Growth Hormone Gene Polymorphism Research Articles

Evaluating Candidate Gene Expressions, pH Levels, and Growth Hormone Gene Polymorphisms in different Chicken Breeds: Investigations for Meat Color Regulation and Abdominal Fat Deposition

Evaluating Candidate Gene Expressions, pH Levels, and Growth Hormone Gene Polymorphisms in different Chicken Breeds: Investigations for Meat Color Regulation and Abdominal Fat Deposition

Effects of GH L127V and TG5 C422T polymorphisms on the hormonal profile, slaughter traits, and meat quality of Hereford bulls.

The creation of objective methods for the evaluation and improvement of quantitative and qualitative indicators of meat productivity in farm animals should be based on a comprehensive analysis of the genetic, physiological, and biochemical parameters of the animal. This study aimed to investigate the effects of growth hormone (GH) and thyroglobulin (TG5) gene polymorphisms on the hormonal status, slaughter traits, and chemical, amino acid, and fatty acid composition of meat in Hereford bulls. Hereford bulls (n = 9) were reared under the same feeding and housing conditions until the age of 21 months, after which they were slaughtered. Polymerase chain reaction-restriction fragment length polymorphism was performed for genotyping GH L127V and TG5 C422T polymorphisms. The experimental animals were evaluated to determine slaughter traits (including pre-slaughter weight, carcass, and internal fat weight and yield), chemical, fatty acid, and amino acid composition of ground beef, and hormonal status using serum concentrations of GH, triiodothyronine, and thyroxine. Animals with the valine homozygous (VV) genotype of GH had the maximum serum GH level of 9.33 mIU/mL (p = 0.10) higher than leucine homozygous (LL) genotype carriers. Individuals with the LL genotype outperformed V-allele carriers in serum thyroxine (T4) concentration by 21.3-30.5 nmol/L (16.15%-24.86%; p < 0.01-0.05). Genetic differentiation induced by TG5 C422T polymorphism was determined to a lesser extent by the hormonal status of the Hereford animals. The V-allele was associated with increased carcass weight, with VV homozygotes significantly outperforming LL individuals by 45.0 kg (13.61%; p < 0.05). The T allele at the TG5 gene polymorphism was associated with more intense lipogenesis and less protein synthesis in muscle tissue and these effects were enhanced in the homozygous state. Young animals with the TT variant of the TG5 gene exhibited a significantly superior polyunsaturated fatty acid/saturated fatty acid ratio of 0.012 units (p < 0.01). Carriers of the LL genotype were characterized by minimum amino acid content in muscle tissue. Heterozygous bulls exceeded LL homozygotes in the sum of essential amino acids by 3.09% (p = 0.10) and non-essential amino acids by 1.9% (p < 0.05). The development of breeding programs for the Hereford breed should be carried out considering genetic features that determine the formation of economic traits in animals. Analysis of polymorphisms in the TG5 gene is a promising method for the early diagnosis of the fatty acid composition of beef. Identification of polymorphisms in the GH gene allows the prediction of higher productivity potential and amino acid composition of meat. The different effects of the GH and TG5 genes on the development of various economic traits allowed us to determine further vectors for scientific research on their complex associations in Hereford cattle, which will be useful for planning effective breeding schemes.

Polymorphism of growth hormone (GH/HaeIII) gene and its association with the performance of merino cross rams

Merino cross sheep (75% Merino × 25% Garut) are introduced by the government of Indonesia for meat production purposes. The present study aimed to determine the polymorphism in the exon 2 region of the growth hormone (GH) gene (422 bp) in Merino cross rams using the PCR-RFLP technique and to analyze its relationship with body weight and body measurements of the rams. A total of 145 rams aged one-year-old with an average body weight of 29.08 ± 7.96 kg from the breeding station in West Java, Indonesia were considered as the experimental animals. It was indicated that a missense mutation of c.55G &gt; A (p.G19S) was detected in the target sequence of the GH gene in Merino cross rams. The PCR-RFLP analysis in the GH gene of Merino cross with HaeIII restriction enzyme (GH/HaeIII) was observed in a moderate category with a polymorphic informative content (PIC) value of 0.22. Therefore, the G allele was more frequent than the A allele (0.85 versus 0.15). Furthermore, the genotype AA was not present among the sheep that were part of the study. However, the polymorphism of p.G19S was found to have no significant association with birth weight and body measurements in one-year-old Merino cross sheep. However, the GH/HaeIII gene in Merino cross rams exhibited polymorphism, primarily with two genotypes: GG (wildtype) and GA (carrier). The G allele was identified as the dominant allele in the ovine GH gene, occurring with a frequency of 0.85. Importantly, the polymorphism of the GH/HaeIII gene was significantly linked to birth weight and chest depth in one-year-old Merino cross rams. These findings provide preliminary insights that could potentially aid in the early stages of molecular selection for Indonesian Merino cross sheep.

The Relationship Between Body Weight and Growth Hormone Gene Polymorphism in Indigenous Turkeys of Nigeria

The candidate gene approach is a valuable tool for improving breeding programs, particularly in poultry, by identifying traits for enhanced production performance. This study investigates the growth hormone (GH) gene as a potential determinant of body weight in Nigerian indigenous turkeys. DNA was extracted from 60 twelve-week-old turkeys using blood samples, and a 466bp DNA fragment was amplified via PCR with primers designed from chicken sequences. The PCR product underwent Msp1 restriction enzyme digestion and was visualized on a 1.5% agarose gel. Genotypes associated with body weight were assessed using a General Linear Model. The GH/Msp1 locus revealed Two alleles (A and G) and three genotypes (AA, AG, and GG), with allele G being predominant. Genotype AG had the highest frequency (0.55), followed by AA (0.42), and GG had the lowest frequency (0.03). However, the least square means analysis showed that the polymorphism in the GH gene of the studied population was not significantly associated with body weight (p&gt; 0.05). Nonetheless, the polymorphic nature of the GH gene in Nigerian turkeys suggests potential for further exploration in quantitative traits.

Polymorphism of growth hormone (GH) gene and its association with performance and body conformation of Harnali sheep.

The present study was carried out to study the polymorphism in the GH gene and its association with various performance and body conformation traits, viz., birth weight (B-WT), weaning weight (W-WT), six-month body weight (6M-WT), one-year body weight (Y-WT), annual greasy fleece weight (AGFW), body length (BL), body height (BH), heart girth (HG) and paunch girth (PG) in 138 Harnali sheep. PCR-RFLP was performed to identify polymorphism in the targeted region of the GH gene. The PCR product of 422bp size of the GH gene was amplified encompassing partial exon 2 and inton 3 in Harnali sheep. The PCR product was digested with HaeIII restriction enzyme for the detection of Single nucleotide polymorphism (SNP). The digested products revealed the presence of two genotypes, i.e. AA and AB in the studied population. A > G mutation (A781G) was observed in our resource population. The AA genotype was found to be the predominant genotype (0.62). Chi square value revealed that resource population was not under Hardy-Weinberg equilibrium with respect to target locus. Period of birth was found to have significant effect on W-WT, Y-WT, BL, BH and PG. Sex of animal was found to have significant (P < 0.05) effect on W-WT and highly significant (P < 0.01) effect on 6M-WT, Y-WT and AGFW in Harnali sheep. The effect of genotype was found to be significant (P < 0.05) on annual greasy fleece weight. AB genotype was found to be associated with higher annual greasy fleece weight and can be used as a potential candidate marker in selection criteria for improving greasy fleece weight in Harnali sheep.

Single-Nucleotide Polymorphisms of Growth Hormone Gene and Its Relationship with Growth Traits in Black Bengal Goats.

The single-nucleotide polymorphisms (SNPs) of the growth hormone (GH) gene could be related to growth traits, particularly in farm animals. This study aimed to identify the SNPs of the GH gene (A781G and A1575G) in Black Bengal (BB) goats in Thailand. Seventy-seven BB goats of both sexes were recruited, and their genotypes were identified. Preweaning growth at birth (weight, W0; height, H0; length, L0; and chest girth, C0) and at 10 weeks postpartum (W10, H10, L10, and C10), including average daily gain (ADG) at 0-4 weeks (ADG0-4W), 4-8 weeks (ADG4-8W), and 8-12 weeks (ADG8-12W), was compared among the different genotypes in goats born from twin litter-size dams. The results showed one genotype, CC, for A1575G and three genotypes, AA, AB, and BB, for A781G. The AA gene had significantly higher W10 than AB (p < 0.05) and BB (p < 0.05). The AA had significantly higher L10 than AB (p < 0.05), while C10 was only higher in male goats (p < 0.01). The ADG4-8W of the AA genotype was significantly higher than the BB genotype (p < 0.01). We came to the conclusion that A781G is associated with growth traits during the preweaning period, while the AA genotype showed better performance than the other genotypes.

Growth hormone gene polymorphism in domestic and wild goat breeds in Kurdistan region of Iraq using PCR-RFLP and SNP markers

Growth hormone gene polymorphism in domestic and wild goat breeds in Kurdistan region of Iraq using PCR-RFLP and SNP markers

Relationship Between Growth Hormone Gene Polymorphism with Milk Production and Its Components in Black Iraqi Goat

Local black goat are raised for the purpose of milk production. The goal of the current study was to identify the growth hormone gene's single nucleotide polymorphism (SNPS). Additionally, the effect of the GH gene SNP on the milk qualities of Iraqi black goat was evaluated. DNA was extracted from blood samples of 28 goat. A segment with a length of 330 bp in the third intron and the fourth exon of the GH gene was analyzed. Bioinformatics software was used to analyze the results. The results showed the presence of three genotypes (TT, TC, CC) at position 263 of the studied plot with a frequency of 0.36, 0.21, and 0.43, respectively. The local breed was characterized by a decrease in observed heterozygosity (21.43%). However, the expected heterozygosity was 50.65%. Low heterozygosity may indicate the presence of inbreeding within the same herd. Haplotypes network revealed a genetic relationship between the local Iraqi goat and the Egyptian goat. As well as the existence of a genetic relationship at a lower level with the Indian goats. From Tajima's D test and Fu's Fs (1.547 and 1.428), the results led to a rise in inbreeding. In milk production, energy, and the amounts of protein. The analysis of the data using bioinformatics tools predicted the effects of identified the genotypes in which the amino acid was not altered, and this is where the mutation was found. There is a relationship between the genetic polymorphism of the growth hormone gene and the production of milk and its components. The CC genotype was superior in milk production, energy, and the amounts of protein and fat over the TC and CC combinations.

Study some Genetic Variance and Breeding Value on Productive Performance for Local Chicken Differ in Polymorphism of Growth Hormone Gene

To fix and detect some value of genetic selection parameters for hens of local chicken differ in growth hormone GH gene polymorphisms, PCR-RFLP technique used with MSP restriction enzyme, three genotype found as AA the wild, AB the heterosis and the mutant BB. Results of some genetic analysis indicating that based on breeding value BV for AA genotype was the highest one 79.913 for body weight at sexual maturity and 1.736 for average age at sexual maturity and 4.373, 5.894 and 0. 438 for average egg product at 100 days and average egg weight at 27 and 34 weeks respectively for the seam AA hens’ genotype. The lowest value for dominant deviation DD was 0.298 for traits of average first egg weight, for body weight at sexual maturity was – 6.659 and – 5.58 for average age at sexual maturity and 0.012 for average egg weight at 20 weeks and 0.042 for average egg weight at 34 weeks for hens with BB genotype. AB genotype was low in trait for average egg weight at 27 and 34 weeks with value of 8.044 and – 0.08 respectively. In conclusion molecular procedure result indicating that depending on some molecular genetic parameters RFLP for such gene of relation with productive performances and BV includes some genetic variances as DD, DV and VA and GV are good tools used in selection programs for local hen’s chicken either if their genotype is with one or two copies of allele A in order to achieve the best genetic group in the way of improving production efficiency for Iraqi local chickens.

The growth hormone gene polymorphism and its relationship to performance and carcass features in Egyptian Awassi lambs

The main purpose of the existing experiment was to assess the allelic and genotypic polymorphisms of the Growth hormone (GH) gene and its correlation with growth indices, efficiency of consumed feed, some body indices and carcass traits of the Egyptian Awassi sheep. Forty Egyptian Awassi male lambs were selected for their growing indices (post-weaning daily gain, marketing weight, and weaning weight), feed efficiency (consumed feed and of consumed feed), body conformational indicators (skeletal muscle index, relative body index, body mass index, and body index), and carcass features (dressing %, hot carcass weight, fore-legs %, neck %, loin %, ribs %, abdominal fat %, Tail % and hind-legs %). The polymerase chain reaction-restricted fragment length polymorphism (PCR-RFLP) tool was applied to detect the genotypic and allelic GH gene polymorphisms properties. The PCR-RFLP analysis identified three main genotypes (AA, AB and BB) and two main alleles (A and B). The GH genotype (AA or AB) exhibited moderate significant influence (P < 0.05) on marketing weight, Loin% and Tail%. Also, genotype (AB or BB) of expressed GH gene significantly (P < 0.01) influence on consumed feed, post-weaning daily gain, neck% and body mass index, whereas, it had no influence on the phenotypic values of the other characteristics investigated. The presence of the A allele in the genotype was markedly associated (P < 0.01) with consumed feed, body mass index and post-weaning daily growth; conversely, the presence of the B allele in the genotype was significantly related (P < 0.05) with marketing weight, loin %, and tail %. While, GH gene expression was revealed to be highly significant (P < 0.01) in relation to post-weaning daily growth, feed intake, and neck %. According to the findings, determining the associations between GH gene variation and growth, efficiency of consumed feed, body measurements, and carcass features of Egyptian Awassi sheep and applying marker assisted selection with the GH gene to improve these traits is warranted and will be of significant economic value to sheep production.

Evaluation of the gene pool by GH L127V and GHR F279Y polymorphisms in Kazakh White-Headed cattle

Abstract. The aim of research is to monitor the genetic diversity of Kazakh White-Headed breed, taking into account the GH L127V and GHR F279Y polymorphisms. Research methods. The object of the study were cows (n = 57 heads) and young animals (calves and heifers, n = 50 heads) from the breeding farm “Krasnyy Oktyabr’”, Volgograd region. Whole blood of animals served as the biomaterial; genotyping was carried out according to the polymorphisms GH L127V in growth hormone gene and GHR F279Y in growth hormone receptor gene by PCR-RFLP method. Results. The study of the gene pool by polymorphisms of the somatotropic axis genes in Kazakh White-Headed cattle showed that the representatives of mature herd and young animals had L (PL = 0.660–0.728) and V (PV = 0.272–0.340) alleles in the locus of growth hormone gene, as well as F (PF = 0.412–0.550) and Y (PY = 0.450–0.588) in the locus of growth hormone receptor gene. Genotypes distribution in growth hormone gene polymorphism was more balanced according to the Hardy-Weinberg law, but the population significantly (P &lt; 0.05) deviated from the equilibrium state according to the genetic frequencies in growth hormone receptor gene. Differences in genetic frequencies for the growth hormone gene did not reach a significant level (χ2 = 4.451; P = 0.108) between cows and young animals. Whereas, there were significant differences (χ2 = 12.103; P = 0.002) in the frequencies of homozygous genotypes carriers for the growth hormone receptor gene, which was due to the use of heterozygous sire for this polymorphism in the reproduction of the herd. Scientific novelty. For the first time, data on the assessment of the genetic structure of the Kazakh White-Headed mature herd and replacement young animals of Volgograd selection were obtained according to the polymorphisms GH L127V and GHR F279Y, associated with indicators of meat productivity. The results of the analysis of the genetic structure of the herd indicate the possibility of directed changes in the gene pool of the population in just one generation, which creates the prerequisites for the introduction of marker-assisted selection.

Growth hormone gene and their association with body weights and morphometric characters in Nellore sheep

The aim of the study was to identify growth hormone gene polymorphisms and their association with body weights and morphometric characters in Nellore sheep. A total of 50 Nellore sheep (12 months old) maintained at Instructional Livestock Farm Complex, Mamnoor were genotyped at 5' regulatory region and exon 4 by using polymerase chain reaction-single stranded chain polymorphism (PCR-SSCP) technique. The PCR-SSCP of 5' regulatory region (210 bp) yielded three genotypes AA, AB and BB corresponding to two allelic variants A and B. The genotypic frequencies were 0.24, 0.42 and 0.34 for AA, AB and BB, respectively and the allelic frequencies of A and B were 0.45 and 0.55, respectively. The exon-4 (191 bp) yielded two genotypes, AA (0.60) and AB (0.40) corresponding to two allelic variants A and B. The allelic frequencies of A and B were 0.80 and 0.20, respectively. No significant associations were found between different SSCP genotypes and body weights and morphometric characters. The study showed that two loci were polymorphic and hence further studies are required to find out association of polymorphism, if any, with different economic traits in Nellore sheep.

Association of Growth Hormone Gene Polymorphisms and Calpastatin Gene with Quality of Sheep Meat

Association of Growth Hormone Gene Polymorphisms and Calpastatin Gene with Quality of Sheep Meat

Breeding characteristics of Romanov sheep depending on polymorphism of growth hormone gene

The search for new markers of high productivity of sheep and the introduction of evaluation and selection methods for these indicators is an urgent direction in breeding of Russian sheep. The material for the research was the results of assessment of exterior, live weight of Romanov sheep. Genetic studies were carried out using tissue samples (ear plucking). Polymorphism of growth hormone gene in Romanov sheep was evaluated by restriction fragment length polymorphism analysis and polymerase chain reaction. Evaluation of polymorphism of growth hormone gene in the population of Romanov sheep showed the presence of three allelic variants - AA, AB and BB, with a frequency of 0.24, 0.63 and 0.14, respectively. The statistically significant difference between the indicators of live weight in animals with genotypes GHAB and GHAA, GHAB and GHBB was: at birth 210 g and 140 g (P 0.95), respectively; at weaning 350 g and 1260 g (P 0.95), respectively. The phenotypic variability of live weight was the highest at birth and at weaning and amounted to 31.732.5 % for all genotypes. Animals with genotypes GHAA and GHAB outperformed their peers with genotype GHBB in dimensions of rump width in tuber coxae, rump width in tuber trochanterica, chest width, chest circumference, and therefore, had a wide body. When studying the phenotypic and genetic correlations of measurements of exterior and live weight at the age of 12 months, a reliable positive relationship was established with height at withers height (rP = +0.13*; rG = +0.02), rump height (rP = +0.14**; rG = +0.03), rump length (rP = +0.14**; rG = +0.02). The new knowledge gained about polymorphism of GH gene and its relationship with productive traits of Romanov sheep will allow for in-depth evaluation, targeted selection and selection of individuals with desirable genotypes.

Morphometric characterization and effect of growth hormone (GH) gene polymorphism on growth traits of Kerinci duck (Anas platyrhynchos)

&lt;p&gt;&lt;strong&gt;Objective:&lt;/strong&gt; To determine the association of GH gene diversity with growth traits and to obtain the morphometric characteristics in Kerinci ducks.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Methods:&lt;/strong&gt; The research method is an experiment using 96 blood samples of Kerinci duck blood. The methods included data collection on quantitative characteristics (body weight, body weight gain, body measurements), blood samples from Kerinci ducks, DNA extraction activities, PCR amplification and restriction with AluI enzyme. Data analysis included t-test, T2-Hotelling, principal component analysis, genotype frequency, allele, Hardy-Weinberg balance, heterozygosity, and PIC.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Results:&lt;/strong&gt; The quantitative characteristics of male Kerinci ducks were significantly different (P&amp;lt;0.05) higher than female Kerinci ducks. Analysis of the Kerinci duck GH|AluI gene was polymorphic. The population of Kerinci ducks was in Hardy-Weinberg equilibrium (P&amp;gt;0.05). Diversity Value of Kerinci Duck Ho&amp;lt;He. Quantitative characteristics of GH gene of Kerinci duck genotype +/+ were significantly different (P&amp;lt;0.05) higher than genotype +/- and -/-.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Conclusions:&lt;/strong&gt; The quantitative characteristics of male Kerinci ducks were higher than female Kerinci ducks. Characteristics of the body size of Kerinci duck are the length of sternum, length of shank, and circumference of shank, and identifier of body shape is length of wings. The Kerinci duck GH|AluI gene is polymorphic and has associations with quantitative characteristics, with the best genotype being the +/+ genotype.&lt;/p&gt;

A meta-analysis of the association between Growth Hormone (GH) gene polymorphism and growth traits in cattle breeds

GH gene is one of the important genes that affect the productive and physiological traits in livestock. This study aimed to use a meta-analysis to determine the association of the GH gene with growth traits in cattle. Four different genetic models were used: dominant LL + LV versus VV, recessive LL versus LV + VV, complete over dominant LL+VV vs. LV and co-dominant LL vs. LV, LL vs. VV and LV vs. VV. The random-effect model was used in data analysis based on I2. Meta-analysis showed an effect of GH genotypes on the birth weight (BW) under the recessive (p&lt;0.05) and complete over dominant (p&lt;0.01) models. However, no association (p&gt;0.05) was found under the dominant model. In terms of co-dominant model, the GH polymorphism showed a significant association with BW (SMD = 0.359, 95% CI = 0.119 to 0.599, p = 0.003) under LL vs. LV genotype combination patterns. No association was found between GH polymorphism and BW under LL vs. VV genotype combination. The results showed that the LL genotype had a significant effect on BW traits from LV and VV genotypes when comparing the models. The results showed an effect of the GH on ADG under four genetic models (p&lt;0.05).

PSXII-6 Evaluation of the Influence of bGH Gene Polymorphism on Elemental Composition of Blood Serum and Beef Productivity of Black Spotted Bulls

Abstract The purpose of this study was to establish the effect of single-nucleotide polymorphism of the bovine growth hormone (bGH) gene on elemental status and beef productivity of Black Spotted bulls (n=100; age-18 months). DNA samples were isolated from whole blood. The bGH gene polymorphism was determined using the PCR-RFLP method followed by restriction analysis. The elemental composition of the samples was estimated according to 25 chemical elements (Al, As, B, Ca, Cd, Co, Cr, Cu, Fe, I, K, Li, Mg, Mn, Na, Ni, P, Pb, Se, Si, Sn, Hg, Sr, V, Zn) by ICP AES and ICP MS. The detection of SNP (rs135322669) in the bGH gene showed three genotypes: CC (n=58), CG (n=24), GG (n=18). A comparative analysis showed that blood serum of animals with CC genotype contained significantly (Р£0.05) more Co, Cr, Cu, Fe, Ca, I, Se, Si, Li, Sr compared to the CG and Cu, I genotypes, Se, Ca, Si, Li, V, Sr in comparison with the GG genotype. In bulls with genotype CG to GG more toxic elements-Al, Sn, Pb were accumulated significantly (P£0.01). The Black Spotted bulls with the CC genotype advanced over animals with CG and GG, according to fresh carcass weight by 5.1 (Р≤0.05) and 8.9% (Р≤0.05), carcass yield-by 0.38 and 0.91% (Р≤0.05), internal fat mass-by 5.9 (Р≤0.05) and 15.6% (Р≤0.01), slaughter weight-by 4.8 (Р≤0.05) and 9.1% (Р≤0.01), slaughter yield-by 0.51 and 1.2% (Р≤0.05), pulp weight-by 5.4 (Р≤0.05) and 10.8% (P≤0.01). Thus, selecting Black Spotted bulls according to the bGH gene polymorphism, it is advisable to select individuals homozygous for the CC genotype. Animals with the indicated genotype are characterized by higher beef productivity, increased metabolism of essential elements and a minimum quantity of toxic elements in relation to animals with the CG and GG genotypes.

Growth Characteristic and the Study of Polymorphism Growth Hormone Genes of Sentul Chicken

The research was conducted to study the characteristics of growth, carcass production and growth hormone gene polymorphisms in various male sentul chickens. The research was conducted using experimental methods with a completely randomized design. The research material was 100 male day old chickens of Sentul. The treatment was a fixed factor, namely the variation of the color of the feathers of various Sentul chickens consisting of: “Abu” Sentul, “Emas” Sentul, “Geni” Sentul, “Debu” Sentul, “Batu” Sentul.. Each experimental unit consisted of 5 chickens and 4 replications. The variables measured included: hatching weight, body weight, body weight gain and the percentage of carcass produced at the age of 8 weeks. Identification of growth hormone gene polymorphisms used the primary design Gallus gallus haplotype GH-h22 growth hormone (GH) gene, complete cds, GenBank: JN675393.1 with forward primer / Sequence: AGGTGGTTCGGTTTTCACTG and reverse primer / Sequence: TCCCTTCTTCCAGGTCCTTT. Characteristics of growth and carcass production data were analyzed by analysis of variance; while to determine the presence of GH gene, polymorphisms were analyzed using the bioedit program. Analysis of variance showed that there were no significant differences (P&gt; 0.05) between hatching weight, body weight, body weight gain and carcass percentage of various Sentul chickens. The results of GH Gallus gallus gene sequencing at base length 80 bp showed a mutation from adinine to cytosine, when comparing sentul chickens and Gallus gallus data in GenBank. The GH gene were present in various sentul chickens with monomorphic characteristics with homozygous genotypes of CC. The results of this study can be concluded that the characteristics of growth and carcass production in various Sentul chickens are relatively the same, as well as the monomorphic GH gene.&#x0D; Keywords: Sentul chickens, body weight, carcass percentage, growth hormone gene, monomorphic.

Association of GH gene polymorphism with meat quality traits in meat and wool sheep

Increasing the productivity and effi ciency of lamb production is a key factor in the competitiveness of the meat sheep industry. Therefore, in order to conduct sheep breeding more effectively it is necessary to apply new approaches to increase and improve the quality of products.Considerable interest are modern technologies involving the use of DNA markers, which are widely used in national breeding programs of a number of countries with developed animal husbandry and have a signifi cant impact on improving productivity indicators. A significant number of genes associated with meat productivity and meat quality have been identifi ed. However, in sheep breeding, information about the main genes or loci that affect the growth characteristics and productive traits of sheep is relatively limited. Due to the growing interest in the production of young mutton and lamb, priority is given to the study of genes that control meat productivity. The greatest interests are studies on the evaluation of the polymorphism of the growth hormone (GH) gene, which controls growth and development, as well as infl uencing the meat productivity of sheep. In this regard, the purpose of this work was research aimed at fi nding associations between polymorphic variants of the growth hormone gene and the qualitative characteristics of meat in meat and wool sheep of the genotype ½ Poll Dorset × ½ North Caucasian Meat and Wool breed bred in the Stavropol Territory. The data obtained when studying the histostructure of the m. Longissimus dorsi, depending on the genotypes of GH gene, indicate that the muscle tissue in individuals with AB and BB genotypes was characterized by a large number of muscle fi bers by 5,7 and 6,4 %, their smaller diameter by 7,6 and 9,2 %, and a lower content of connective tissue compared to animals with the genotype AA of GH gene.

Polymorphism of growth hormone gene and its association with body measurement traits in Boer goat does

The study examined single nucleotide polymorphisms (SNPs) in the growth hormone gene (GH1) in Boer goat does and their relationship with body measurement traits, namely bodyweight, body length, heart girth, rump height, rump width, ear length, cannon circumference, and head width. Seventy-six Boer goat does between the ages of 2 and 4 years were used as experimental animals. Polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) and deoxyribonucleic acid (DNA) sequencing techniques were used to detect SNPs. Chi-square test was used to measure the genetic equilibrium and a general linear model was used for the marker-trait association analysis. The PCR-RFLP and DNA sequencing results discovered one SNP (G505C) in the exon 5 of the candidate gene with two genotypes observed (AA and AB). The association analysis indicated that bodyweight was associated with the genotypes (P &lt;0.01), but not with any of the morphometric traits. A chi-square analysis indicated that the genotypic frequencies were in Hardy-Weinberg equilibrium. The polymorphism discovered in this study is a putative marker that might assist farmers in improving their does’ bodyweight through marker-assisted selection.