mitochondrial (mt) genomes directly from total genomic DNA extracts derived from next-generation sequencing (NGS) data sets. The in silico post-sequencing pipeline described is fast, accurate, and highly efficient, with modest memory requirements that can be performed using a standard desktop computer. The approach is particularly effective for obtaining mitochondrial genomes for species with little or no mitochondrial sequence information currently available and overcomes many of the limitations of traditional strategies. The described methodologies are also applicable for metagenomics sequencing from mixed or pooled samples containing multiple species and subsequent specific assembly of specific mitochondrial genomes.

Isolation and Purification of DNA from Complicated Biological Samples.

The isolation of nucleic acids from a biological sample is an important step for many molecular biology applications and medical diagnostic assays. This chapter describes an efficient protocol using established acidic CTAB (with a pH value of 5.0 to 6.8) based extraction method for isolation and/or purification of high molecular weight genomic DNA from a range of fresh and difficult sources from plant, animal, fungi, and soil material. This protocol is suitable for many sequencing and genotyping applications, including large-scale sample screening.

Optimization of high molecular weight DNA extraction methods in shrimp for a long-read sequencing platform.

Marine organisms are important to global food security as they are the largest source of animal proteins feeding mankind. Genomics-assisted aquaculture can increase yield while preserving the environment to ensure sufficient and sustainable production for global food security. However, only few high-quality genome sequences of marine organisms, especially shellfish, are available to the public partly because of the difficulty in the sequence assembly due to the complex nature of their genomes. A key step for a successful genome sequencing is the preparation of high-quality high molecular weight (HMW) genomic DNA. This study evaluated the effectiveness of five DNA extraction protocols (CTAB, Genomic-tip, Mollusc DNA, TIANamp Marine Animals DNA, and Sbeadex livestock kits) in obtaining shrimp HMW DNA for a long-read sequencing platform. DNA samples were assessed for quality and quantity using a Qubit fluorometer, NanoDrop spectrophotometer and pulsed-field gel electrophoresis. Among the five extraction methods examined without further optimization, the Genomic-tip kit yielded genomic DNA with the highest quality. However, further modifications of these established protocols might yield even better DNA quality and quantity. To further investigate whether the obtained genomic DNA could be used in a long-read sequencing application, DNA samples from the top three extraction methods (CTAB method, Genomic-tip and Mollusc DNA kits) were used for Pacific Biosciences (PacBio) library construction and sequencing. Genomic DNA obtained from Genomic-tip and Mollusc DNA kits allowed successful library construction, while the DNA obtained from the CTAB method did not. Genomic DNA isolated using the Genomic-tip kit yielded a higher number of long reads (N50 of 14.57 Kb) than those obtained from Mollusc DNA kits (N50 of 9.74 Kb). Thus, this study identified an effective extraction method for high-quality HMW genomic DNA of shrimp that can be applied to other marine organisms for a long-read sequencing platform.

PacBio Long-Read Sequencing, Assembly, and Funannotate Reannotation of the Complete Genome of Trichoderma reesei QM6a.

Single-molecule real-time (SMRT) sequencing developed by Pacific BioSciences (PacBio) offers three major advantages compared to second-generation sequencing: long read length and high consensus accuracy, and a low degree of bias. Together with high sequencing coverage, these advantages overcome the difficulty of sequencing genomic regions such as long AT-rich islands and repeated regions (e.g., ribosomal DNA) in the genome of Trichoderma reesei QM6a. Herein, we describe a protocol for preparing high-quality, high molecular weight genomic DNA for PacBio long-read sequencing, de novo assembly and streamlined annotation of the QM6a genome.

A simple method for high molecular-weight genomic DNA extraction suitable for long-read sequencing from spores of an obligate biotroph oomycete

Long-read sequencing technologies are having a major impact on our approaches to studying non-model organisms and microbial communities. By significantly reducing the cost and facilitating the genome assembly pipelines, any laboratory can now develop its own genomics program regardless of the complexity of the genome studied. The most crucial current challenge is to develop efficient protocols for extracting genomic DNA (gDNA) with high quality and integrity adapted to the organism of interest. This can be particularly complex for obligate pathogens that must maintain intimate interactions inside infected host tissues. Here we propose a simple and cost-effective method for high molecular weight gDNA extraction from spores of Plasmopara halstedii, an obligate biotroph oomycete pathogen responsible for downy mildew in sunflower. We optimized the yield, the quality and the integrity of the extracted gDNA by fine-tuning three critical parameters, the grinding, the lysis temperature and the lysis duration. We obtained gDNA with a fragment size distribution reaching a peak ranging from 79 to 145 kb. More than half of the extracted gDNA consisted of DNA fragments larger than 42 kb, with 23% of fragments larger than 100 kb. We then demonstrated the relevance of this protocol for long-read sequencing using PacBio RSII technology. With this protocol, we were able to obtain a mean read length of 9.3 kb, a max read length of 71 kb and an N50 of 13.3 kb. The development of such DNA extraction protocols is an essential prerequisite for fully exploiting technologies requiring high molecular weight gDNA (e.g. long-read sequencing or optical mapping). These technological advances will help generate data to answer questions such as the role of newly duplicated gene clusters, repeated regions, genomic structural variations or to define number of chromosomes that still remains undefined in many species of pathogenic fungi and oomycetes.

First record of a tandem-repeat region within the mitochondrial genome of Clonorchis sinensis using a long-read sequencing approach.

BackgroundMitochondrial genomes provide useful genetic markers for systematic and population genetic studies of parasitic helminths. Although many such genome sequences have been published and deposited in public databases, there is evidence that some of them are incomplete relating to an inability of conventional techniques to reliably sequence non-coding (repetitive) regions. In the present study, we characterise the complete mitochondrial genome—including the long, non-coding region—of the carcinogenic Chinese liver fluke, Clonorchis sinensis, using long-read sequencing.MethodsThe mitochondrial genome was sequenced from total high molecular-weight genomic DNA isolated from a pool of 100 adult worms of C. sinensis using the MinION sequencing platform (Oxford Nanopore Technologies), and assembled and annotated using an informatic approach.ResultsFrom > 93,500 long-reads, we assembled a 18,304 bp-mitochondrial genome for C. sinensis. Within this genome we identified a novel non-coding region of 4,549 bp containing six tandem-repetitive units of 719–809 bp each. Given that genomic DNA from pooled worms was used for sequencing, some variability in length/sequence in this tandem-repetitive region was detectable, reflecting population variation.ConclusionsFor C. sinensis, we report the complete mitochondrial genome, which includes a long (> 4.5 kb) tandem-repetitive region. The discovery of this non-coding region using a nanopore-sequencing/informatic approach now paves the way to investigating the nature and extent of length/sequence variation in this region within and among individual worms, both within and among C. sinensis populations, and to exploring whether this region has a functional role in the regulation of replication and transcription, akin to the mitochondrial control region in mammals. Although applied to C. sinensis, the technological approach established here should be broadly applicable to characterise complex tandem-repetitive or homo-polymeric regions in the mitochondrial genomes of a wide range of taxa.

SILEX: a fast and inexpensive high-quality DNA extraction method suitable for multiple sequencing platforms and recalcitrant plant species

BackgroundThe use of sequencing and genotyping platforms has undergone dramatic improvements, enabling the generation of a wealth of genomic information. Despite this progress, the availability of high-quality genomic DNA (gDNA) in sufficient concentrations is often a main limitation, especially for third-generation sequencing platforms. A variety of DNA extraction methods and commercial kits are available. However, many of these are costly and frequently give either low yield or low-quality DNA, inappropriate for next generation sequencing (NGS) platforms. Here, we describe a fast and inexpensive DNA extraction method (SILEX) applicable to a wide range of plant species and tissues.ResultsSILEX is a high-throughput DNA extraction protocol, based on the standard CTAB method with a DNA silica matrix recovery, which allows obtaining NGS-quality high molecular weight genomic plant DNA free of inhibitory compounds. SILEX was compared with a standard CTAB extraction protocol and a common commercial extraction kit in a variety of species, including recalcitrant ones, from different families. In comparison with the other methods, SILEX yielded DNA in higher concentrations and of higher quality. Manual extraction of 48 samples can be done in 96 min by one person at a cost of 0.12 €/sample of reagents and consumables. Hundreds of tomato gDNA samples obtained with either SILEX or the commercial kit were successfully genotyped with Single Primer Enrichment Technology (SPET) with the Illumina HiSeq 2500 platform. Furthermore, DNA extracted from Solanum elaeagnifolium using this protocol was assessed by Pulsed-field gel electrophoresis (PFGE), obtaining a suitable size ranges for most sequencing platforms that required high-molecular-weight DNA such as Nanopore or PacBio.ConclusionsA high-throughput, fast and inexpensive DNA extraction protocol was developed and validated for a wide variety of plants and tissues. SILEX offers an easy, scalable, efficient and inexpensive way to extract DNA for various next-generation sequencing applications including SPET and Nanopore among others.

UltraPrep is a scalable, cost-effective, bead-based method for purifying cell-free DNA.

UltraPrep is an open-source, two-step method for purification of cell-free DNA that entails extraction of total DNA followed by size-selective enrichment of the smaller fragments that are characteristic of DNA originating from fragmentation between nucleosome. The advantages of the two related protocols that are described are that they can easily accommodate a wide range of sample input volumes, they rely on simple, magnetic bead-based technology, the yields of cfDNA are directly comparable to the most popular methods for cfDNA purification, and they dramatically reduce the cost of cfDNA isolation relative to currently available commercial methods. We provide a framework for physical and molecular quality analysis of purified cfDNA and demonstrate that the cfDNA generated by UltraPrep meets or exceeds the quality metrics of the most commonly used procedure. In addition, our method removes high molecular weight genomic DNA (hmwgDNA) that can interfere with downstream assay results, thereby addressing one of the primary concerns for preanalytical collection of blood samples.