Hereditary Renal Cell Research Articles

Abstract 2970: Oncometabolites confer vulnerabilities in NAD biosynthesis via NAPRT gene silencing

Abstract Cancer associated mutations in citric acid cycle enzymes cause overproduction of 2-hydroxyglutarate (2HG), fumarate, or succinate, commonly referred to as oncometabolites. These oncometabolite producing mutations are prevalent in 70% of gliomas, >76% of hereditary leiomyomatosis and renal cell carcinoma, and >25% of paraganglioma and pheochromocytomas, respectively. These oncometabolite producing cancers harbor vulnerabilities in multiple cellular pathways because oncometabolites competitively inhibit alpha ketoglutarate dependent dioxygenases. This group of enzymes includes the ten eleven translocation (TET) family of enzymes, which catalyze locus specific DNA demethylation. Thus, oncometabolite producing cancers have been shown to exhibit global DNA hypermethylation, which drastically alters gene expression in the cell and is thought to occur via TET inhibition. Cells with isocitrate dehydrogenase 1 (IDH1) mutations, which produce 2HG, have loss of expression of a critical NAD biosynthesis enzyme, nicotinate phosphoribosyltransferase (NAPRT). We show that in addition to IDH1 mutant cells, fumarate hydratase (FH)-deficient isogenic cell lines, which overproduce fumarate, show loss of NAPRT expression, which can be targeted by nicotinamide phosphoribosyltransferase (NAMPT) inhibitors. The goal of our work is to determine if this NAPRT silencing is present in many oncometabolite producing cancers, elucidate the mechanism of silencing, and test therapies to target this vulnerability in NAD biosynthesis. FH-deficient cancer cell lines show reduction of NAPRT mRNA levels by qRT-PCR and absence of protein by western blot, suggesting a reduction in NAPRT transcription. In addition, FH-deficient cell lines exhibit synthetic lethality in short term cell viability assays when treated with NAMPT inhibitor, FK866, which inhibits a parallel NAD biosynthesis pathway. Cell viability is not rescued by nicotinic acid supplementation in FH-deficient lines while parental lines are rescuable, validating the loss of functional NAPRT in only FH-deficient lines. Furthermore, patient samples of FH-deficient renal cell carcinomas show higher NAPRT promoter methylation compared to healthy tissue via methylation array. Ongoing studies are investigating the role of TET1/2/3 enzymes in NAPRT promoter methylation. Together, these results suggest that hypermethylation of the NAPRT promoter is associated with silencing of NAPRT expression in FH-deficient cancers, which can be therapeutically targeted through NAMPT inhibition. Citation Format: Katelyn Noronha, Jiayu Liang, Ranjit Bindra. Oncometabolites confer vulnerabilities in NAD biosynthesis via NAPRT gene silencing [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 2970.

Abstract 3112: Metabolic hallmarks of rare renal cell carcinoma patient-derived xenograft models

Abstract Renal medullary carcinoma (RMC) and fumarate hydratase (FH)-deficient renal cell carcinoma (RCC) are rare but highly aggressive malignancies that are often refractory to the therapies used for the more common RCCs. FH-deficient RCC most often occurs in individuals with hereditary leiomyomatosis and renal cell carcinoma syndrome (HLRCC) and is characterized by loss of FH activity, a key metabolic enzyme. Bevacizumab plus erlotinib (B+E) is a preferred first-line therapy for FH-deficient RCC. RMC is characterized by loss of SMARCB1, which is involved in ATP-dependent chromatin remodeling. Platinum-based chemotherapy consisting of either cisplatin or carboplatin plus paclitaxel is the preferred first-line therapy for RMC. We developed patient-derived xenograft (PDX) models of tumors exposed to the commonly used first-line therapies to allow functional characterization of the metabolic hallmarks of treatment-experienced RMC and FH-deficient RCC. Methods: Resected tumor tissue was immediately implanted into NSG male and female mice. After tumor engraftment, animals were euthanized, and the tumor tissue implanted into another set of NSG mice. PDX tissues were confirmed to be genetically identical to the original patient tissue by short tandem repeat analysis. Histology was confirmed to be identical between original patient tumor and PDX by a trained clinical pathologist. Four tumors from each PDX model and four normal human kidney tissue samples were analyzed using reverse phase protein array (RPPA). Expression of proteins shown to be highly expressed by RPPA were further validated by Western blots. Results: We successfully generated one PDX model for RMC and one for FH-deficient RCC, respectively. The RMC model was generated from a 28-year old male with sickle cell trait, who had previously received cisplatin plus paclitaxel followed carboplatin plus paclitaxel. His lesion was characterized as ypT3apN1pMx and histology was consistent with RMC. The FH-deficient RCC model was generated from a 24-year-old female with HLRCC, who had been previously treated with B+E. Her lesion was characterized as pT3apN1pM1 and histology consistent with FH-deficient RCC. Germline testing revealed a R233H pathogenic mutation in the FH gene. RPPA revealed higher expression of hexokinase II (10x HLRCC, 16x RMC), lactate dehydrogenase A (27x HLRCC, 17x RMC), and glutaminase (4x HLRCC) in PDX tissue compared to normal kidney tissue. Western blots confirmed higher expression of glutaminase 1 in both HLRCC and RMC compared to normal kidney. Furthermore, we observed substantially higher hypoxia inducible factor 2α (HIF2α) protein expression in PDX tissue from FH-deficient RCC compared to RMC PDX tumors and normal kidney. Conclusions: Our study revealed distinct metabolic features in PDX models of FH-deficient RCC following treatment with B+E, and of platinum-experienced RMC, these differences may confer targetable vulnerabilities. Citation Format: Manuel Ozambela, Alberto Pieretti, Graciela M. Nogueras Gonzalez, Tapati Maity, Lei Wang, Carolyn De La Cerda, Breanna Alonzo, Luis Segarra, Angelita Alaniz, Priya Rao, Nizar Tannir, Jose A. Karam, Christopher G. Wood, Pavlos Msaouel, Niki M. Zacharias. Metabolic hallmarks of rare renal cell carcinoma patient-derived xenograft models [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 3112.

A phase 2 study of bevacizumab, erlotinib, and atezolizumab in subjects with advanced hereditary leiomyomatosis and renal cell cancer (HLRCC) associated or sporadic papillary renal cell cancer (pRCC).

TPS4604 Background: Papillary RCC accounts for 10-15% of kidney cancers and is the second most common subtype of RCC after clear cell RCC. HLRCC is a familial cancer syndrome characterized by a propensity for developing papillary kidney cancer. HLRCC-associated renal tumors are known to be clinically aggressive, with a paucity of treatment options. The combination of bevacizumab and erlotinib has shown promising activity in patients with HLRCC-associated RCC and sporadic pRCC (Srinivasan et al, ASCO 2020). We hypothesize that the addition of a PDL-1 inhibitor might provide synergistic clinical activity against these tumors. Methods: This is an ETCTN-sponsored, open-label, multicenter, phase 2 study evaluating bevacizumab, erlotinib and atezolizumab in adult and pediatric patients with advanced 1) HLRCC-associated RCC or 2) sporadic pRCC. Eligible patients will have cytologically or histologically confirmed advanced HLRCC- associated or sporadic pRCC, age ≥12 years, ECOG PS ≤2, no more than two prior regimens targeting the VEGF pathway, no prior treatment with PD-1 or PD-L1 inhibitors and adequate organ and marrow function. Patients with HLRCC-associated RCC or sporadic pRCC will be enrolled into parallel, independent cohorts. Initially, 12 adult patients with advanced HLRCC-associated RCC or sporadic pRCC will be enrolled into the safety run-in portion of the trial. If ≤ 3 dose-limiting toxicities are observed, enrollment will proceed into both cohorts and pediatric patients will be allowed to enroll. A Simon two-stage phase 2 minimax design will be used to determine accrual to each cohort. In the first stage, 12 evaluable patients will be enrolled into cohort 1) HLRCC-associated RCC or cohort 2) sporadic pRCC. If 0 of 12 patients have a CR, then no further patients will be enrolled in that cohort. If 1 or more of the first 12 evaluable patients enrolled have a clinical response, then accrual will continue until a total of 21 evaluable patients (adult or pediatric) have been enrolled into each cohort for a total of 42 patients. Adult patients will receive a fixed dose of bevacizumab (15 mg/kg IV every 21 days) plus atezolizumab (1,200 mg IV every 21 days) and erlotinib (150 mg PO daily). Pediatric patients will receive bevacizumab (15 mg/kg IV every 21 days) plus atezolizumab 15 mg/kg (max 1,200 mg IV every 21 days) and erlotinib 85 mg/m2 (max 150 mg PO daily). The primary endpoint is to assess the complete response rate according to RECIST 1.1 in patients with advanced 1) HLRCC-associated RCC and 2) sporadic pRCC. Secondary endpoints include safety and tolerability, objective response rate, disease control rate, progression-free survival and overall survival. Key exploratory endpoints include evaluation of immunologic modulation associated with this regimen. The study has just opened to accrual. Clinical trial information: NCT04981509.

Molecular and immune landscape of FH-mutated cancers.

3125 Background: Fumarate Hydratase (FH) encodes an essential enzyme in the TCA cycle. Inactivating germline mutations in FH lead to hereditary leiomyomatosis and renal cell cancer syndrome with risk of development of certain cancers. Sporadic FH mutations have been described in different cancers but implications of somatic mutations on cancer outcomes and survival are not well described. Here, we characterize the molecular landscape of FH-mutant cancers. Methods: Tumors analyzed using NGS (NextSeq, 592 genes; NovaSeq, WES), IHC, and WTS (NovaSeq) (Caris Life Sciences, Phoenix, AZ). PD-L1 tested by 22c3, 28-8 (Agilent) and SP-142 (Spring Biosciences) IHC (>1%). MSI tested by FA, IHC, and NGS. TMB measured by totaling somatic mutations per tumor (TMB-h > 10 mutations/MB). Real-world overall survival was extracted from insurance claims data and calculated from first treatment to last contact using K-M survival curves for molecularly defined cohorts. Statistical significance was determined using chi-square and Wilcoxon rank-sum test, adjusted for multiple comparisons (q<0.05). Results: 3239 FH mutations were seen in 45 tumor types in 3149 FH-mutated tumors. NSCLC, colorectal and endometrial cancers harbored the most mutations. There were 839 pathogenic (P) or likely pathogenic (LP) and 2400 variants of unknown significance (VUS). Some tumors had multiple mutations. The most common mutations: R233H (P; 37), K477dup (LP; 555), and A41V (VUS; 70). VUS had increased TMB-H (40.4% vs 29.8%, q=0.004) and CREBBP mutations (5.1% vs 1.6%, q=0.012) compared to P+LP. A41V-mt tumors had significantly lower TMB-H than other VUS (8.8% vs 41.5%, q=0.002) and lower MSI-H (3.13% vs 3.69% vs 29.4%, q=0.003) and DICER1, PRKDC, FBXW7 mutations (q<0.05) compared to K477dup and R233. The A41V-mt patients had worse survival compared to patients with P+LP (HR: 1.4, 95% CI: 1.0-2.0, p = 0.049) and a trend toward worse survival compared to K477dup and R233H. In patients treated with chemotherapy, A41 was associated with worse survival compared to P+LP (HR: 4.6, 95% CI: 2.0-10.3, p<0.0001) and compared to K477dup and R233 (p<0.01). There was a trend towards worse survival after IO of A41-mt compared to P+LP (HR: 1.99, 95% CI: 0.88-4.5, p = 0.093). Conclusions: FH alterations are found in multiple cancers. A41V was the most common VUS mutation and is associated with a distinct molecular profile compared to K477dup-mt and R233-mt tumors; it was associated with worse survival in all-comers and after chemotherapy compared to P+LP mutations. This highlights the significance of this mutation and the need for further investigation into how this specific and other FH mutations contribute to cancer progression and treatment outcomes.

Molecular and immune landscape of FH-mutated kidney cancer.

382 Background: Hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome is caused by inactivating germline mutations in fumarate hydratase ( FH), predisposing individuals to development of certain cancers. Sporadic FH mutations have been described in different types of cancers, including kidney cancers, but the implications of somatic mutations are not well described. Here, we characterize the molecular landscape of kidney tumors with FH mutations. Methods: Tumors were analyzed using next generation sequencing of DNA (NextSeq, 592 genes and NovaSeq, WES) and RNA (NovaSeq). Immune cell fraction was estimated by immune deconvolution (Quantiseq). Significance was determined by chi-square and Wilcoxon rank sum test and adjusted for multiple comparisons (q-value <0.05). Results: Of 1956 kidney tumors, 31 had somatic pathogenic or likely pathogenic (P+LP; 1.58%) and 21 had variant of unknown significance (VUS; 1.07%) mutations in FH. Among the most commonly co-mutated genes, VHL (29.03% vs 38.1% vs 55.2%) and PBRM1 (9.68% vs 20% vs 29.8%) were less frequently mutated in P+LP compared to VUS and WT tumors; while NF2 (22.6% vs 5% vs 5.65%) was more frequently mutated in P+LP tumors compared to the others. In P+LP tumors, the HIPPO pathway (22.6% vs 4.76% vs 5.62%) was more frequently altered while the chromatin remodeling pathway (25.8% vs 28.6% vs 51.1%) was less frequently altered compared to VUS or WT tumors. P+LP tumors showed decreased NK cell infiltration (q=0.01) compared to VUS and WT tumors. Additionally, there was a trend towards increased CD8+ T cells and CTLA4 and PDCD1 expression in P+LP tumors compared to VUS but not WT tumors. Of the 1,956 kidney tumors, 315 were of clear cell renal cell carcinoma (ccRCC) histology. P+LP (n=4) ccRCC tumors showed a trend towards higher expression of immune checkpoint genes CTLA4 and IDO1 compared to VUS tumors (n=5). VHL expression was higher in P+LP ccRCC compared to VUS ccRCC tumors. P+LP ccRCC tumors showed a trend toward increased CD4+ (2.59% vs 0%) and CD8+ (2.14% vs 0%) T cells as well as T cell inflammation (25% vs 0%) and median Interferon score compared to VUS ccRCC tumors. Conclusions: P+LP FH mutated kidney tumors may have a different mutational and immune landscape than VUS FH mutated and WT tumors. Despite the small sample size, our study highlights potential therapeutic implications that will require further study.[Table: see text]

Abstract P055: Targeting Krebs-cycle-deficient renal cell carcinoma with PARP inhibitor and low-dose alkylating chemotherapy

Abstract Loss-of-function mutations in genes encoding the Krebs cycle enzymes fumarate hydratase (FH) and succinate dehydrogenase (SDH) lead to excess accumulation of fumarate and succinate, respectively. Germline mutations in FH lead to a genetic predisposition to hereditary leiomyomatosis and renal cell cancer (HLRCC)-associated RCC. Similarly, loss-of-function alterations of SDH, most commonly SDHB, are associated with SDH-deficient neoplasms, including RCC. FH and SDHB deficient RCC tends to be aggressive and metastasize early with very limited treatment options. The oncometablites produced by these mutations, fumarate and succinate, competitively inhibit αKG-dependent dioxygenases, resulting in dysregulated DNA methylation and histone modification. We have previously demonstrated that elevated levels of fumarate and succinate both suppress the homologous recombination (HR) DNA-repair pathway through inhibition of the lysine demethylase KDM4B, resulting in aberrant hypermethylation of histone 3 lysine 9 (H3K9) at loci surrounding DNA breaks and masking a local H3K9 trimethylation signal that is essential for the proper execution of HR. In this study, we sought to identify novel treatment approaches that exploit genomic instability in FH- and SDHB-deficient RCC. Temozolomide (TMZ), an alkylating agent, mediates its cytotoxic effect by attaching methyl groups to DNA (O6-guanine, N7-guanine and N3-adenine). 16 N3-MetA and N7-MetG repair are mediated by the base excision repair (BER) in a process involving PARP. While the combination of PARP inhibitors with TMZ has been shown to increase TMZ-induced cytotoxicity, clinical trials investigating combination therapy have been hampered by significant toxicity. Using CRISPR/Cas9, we developed new syngeneic FH- and SDHB-deficient murine models of RCC. We demonstrate that FH- and SDHB-deficient cells have accumulation of fumarate and succinate leading to an increase in unresolved DNA double-strand breaks (DSBs). Treatment with PARP inhibition and temozolomide results in marked in vitro cytotoxicity in FH- and SDHB-deficient cells, even at low concentrations of TMZ (50 µM). In vivo, the combination of standard dose BGB-290 and low-dose TMZ (3mg/kg/dose) results in significantly delayed tumor progression in an SDHB deficient RENCA model without any significant increase in toxicity. Notably, the TMZ dose of 3mg/kg/dose is significantly lower than the 50mg/kg/dose that is commonly used for in vivo studies. Taken together, these findings provide the basis for a novel therapeutic strategy exploiting HR deficiency in FH and SDHB-deficient RCC with combined PARP inhibition and low-dose alkylating chemotherapy. Furthermore, the development of a new syngeneic mouse model provides a tool for the future study of immunotherapy in Krebs-cycle-deficient RCC. Citation Format: Daiki Ueno, Amrita Sule, Jiayu Liang, Jinny van Doorn, Ranjini Sundaram, Randy Caliliw, Huihui Ye, Rong Rong Huang, Jing Li, Karla Boyd, Ranjit S. Bindra, Juan C. Vasquez, Brian M. Shuch. Targeting Krebs-cycle-deficient renal cell carcinoma with PARP inhibitor and low-dose alkylating chemotherapy [abstract]. In: Proceedings of the AACR-NCI-EORTC Virtual International Conference on Molecular Targets and Cancer Therapeutics; 2021 Oct 7-10. Philadelphia (PA): AACR; Mol Cancer Ther 2021;20(12 Suppl):Abstract nr P055.

Clear cell and papillary renal cell carcinomas in hereditary papillary renal cell carcinoma (HPRCC) syndrome: a case report

BackgroundHereditary papillary renal cell carcinoma (HPRCC) is a rare autosomal dominant disease characterized by the development of multiple and bilateral papillary type I renal cell carcinomas (RCC) and papillary adenomas caused by activating mutations in the MET proto-oncogene. Classically, distinctive histological features of RCC are described according to the familial renal cell carcinoma syndrome. To date, no clear cell RCC has been reported in HPRCC syndrome.Case presentationWe describe the case of a 51-year-old man with a germline MET mutation detected on peripheral blood testing, and no germline VHL mutation, who developed numerous papillary tumors but also unexpectedly clear cell renal cell carcinomas. During the follow-up, an adrenal metastasis was observed 7 years after the initial diagnosis corresponding to a clear cell RCC metastasis. By immunohistochemistry, clear cell tumors showed focal cytokeratin 7, moderate racemase, and diffuse and membranous CAIX expression, while papillary tumors expressed strong diffuse cytokeratin 7 and racemase without CAIX positivity. Using FISH, VHL deletion was observed in one of the clear cell tumors, and the metastatic clear cell tumor presented a trisomy of chromosomes 7 and 17. These last genomic alterations are usually detected in papillary RCC, highlighting the potential link between both histological subtypes of tumors and the HPRCC syndrome.ConclusionsThe pathologist must be aware that the presence of a non-papillary RCC associated with numerous papillary tumors should not exclude the diagnostic suspicion of HPRCC and thus to perform a thorough genomic study.

Uterine leiomyomatosis in adolescents and young adults (AYAs) may represent a narrow phenotypic variant of FH tumour predisposition syndrome

FH Tumour Predisposition Syndrome, also known as Hereditary Leiomyomatosis and renal cell cancer (HLRCC), or Reed Syndrome, is an autosomal dominant condition clinically characterized by multiple cutaneous leiomyomas, multiple early-onset uterine leiomyomas and early-onset renal cell cancer. Here we report a young female with FH Tumour Predisposition Syndrome with no clinical features except early-onset uterine leiomyomas. Whilst there is a significant history of uterine leiomyomas in her family, there is no history of cutaneous leiomyomas or renal cell cancer (RCC). Uterine leiomyomatosis in young adults may represent a narrow phenotypic variant of FH Tumour Predisposition Syndrome. It is important that young women who present with multiple leiomyomata or leiomyomata with atypical features are referred for molecular genetic testing.

Hereditary leiomyomatosis and renal cell cancer presenting as urothelial carcinoma

Hereditary leiomyomatosis is a genetic disorder that follows an autosomal dominant pattern of inheritance. Along with a variety of leiomyomas, affected individuals are predisposed to developing an aggressive form of type 2 papillary renal malignancy known as Hereditary Leiomyomatosis Associated Renal Cell Carcinoma (HLRCC) that can occur in both the tubulo-papillary and collecting-duct systems. We present a rare case of HLRCC with components of urothelial carcinoma. The patient was treated with cisplatin-based neoadjuvant chemotherapy followed by left radical nephroureterectomy to achieve complete remission of disease.

Abstract 2556: The somatic variant of HLRCC, an unrecognized type of RCC

Abstract Background: Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a hereditary cancer syndrome where affected individuals are predisposed to the development of multiple leiomyomas of the skin and uterus and aggressive forms of kidney cancer. Affected individuals harbor a germline heterozygous loss-of-function mutation of the fumarate hydratase (FH) gene. Diagnosis of these tumors is done on clinical, morphologic and immunohistochemical (IHC) determination of negative staining for FH and genetic testing considered the gold standard. Somatic mutations in HLRCC RCC are not well recognized, and the morphologic features of tumors associated with the somatically mutated tumors has not been described. We report the clinical, morphologically and genetic findings of 7 patients with HLRCC and somatic mutations. Design: Clinicopathologic correlation was done in all cases. All patients (4 males and 3 females) denied family history of kidney cancer or skin lesions. Age range was from 27 to 77. All patients had metastatic disease when accepted for protocol. Genetic testing was performed in all cases and IHC for FH when material was available. Results: The genetic testing was negative for a germline mutation in all cases; however a pathogenic somatic mutation was found in all of them. Some of the somatic mutations included two copy deletion of 1q43, multiple break points on chromosome 1, and loss of heterozygosity. Morphologically the predominant pattern was extensive dense tubular formation with small tubules lined by clear or eosinophilic cells in which some nuclear features suggestive of HLRCC were identified (4 cases) the other cases showed cystic and papillary features. The diagnosis of HLRCC was suggested and FH performed with negative results. Conclusion: Pathologists need to be aware that HLRCC with somatic and no germline mutations may occur more frequently than suspected and that a negative family history is frequently obtained. Morphology is helpful. However, staining for FH with negative results should be suspicious of HLRCC and genetic testing repeated considering the possibility of a somatic mutation, so proper diagnosis is made, and patients receive proper therapies. Citation Format: Maria J. Merino, Esra Dikoglu, Sandeep Gurram, Marston Linehan, Ramaprasad Srinivasan. The somatic variant of HLRCC, an unrecognized type of RCC [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 2556.

Abstract 1311: Inter- and intra-tumor heterogeneity of genetic and immune profiles in hereditary clear cell renal cell carcinoma

Abstract [Background] Von Hippel-Lindau (VHL) disease is an autosomal dominant hereditary cancer syndrome attributed to germline VHL mutation. Patients with this disease are at risk of developing multiple independent clear cell renal carcinomas (ccRCCs), which offers a unique opportunity to analyze inter- and intra-tumor heterogeneity of genetic and immune profiles in the same patient. [Method] We selected seven patients with clinically diagnosed VHL disease who underwent one or two surgeries, in each of which two to five ccRCC tumors (total, n = 25) were removed. We harvested one to six regions from each tumor (total, n = 48), and performed whole-exome sequencing on them, together with normal blood (n = 7), cyst (n = 3), and adjacent normal renal tissue (n = 7) specimens from these patients. In addition, we carried out RNA-sequencing (for 20 tumors and 3 adjacent tissues) and digital multiplexed gene expression analysis using the NanoString nCounter system with Human Immunology V2 panel (for 36 tumors and 5 adjacent tissues) to clarify their immune profiles. [Result] Germline VHL mutations were confirmed in all seven patients. A total of 1,141 non-silent somatic mutations (8-44 mutations per patient) were detected, including 22 mutations affecting previously reported driver genes (such as BAP1, PBRM1, PTEN, PIK3CA, and SETD2). In consistent with previous reports, tumors arising in this context are clonally independent and harbor distinct secondary events, including mutations and copy number alterations (as exemplified by loss of heterozygosity of 3p). By contrast, multiple specimens from the same tumor showed almost the same genetic alterations, although several subclonal mutations were observed. Unsupervised hierarchical clustering of gene expression data discovered two robust subsets with distinct immune-related signatures. Particularly, the subset with high immune signature (n = 29) showed increased antigen presentation machinery genes (B2M, TAP1 and TAP2) and cytotoxic T lymphocyte genes (CD8, PRF1, and GZMA) than that with low immune signature (n = 19), suggesting a higher cytolytic activity in the former subset. Pathway analysis revealed the enrichment of cytokine interaction, JAK-STAT signaling and Toll-like receptor signaling. Interestingly, specimens from the same tumor invariably showed a similar immune signature, whereas different tumors frequently exhibit different immune signatures despite the identical immune background, suggesting a greater difference of immune status across tumors than within a tumor. [Conclusion] This study delineates inter- and intra-tumor heterogeneity of genetic and immune profiles in hereditary clear cell renal cell carcinoma. Our findings demonstrate more profound inter-tumor than intra-tumor heterogeneity in immune status, suggesting that tumor factors have a greater impact on immune microenvironment than host factors. Citation Format: Mariko Tabata, Yusuke Sato, Yasunori Kogure, Marni B. McClure, Yuji Kumade, Yuki Saito, Sumito Shingaki, Kota Yoshifuji, Junji Koya, Kazushi Yoshida, Takashi Kohno, Kenichi Chiba, Ai Okada, Yuichi Shiraishi, Haruki Kume, Keisuke Kataoka. Inter- and intra-tumor heterogeneity of genetic and immune profiles in hereditary clear cell renal cell carcinoma [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 1311.

Hereditary leiomyomatosis and renal cell cancer syndrome (HLRCC): Genotype and phenotype characteristics in a cohort of 197 patients.

1580 Background: HLRCC is a hereditary condition with autosomal dominant inheritance due to germline mutations in the fumarate-hydratase gene ( FH). It is characterized by skin leiomyomas (SLM) in 48-84% of individuals, uterine leiomyomas (ULM) in 30-72%, renal cysts (RCy) and renal cell cancer (RCC) in 15-34%. We aimed to describe the genetics, the clinical features and the potential genotype-phenotype associations in the largest cohort of FH mutation carriers from Spain. Methods: We performed a multicenter, observational, retrospective study of individuals with genetic or clinical diagnosis of HLRCC. We collected clinical information from medical records. We analyzed genetic variants and looked for genotype-phenotype associations. Statistical analyses were performed by IBM-SPSS Statistics-v.22. Results: We included 197 individuals (113 women, 84 men), 74 index cases and 123 relatives. Twenty-seven different variants were detected, 26 pathogenic (12 missense, 5 frameshift, 4 large-deletions, 3 splice-site and 2 nonsense) and 1 variant of unknown significance (missense). Of 182 patients with full skin examination, 64.8% presented SLM (median age 36 years; range 8-85). ULM were diagnosed in 90.3% of 103 women with gynecologic exam (median age 30 years; range 17- 55). Hysterectomy was performed in 62.9% (median age 34 years; range 21-54). Of 153 patients with radiological records, 37.3 % presented RCy. Nineteen patients (10.9%) presented RCC, 11 males and 8 females (median age 37 years; range 10-67). The histological diagnoses were: 14 papillary, of which 10 were type 2; 3 clear cell carcinoma and 2 unclassified carcinoma. Six tumors had stage I, 2 stage II, 3 stage III, 4 stage IV, and 4 not available. The median overall survival among patients at stages 3-4 was 2.9 years [1.3-4.5]. Patients with missense pathogenic variants showed higher risk of developing SLM (p = 0.043) and ULM (p = 0.002) than those with loss of function variants. Conclusions: In our cohort, the frequency of RCC (10.9%) is lower than that published in cohorts of similar sample size. The most frequent histology was the papillary type-2; however, other histological patterns do not exclude HLRCC. Individuals with missense pathogenic variants show higher incidence of SLM and ULM.

Hereditary leiomyomatosis and renal cell cancer: A case series from southeast Spain

Hereditary leiomyomatosis and renal cell cancer: A case series from southeast Spain

Abstract 730: Genomic characterization of hereditary leiomyomatosis and renal cell carcinoma (HLRCC), a rare and aggressive kidney cancer

Abstract Background Hereditary Leiomyomatosis and Renal Cell Carcinoma (HLRCC) is a rare autosomal-dominant syndromic disorder associated with germline FH mutations. Affected individuals have a predisposition to cutaneous and uterine leiomyoma’s, and are at increased risk of developing a renal cell carcinoma (HLRCC- associated RCC) with aggressive clinical outcome. However, aside from FH bi-allelic loss, additional genomic features of HLRCC are currently poorly understood. Method Five cases of HLRCC-associated RCC were characterized using integrated next generation sequencing (NGS) technology. This included an index case where multiple tumor sites (kidney, lung, liver, lymph node, skin, and uterine) from a single patient were characterized. For integrative analysis, in-house data were combined with five RCC cases with FH bi-allelic loss from The Cancer Genome Atlas Study. Single cell sequencing was carried out on normal human kidney to study the cell of origin for HLRCC- associated RCC. Results: Integrative NGS profiling and analysis of HLRCC-associated RCC tumors (n=10) revealed several important observations such as 1) a high frequency loss of whole chromosomes, which is reminiscent of tumors arising from the distal nephron, 2) low mutational burden similar to that observed in other kidney tumors and, 3) a HLRCC specific gene expression signature and discovery of a novel therapeutic candidate (HLRCC-TC1). Importantly, among renal tumors, HLRCC-TC1 was specifically expressed in HLRCC and other RCCs with poor clinical outcome. Application of siRNAs and neutralizing antibodies to HLRCC-TC1 reduced cell proliferation of the HLRCC cell line UOK262, but did not for that of control cell lines. Conclusion: The observed FH bi-allelic mutation along with recurrent chromosome-wide losses and integrative analysis with human kidney single cell sequencing data support a distal nephron origin for HLRCC- associated RCC. In addition, our study provides evidence for nominating HLRCC-TC1 as a novel cancer-specific therapeutic target. Further studies are needed to conduct an in-depth characterization of HLRCC-TC1. Citation Format: Pankaj Vats, Yuping Zhang, Sarvana Mohan Dhanashekaran, Narayanan Sathiya Pandi, Xuhong Cao, Fengyun Su, Sudhanshu Shukla, Rui Wang, Marcin Cieslik, Jincheng Pan, Christopher J. Ricketts, Prem Kumar Kumpati, Ajjai Alva, Marston W. Linehan, Rohit Mehra, Arul M. Chinnaiyan. Genomic characterization of hereditary leiomyomatosis and renal cell carcinoma (HLRCC), a rare and aggressive kidney cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 730.

Abstract 2759: Chemoproteomic profiling of the oncometabolite fumarate

Abstract Dysregulated metabolism is a feature of many diseases, including cancer. In addition to providing energy and building blocks to growing cells, altered metabolism can assist in tumor growth by producing “oncometabolites”. For example, in hereditary leiomyomatosis and renal cell carcinoma (HLRCC) inactivating mutations in fumarate hydratase (FH) leads to accumulation of millimolar levels of an oncometabolite, fumarate. At such high concentrations, fumarate can spontaneously react with protein cysteine residues leading to a post-translational modification (PTM) called cysteine succination. This PTM can directly stimulate tumorigenic signaling, however, current methods to study this PTM are limited. Our lab has developed chemical proteomic methods to investigate proteome-wide targets of cysteine succination. Using these methods, we have identified hundreds of targets of fumarate in normal kidney cells as well as HLRCC cells. One interesting target identified that has implications in cancer progression is SMARCC1, a core subunit of a nucleosome remodeling complex known as the SWI/SNF complex. The SWI/SNF complex is a well-known tumor suppressor and mutation of this complex leads to cancer development. We have demonstrated that excess fumarate levels result in hyper-modification of SMARCC1 and decrease in SWI/SNF complex stability. This instability also results in an increase in EZH2 expression as well as activity, and an increase in H3K27Me3. Our current efforts are aimed at understanding how fumarate affects the function of this complex in vivo and exploring the potential of using EZH2 inhibitors in the treatment of HLRCC. Citation Format: Sarah E. Bergholtz, Chloe A. Briney, Rhushikesh A. Kulkarni, David Wei, Daniel W. Bak, Jonathan H. Shrimp, Eranthie Weerapana, W. Marston Linehan, Jordan L. Meier. Chemoproteomic profiling of the oncometabolite fumarate [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 2759.

Abstract 2760: Photoinducible detection of the oncometabolite fumarate

Abstract Dysregulated metabolism is an important marker of many disease states, including cancer. For example, in hereditary leiomyomatosis and renal cell cancer (HLRCC), inactivating mutations in fumarate hydratase (FH) lead to accumulation of high levels of fumarate, a so-called “oncometabolite.” Substantial evidence indicates that fumarate stimulates various oncogenic signaling pathways, necessitating sensitive methods to detect the oncometabolite in order to more rapidly diagnose HLRCC as well as to identify new disease settings in which fumarate may play a signaling role. Here, we report development of novel photoactivatable, fluorogenic chemical probes for detection and profiling of fumarate in biological systems. These chemical probes, diaryl tetrazoles, are by themselves inert towards fumarate. However, upon irradiation with UV light, they release nitrileimines that can form fluorescent cycloadducts with fumarate. We have demonstrated that diaryl tetrazoles can sensitively detect FH activity as well as low micromolar levels of fumarate in complex biological samples. We have also shown that diaryl tetrazoles can be used to monitor changes in intracellular fumarate levels in biological samples by live-cell imaging and flow cytometry. Moreover, these compounds are capable of visualizing differences between patient-derived primary HLRCC tumors lacking FH activity and the adjacent normal kidney, highlighting their potential utility in clinical diagnostics. By offering new insights into fumarate reactivity, our studies provide the chemical basis for novel approaches to therapy and diagnosis in cancers driven by oncometabolite accumulation. Citation Format: Chloe Briney, Sarah Bergholtz, Rhushikesh Kulkarni, Daniel Crooks, Chandrasekhar Mushti, Stephen Lockett, Rolf Swenson, W. Marston Linehan, Jordan Meier. Photoinducible detection of the oncometabolite fumarate [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 2760.

Bioorthogonal oncometabolite ligation.

Dysregulated cellular metabolism is an emerging hallmark of cancer. Improved methods to profile aberrant metabolic activity thus have substantial applications as tools for diagnosis and understanding the biology of malignant tumors. Here we describe the utilization of a bioorthogonal ligation to fluorescently detect the TCA cycle oncometabolite fumarate. This method enables the facile measurement of fumarate hydratase activity in cell and tissue samples, and can be used to detect disruptions in metabolism that underlie the genetic cancer syndrome hereditary leiomyomatosis and renal cell cancer (HLRCC). The current method has substantial utility for sensitive fumarate hydratase activity profiling, and also provides a foundation for future applications in diagnostic detection and imaging of cancer metabolism.

Abstract 4611: Uterine leiomyoma driver events in uterine adenomyomas

Abstract Uterine adenomyosis is a condition in which ectopic endometrial glands are present in myometrial stroma surrounded by smooth muscle cell hyperplasia. Foci of adenomyosis growing as a tumor like mass are called adenomyomas. Uterine adenomyomas are common tumors and they share symptoms, including pelvic pain and abnormal bleeding, with uterine leiomyomas. The two tumor types are challenging to distinguish from one another and the diagnosis is usually confirmed only after surgery by pathological evaluation. The molecular background of uterine adenomyomas is not currently well known. In uterine leiomyomas, somatic mediator complex subunit 12 (MED12) mutations, high mobility group AT-hook (HMGA2) protein overexpression, and fumarate hydratase (FH) inactivation are well established as major mutually exclusive driver events covering 80-90% of the tumors. Here, we have analyzed the presence of these changes in a set of 21 uterine adenomyomas. Representative areas of formalin-fixed paraffin embedded archival uterine adenomyoma tissue samples were used to construct a tissue microarray. The HMGA2 overexpression and the FH inactivation were assessed using immunohistochemistry with anti HMGA and 2SC antibodies, respectively. DNA was extracted from the tumor samples to determine the MED12 mutation status by direct sequencing of exons 1 and 2 of the gene. MED12 c.131GA, p.G44D mutation was found in two adenomyoma samples out of 21 (9.5%). Strong positive staining of 2SC indicating FH inactivation was present in one sample which also showed reduced FH protein expression when validated with an independent method using anti-FH immunostaining. Sequencing revealed a frameshift mutation c.911delC, p.P304fs in exon 7 leading to a premature stop codon 25 codons later. The mutation was also found in a separate uterine leiomyoma of the same patient and both tumor samples mostly presented the mutant allele indicating loss of heterozygosity of the wild type allele. This, together with the patient's medical history of previous uterine leiomyomas, indicates the germline origin of the mutation and thus a hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome. No changes in HMGA2 expression were detected with all samples presenting normal expression levels. In conclusion, MED12 mutations are present in a subset of uterine adenomyomas. The mutation frequency of 9.5% that was observed here in our adenomyoma sample series is considerably lower than that of 70% in uterine leiomyomas. Our results also suggest that adenomyomas may be linked to HLRCC in which they have not been previously reported. The driver events behind uterine adenomyomas remain mostly unknown and further large-scale studies are warranted to clarify the spectrum of underlying mutations and molecular background of these common tumors. Citation Format: Tuomas A. Heikkinen, Anna Äyräväinen, Janne Hänninen, Terhi Ahvenainen, Ralf Bützow, Annukka Pasanen, Pia Vahteristo. Uterine leiomyoma driver events in uterine adenomyomas [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 4611.

Abstract 3361: Are mismatch repair (MMR) defects and microsatellite instability (MSI) relevant in renal cell and prostate carcinomas? Their significance for future therapies

Abstract Background Few studies have investigated mismatch repair (MMR) defects in renal and prostatic cancers. Normally, MMR accurately detects and corrects mistakes made during replication of a DNA strand. But, a defective MMR system is very likely to miss copy-number errors, particularly in microsatellites (short tandem base repeats). Alterations in function of MMR genes can result in microsatellite instability (MSI), known to facilitate tumor progression and poor prognosis. MMR deficiency is observed frequently in colonic and endometrial carcinoma as part of Lynch's syndrome, as well as occasionally in other neoplasms. In our study, we assayed MMR expression in a series of kidney tumors representing the spectrum of renal malignancies and in a wide-ranging group of prostate cancers (for which clinical information and Gleason grade was obtained in all cases). Materials and methods Immunohistochemical (IHC) staining of FFPE sections from 45 kidney cancers and 30 prostatic tumors was performed. The main MMR proteins of interest are MSH2 and MLH1, plus their heterodimer partners MSH6 and PMS2; staining was directed at these 4 targets. Antibody sources were Abcam, Cambridge, MA 02139 (MLH1, MSH6, PMS2) and Agilent Technologies, Wilmington, DE 19808 (MSH2). Also, PD-L1 expression was evaluated using antibody from Cell Signaling, Danvers, MA 01923. Results Forty-five cases of renal cell carcinoma (RCC) comprised 12 cases of clear cell VHL (von Hippel Lindau) related cancer, 11 papillary type 1, 11 chromophobe, and 11 HLRCC (hereditary leiomyomatosis and renal cell carcinoma). Only one case of chromophobe RCC with sarcomatoid differentiation showed complete loss of MLH1 and PMS2 (2% of 45 renal tumors). Of prostate cancers, only one of 30 tumors (3%) was completely negative for both MLH1 and PMS2; that tumor was Gleason grade 8. The remaining 29 cases were positive for all MMR proteins. Discussion Our study suggests that neither kidney nor prostate cancers are likely to possess significant MMR defects. In our series, clear cell, papillary and HLRCC tumors did not lack MMR expression; one chromophobe case negative for MMR (and presumed liable to MSI) may have developed genomic changes as disease progressed to a more aggressive, sarcomatoid pattern. Prostate cancer with MMR defects also appears to be rare, and we found no correlation with grade and stage. MMR defects lead to highly unstable microsatellite sequences and altered gene expression, so while only a small proportion of these tumors exhibited loss of MMR proteins, it is possible that in these few cases the loss may be significant and that such patients may benefit from new modalities of treatment. IHC detection of MMR defects (as predictors of probable MSI) may prove a useful prognostic tool in identification of rare renal and prostatic cancers likely to exhibit greater genetic instability and neoplastic advance. Citation Format: Xu Naizhen, Marston Linehan, Peter A. Pinto, Maria J. Merino. Are mismatch repair (MMR) defects and microsatellite instability (MSI) relevant in renal cell and prostate carcinomas? Their significance for future therapies [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 3361.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.