Greenhouse Pathogenicity Tests Research Articles

Occurrence of the Reniform Nematode Rotylenchulus reniformis on Sponge Gourd (Luffa cylindrica) in Yunnan Province, China.

Sponge gourd (Luffa cylindrica) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes (Rotylenchulus) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 μm (352.8 to 436.7 μm), stylet = 18.6 ± 0.5 μm (17.6 to 19.4 μm), tail length= 25.9 ± 2.2 μm (20.1 to 29.9 μm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 μm (368.1 to 463.9 μm), stylet = 12.8 ± 0.8 μm (11.2 to 14.1 μm), tail length= 26.3 ± 1.8 μm (24.3 to 29.4 μm), spicule = 20.6 ± 0.9 μm (19.6 to 22.7 μm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.

First Record of Aspergillus fijiensis as an Entomopathogenic Fungus against Asian Citrus Psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae).

The Asian citrus psyllid Diaphorina citri Kuwayama (Hemiptera: Liviidae) is the most widespread and devastating pest species in citrus orchards and is the natural vector of the phloem-limited bacterium that causes Huanglongbing (HLB) disease. Thus, reducing the population of D. citri is an important means to prevent the spread of HLB disease. Due to the long-term use of chemical control, biological control has become the most promising strategy. In this study, a novel highly pathogenic fungal strain was isolated from naturally infected cadavers of adult D. citri. The species was identified as Aspergillus fijiensis using morphological identification and phylogenetic analysis and assigned the strain name GDIZM-1. Tests to detect aflatoxin B1 demonstrated that A. fijiensis GDIZM-1 is a non-aflatoxin B1 producer. The pathogenicity of the strain against D. citri was determined under laboratory and greenhouse conditions. The results of the laboratory study indicated that nymphs from the 1st to 5th instar and adults of D. citri were infected by A. fijiensis GDIZM-1. The mortality of nymphs and adults of D. citri caused by infection with A. fijiensis increased with the concentration of the conidial suspension and exposure time, and the median lethal concentration (LC50) and median lethal time (LT50) values gradually decreased. The mortality of D. citri for all instars was higher than 70%, with high pathogenicity at the 7th day post treatment with 1 × 108 conidia/mL. The results of the greenhouse pathogenicity tests showed that the survival of D. citri adults was 3.33% on the 14th day post-treatment with 1 × 108 conidia/mL, which was significantly lower than that after treatment with the Metarhizium anisopliae GDIZMMa-3 strain and sterile water. The results of the present study revealed that the isolate of A. fijiensis GDIZM-1 was effective against D. citri and it provides a basis for the development of a new microbial pesticide against D. citri after validation of these results in the field.

Occurrence and distribution of damping-off in Vigna subterranea in Benin and identification of associated causal agents

Bambara groundnut (Vigna subterranea (L.) Verdc.), also called ground peas or Bambara groundnut, is a West African seed legume of the Fabaceae family, playing an important social and economic role. The objective of the current study was to determine the occurrence, distribution and incidence of this disease on Bambara groundnut in agroecological production zones in Benin and to identify the causal agents responsible for the damages caused to the crop. A survey was conducted from 2019 to 2020 in five agroecological zones (AEZs) of Benin (AEZ2, AEZ3, AEZ4, AEZ5 and AEZ6). A total of 30 fields of Bambara groundnut were surveyed from 10 municipalities located in the agroeclogical zones of production at the early vegetative stage of the crop. Fields’ size of 0.5 ha were selected and scouted alongside both diagonals to evaluate the damping-off disease incidence. The results showed that damping-off occurred in four out of the five AEZs surveyed. The incidence rates varied from 0.00 to 23.33% in the AEZs 5 and 6 in 2019, and from 0.00 to 18.33% in the AEZ 6 in 2020. The highest incidence rates were obtained in the West Zone of Atacora (AEZ 4) and in the Food crop region of South (AEZ 3). Results of the correlation test showed a relationship between incidence, distribution of damping-off and climatic factors. However, most of regression equations showed a strong relationship between chemical properties of soils and incidence of damping-off. Sclerotium rolfssi was identified in the laboratory as the causal agent of the damping-off disease and isolated from diseased plants in the fields and during greenhouse pathogenicity tests. To the best of our knowledge, this is the first report of identification of pathogenic fungus as the causal agent of damping-off on Bambara groundnut seedlings in Benin.

DINÁMICA TEMPORAL DE LA MARCHITEZ DE LA VAINILLA (Vanilla planifolia) ASOCIADA A Fusarium spp., EN TRES SISTEMAS DE PRODUCCIÓN EN PAPANTLA, MÉXICO

<p><strong>Background. </strong>Vanilla wilt disease caused by <em>Fusarium oxsyporum</em> f. sp. <em>vanillae</em> is a major limitant factor in the vanilla crop production in México. <strong>Methodology.</strong> Temporal dynamics of vanilla wilt was studied under different crop production systems, rustic (RS), traditional (TS) and with orange tree as the tutor plant (OTS) in Papantla, Veracruz. Thirty vanilla plants per orchard were selected; roots and rhizosphere soil per plant were sampled from May to December of 2016, to assess <em>Fusarium</em> spp. incidence and severity in roots and inoculum density in rhizosphere soil. Plant phenology and weather variables were also estimated. <strong>Results.</strong> Temporal behavior of inoculum density and <em>Fusarium </em>spp. root incidence showed a monomolecular increase in all crop production systems. OTS showed the highest growth rates for ID (<em>r</em> = 0.023 propagules per day) and incidence (<em>r</em> = 0.006 % per day), but the lowest area under the disease progress curve (AUDPC) for severity (529.1 % per month), an intermediate amount for root biomass rate (<em>r</em> = 0.018 g per day) and the highest crop yield (0.6 t ha<sup>-1</sup>); meanwhile, RS obtained the highest disease severity AUDPC (1267.71 % per month), the lowest root biomass rate (<em>r</em> = 0.011 g per day) ) and zero crop yield. Disease severity in roots decreased their biomass and the crop yield. Greenhouse pathogenicity tests showed that <em>Fusarium oxysporum</em> induced similar wilt and rot disease symptoms in vanilla roots and stems, and foliar yellowing and fall, as those recorded in the crop field, but this not happened with <em>Fusarium solani</em>. <strong>Conclusion.</strong> Vanilla wilt disease occurred during the whole period of assessment in this study, and it was affected by the type of crop production system and management strategies.</p>

Occurrence of copper-resistant strains and a shift in Xanthomonas spp. causing tomato bacterial spot in Ontario.

Field strains of tomato bacterial spot pathogen (Xanthomonas euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri) were characterized for sensitivity to copper and species composition. A total of 98 strains were isolated from symptomatic leaf and fruit samples collected from 18 tomato fields in Ontario. In greenhouse pathogenicity tests, most of the field strains caused severe (37 strains) to highly severe (23 strains) symptoms on 'Bonny Best' tomato plants, whereas 38 strains caused moderate symptoms. In MGY agar plates amended with various concentrations of copper sulfate, 11 strains were completely sensitive (no growth) and 87 strains were resistant (grew on 1.0 mmol/L or higher copper concentration). PCR analysis of the hrp gene cluster followed by restriction digestion with HaeIII and sequencing identified X. gardneri (35 strains) and X. perforans (26 strains) as predominant species and X. euvesicatoria and X. vesicatoria as less common species in Ontario tomato fields. Separation of field strains into various species was also confirmed with starch hydrolysis activity on agar medium. Moreover, 72 field strains produced shiny greenish-yellow colonies surrounded by a milky zone on xanthomonad differential (Xan-D) medium, and the colonies of 26 strains did not produce a milky zone. Thirty-four strains could not be clustered into any species and 25 of those strains were negative for the hrp gene PCR and also did not produce a milky zone around colonies on Xan-D medium. Our results suggest a widespread existence of copper-resistant strains and an increase in X. perforans strains of bacterial spot pathogen in Ontario. This information on copper resistance and species composition within bacterial spot pathogens in Ontario will be helpful for developing effective disease management strategies, making cultivar selection, and breeding new tomato cultivars.

First Report of Corynespora cassiicola-Incited Target Spot on Cotton in Alabama.

Target spot symptoms were first observed on dryland and irrigated cotton (Gossypium hirsutum L.) statewide in Alabama in 2011. Leaf spots first appeared in the lower canopy and spread upward through the canopy toward the shoot tips. Individual leaf spots were roughly circular, formed concentric rings of alternating light and dark brown bands, and were up to 10 mm in diameter. Leaves with multiple lesions senesced prematurely. In 2012, target spot symptoms were observed as early as 68 days after planting in Tallapoosa County, Alabama. The possible combination of early disease onset and frequent showers/irrigation triggered rapid premature defoliation in some fields in excess of 75% in susceptible cultivars (Phytogen 499). Estimated yield losses in select cultivars (Deltapine 1050 and Phytogen 499) exceeded 336 kg/ha seed cotton. In 2012, symptomatic leaves were obtained from two separate locations in Alabama (Baldwin and Tallapoosa counties). The fungus was isolated from lesions by single spores plated on antibiotic V8 agar (1) and incubated at 21°C for 2 weeks under 12-h light cycles. Conidiophores arising from the gray, flocculose colonies were simple, erect, cylindrical, brown or olivaceous, unbranched, with two to seven septa. Conidia were borne singly, ranging from subhyaline to olivaceous, obclavate to cylindrical, straight to slightly curved, contained 4 to 15 pseudosepta, and were 50 to 209 μm long and 7 to 15 μm wide. These characteristics were consistent with the original description of Corynespora cassiicola on cotton (2). The internal transcribed spacer region (ITS) of two isolates, one representing each location, was amplified using primers 2234c and 3126t targeting a 550-bp region of the ITS1, 5.8S rRNA gene, and ITS2 (3). Sequences revealed 99% similarity to C. cassiicola in NCBI (Accession Nos. AY238606 and JQ717069). In greenhouse pathogenicity tests, 10 cotton seedlings (Phytogen 499) were inoculated by spraying a fungal suspension (2 × 104 spores/ml) of each of the two isolates prepared from 2-week-old cultures until runoff. Controls were inoculated with sterile water. Cotton seedlings were incubated in a moist chamber at 21°C for 72 h. All plants inoculated with the fungus developed leaf spot symptoms in 6 days. The fungus was reisolated from five inoculated plants. DNA was extracted from each isolate, amplified using primer pair 2234c/3126t, and sequenced. Sequences (550-bp) from all isolates shared 99% similarity to other C. cassiicola sequences in GenBank (Accession Nos. AY238606 and JQ717069). Nucleotide sequence data reported are available in GenBank under Accession Nos. KC544017 to 23. This pathogen has been reported previously to be economically important on a number of other hosts. To our knowledge, this is the first report of C. cassiicola on cotton in Alabama. Given the increasing prevalence of this disease in Alabama, its confirmation is a significant step toward developing management recommendations for growers.

Zoospore chemotaxis of closely related legume‐root infecting Phytophthora species towards host isoflavones

Phytophthora niederhauserii, P. pisi, P. sojae and P. vignae are closely related species that are pathogenic to various legume plants. While P. sojae and P. vignae are reported to specifically infect soybean and cowpea, respectively, P. pisi is reported to attack pea and faba bean. Phytophthora niederhauserii is considered to have a broad host range. Zoospores of some Phytophthora species are chemotactically attracted to the isoflavones that are secreted by their host plants. The focus of the current study was to determine the chemotaxic behaviour of zoospores from closely related legume‐root infecting Phytophthora species and to investigate the correlation, if any, to host preference as determined by greenhouse pathogenicity tests. The results showed that P. sojae and P. vignae were attracted to the non‐soybean isoflavone prunetin as well as to the soybean isoflavones genistein and daidzein, which is in contrast with their host specificity on soybean and cowpea, respectively. On the other hand, P. pisi and P. niederhauserii were only attracted to prunetin, previously reported to be produced by pea, but not to the isoflavones associated with the non‐host soybean. The lack of responsiveness to genistein and daidzein in P. pisi may represent a recent adaptation to the host specialization towards pea. However, the affinity of P. niederhauserii to prunetin shows that this trait can also be present in taxa not specifically associated with legume hosts.

First Report of Bacterial Gall on Loropetalum chinense Caused by Pseudomonas savastanoi in the United States.

Bacterial gall symptoms were observed on Loropetalum chinense (R. Br.) Oliv. in two separate commercial nurseries in South Alabama during the spring of 2012. Limb dieback and plant death was first reported by the growers. Plants with dieback symptoms had galling and irregular dark callus formation on the lower stem and lower branches. Galls were small, 0.2 to 1 cm, inconspicuous, and in some cases girdled the stem causing breakage of the main stem. In both locations, 30 to 40% of the crop was affected. Similar symptoms have been observed on L. chinense in nursery and landscape plantings in central Alabama, North Carolina, and Georgia in previous years. Bacterial colonies were isolated from four plants representing two different locations. Isolates were recovered from surface sterilized symptomatic tissue on nutrient agar and King's medium B (KMB). All isolates were gram-negative and fluoresced blue-green under UV light after 48 h of growth at 28°C on KMB. One representative isolate from each site was identified as Pseudomonas savastanoi based on their fatty acid profiles (similarity index of 0.776; MIS-TSBA, version 4.0, MIDI Inc., Newark, DE) and LOPAT tests (2). The identity was confirmed by sequencing a 900-bp portion of the 16S rDNA gene, which revealed 98% similarity to the P. savastanoi type strain in NCBI (Accession No. AB021402). In greenhouse pathogenicity tests, eight Loropetalum liners were inoculated with a bacterial suspension (107 CFU/ml) of each of the two isolates. Plants were inoculated by injecting the suspension into the lower stem after wounding by puncturing with needles or slicing sections of the bark. Controls were inoculated with water. All plants inoculated with the bacteria developed gall symptoms in 8 weeks under 90% relative humidity at 30°C. The bacteria were reisolated from five inoculated plants. DNA was extracted from each isolate, amplified using primer pair 27F/1492R targeting the 16S rDNA gene (1), and sequenced. Sequences (900 bp) from all isolates shared 98 to 99% similarity to P. savastanoi type strain in GenBank (Accession No. AB021402). Nucleotide sequence data reported are available in GenBank under accessions JX915832 to 37. To our knowledge, this is the first report of bacterial gall of L. chinense caused by P. savastanoi in the United States. Given the increasing prevalence of this disease in South Alabama, its confirmation is a significant step toward management recommendations for growers.

First report of Nectria haematococca causing root rot disease of physic nut (Jatropha curcas) in China

A serious root rot disease in nurseries and plantations of J. curcas has been observed in Luodian County, Guizhou Province, China, since 2006. The symptoms were yellowing, wilting and leaf fall as well as blackening and rotting of the roots and collars. Laboratory examination and greenhouse pathogenicity tests showed that the causal agent of the disease was Nectria haematococca. This is the first report of N. haematococca, as the cause of root rot of Jatropha curcas L. in China.

Virulence, distribution and diversity of Rhizoctonia solani from sugar beet in Idaho and Oregon

Rhizoctonia root rot causes serious losses on sugar beet worldwide. In order to help explain why Rhizoctonia root rot management practices have not performed well in some areas of the Intermountain West (IMW), a survey was conducted. In the IMW from 2004 to 2006, 94 Rhizoctonia solani field isolates were collected from sugar beet roots. These field isolates were compared with 19 reference strains and 46 accessions from GenBank for genetic diversity based on sequencing of the ITS-5.8S rDNA region. Greenhouse pathogenicity tests on sugar beet and silage corn were conducted and plant damage was assessed using a randomized complete block design with at least four replications. The majority of the isolates had sequence identity with the AG-2-2 IIIB (47%) or AG-4 subgroups (44%). Most of the AG-2-2 isolates (87%) were associated with fields in the western portion of the production area, while 71% of the AG-4 isolates came from the eastern portion of the production area. Isolates from AG-2-2 IIIB were frequently more virulent on sugar beet and sequence of the ITS-5.8s region required cloning because of genetic diversity within isolates. Seven (all AG-2-2 IIIB) of 18 isolates tested could attack both sugar beet and corn, while two of the seven virulent isolates caused less root rot on corn. To reduce Rhizoctonia root rot on sugar beet and corn, crop rotations and the isolates utilized for selecting host resistance could be given further consideration.

Potential of Epicoccum purpurascens Strain 5615 AUMC as a Biocontrol Agent of Pythium irregulare Root Rot in Three Leguminous Plants

Epicoccum purpurascens stain 5615 AUMC was investigated for its biocontrol activity against root rot disease caused by Pythium irregulare. E. purpurascens greenhouse pathogenicity tests using three leguminous plants indicated that the fungus was nonpathogenic under the test conditions. The germination rate of the three species of legume seeds treated with a E. purpurascens homogenate increased significantly compared with the seeds infested with P. irregulare. No root rot symptoms were observed on seeds treated with E. purpurascens, and seedlings appeared more vigorous when compared with the non-treated control. A significant increase in seedling growth parameters (seedling length and fresh and dry weights) was observed in seedlings treated with E. purpurascens compared to pathogen-treated seedlings. Pre-treating the seeds with the bioagent fungus was more efficient for protecting seeds against the root rot disease caused by P. irregulare than waiting for disease dispersal before intervention. To determine whether E. purpurascens produced known anti-fungal compounds, an acetone extract of the fungus was analyzed by gas chromatography mass spectrometry. The extract revealed a high percentage of the cinnamic acid derivative (trimethylsiloxy) cinnamic acid methyl ester. The E. purpurascens isolate grew more rapidly than the P. irregulare pathogen in a dual culture on potato dextrose agar nutrient medium, although the two fungi grew similarly when cultured separately. This result may indicate antagonism via antibiosis or competition.

SEEDLINGS OF CARDAMOM (<i>Elettaria cardamomum</i> (L.) Maton) EVALUATION BY RESISTANCE <i>in vitro</i> AT CULTURE FILTRATES OF <i>Fusarium oxysporum</i> Link

Fusarium oxysporum Link is the cause of basal rotting in cardamom. The present article evaluates the phytotoxical effect of of the fungus crude filtrate,for selecting somaclonal variations of cardamom that showed resistance in greenhouse pathogenicity tests. According to mortality test results clone 5 and the isolated 4 were pointed with the most susceptibility-virulence interaction. From accelerated growth media seedlings there were selected 25 and inoculated with different concentrations of filtrate, causing mortality on the initial weeks. By the sixth week only a 32% resisted the concentration increment. By the tenth cycle of inoculation 100% of seedlings remained in the crude filtrate without dilutions. The more time the seedlings remain in accelerated growth media and the more selection pressure increasing filtrate concentration show increased probability of getting somaclonal variants with in vitro resistance of Fusarium oxysporum.

Sugar beet root rot at harvest in the US Intermountain West

Root rot in sugar beet (Beta vulgaris) causes significant losses worldwide. To assess the distribution of root rot fungi and their relationship to bacterial root rot, commercial sugar beet roots with rot symptoms were collected at harvest time in the Intermountain West. Isolations for both fungi and bacteria were conducted using standard microbiological techniques, and the root area rotted was assessed. A subset of fungal isolates was tested for pathogenicity to sugar beet in greenhouse assays and field trials with and without manure. In the field survey of rotting beets, the fungi most frequently associated with root rot included Fusarium spp. (Fusarium oxysporum and Fusarium acuminatum with 24% and 15% of isolates, respectively), Geotrichum spp. (16% of isolates), Rhizoctonia solani (15% of isolates), and Mucor spp. (14% of isolates). However, only R. solani isolate F321 (AG-2-2IIIB) consistently caused rot in greenhouse pathogenicity tests. In the field survey, a mean of 6% of the root tissue had rotted for individual roots when fungi were isolated individually, whereas mean root rot was 71% and 68% when bacteria were isolated individually or in combination with other organisms, respectively. In field trials, roots inoculated with F321 averaged 3%–5% fungal rot, whereas the percentage of root tissue with bacterial rot was 6%–78%, which supports survey observations. Manure did not lead to root rots in the field. Traditionally, fungal root rots have been the main focus of breeding programs; however, because of the root area rotted by lactic acid bacteria, especially Leuconostoc, these bacteria should not be ignored in breeding efforts.

Holocryphia eucalyptionTibouchina urvilleanain Australia

Tibouchina spp. (Melastomataceae) are native to South America, but have been planted as ornamentals in many southern hemisphere countries. The Melastomataceae are members of the Myrtales and are close relatives of the Myrtaceae, to which the genus Eucalyptus belongs. The recent discovery of several Chrysoporthe spp. on Tibouchina spp. has prompted a more detailed survey for other Eucalyptus pathogens that might occur on this tree. In this study, the discovery in Australia of Holocryphia eucalypti, a Eucalyptus pathogen, on diseased stems of Tibouchina urvilleana is reported. Characterisation of this fungus was based on morphology and comparisons of β-tubulin gene sequences. Greenhouse pathogenicity tests, including isolates of H. eucalypti from Eucalyptus spp. in Australia and South Africa, showed that the isolates of H. eucalypti from T. urvilleana were significantly more pathogenic on T. urvilleana than isolates from Eucalyptus.

Heritability of Resistance to Verticillium Wilt in Alfalfa.

Verticillium wilt of alfalfa, caused by Verticillium albo-atrum, may reduce forage yields by up to 50% in alfalfa-producing areas of the northern United States and Canada. It has been suggested that cultivars require at least 60% resistant plants to afford maximum protection against disease. Our objective was to calculate heritability estimates of resistance to Verticillium wilt in alfalfa. Estimates were generated for two alfalfa populations developed from the cvs. Affinity + Z and Depend + EV. Heritability on a half-sib progeny means basis was calculated based on data from greenhouse pathogenicity tests. Estimates based on repeated experiments conducted for single years (2004 and 2005) were high for both populations, ranging from 0.86 to 0.92. The heritability estimate based on data collected over 2 years was 0.26 for Affinity + Z and 0.66 for Depend + EV. Disease was more severe in 2005 than in 2004. However, the Spearman rank correlation between mean disease severity index values for half-sib families over 2 years was positive and significant for both populations. Results of pathogenicity tests suggested that neither cultivar had resistance levels approaching 60%. The heritability estimates suggest that resistance levels in both Affinity + Z and Depend + EV could be improved further through selection.

Soilborne microorganisms of Euphorbia are potential biological control agents of the invasive weed leafy spurge

Leafy spurge ( Euphorbia esula- virgata), a native of Eurasia, is a serious invasive weed of grasslands of the northern Great Plains of the U.S. and prairie provinces of Canada. Leafy spurge is very difficult to control with herbicides, insect biological control agents, and other cultural practices. Previous field investigations revealed pathogen–insect interactions on the roots of leafy spurge leading to mortality. In order to exploit this synergistic relationship as an effective biological control strategy, we undertook an exploration of Europe for soilborne fungi and rhizosphere bacteria on Euphorbia spp. growing in a wide variety of soils in different landscapes. All microbial cultures were screened for growth suppressive or disease potential on leafy spurge plants or callus tissue. Study objectives were to determine relationships of some edaphic factors and host plant conditions with biological control activity, and to screen rhizobacteria isolated from Euphorbia spp. for traits that might contribute to suppression of leafy spurge growth. The most virulent soilborne fungal strains of Fusarium and Rhizoctonia species, based on greenhouse pathogenicity tests, were isolated from roots of Euphorbia spp. with insect feeding damage. High proportions (>50%) of rhizobacteria were classified as deleterious rhizobacteria (DRB) using a callus tissue bioassay. Euphorbia spp. at sites with high DRB numbers displayed severe fungal disease symptoms and supported insect infestations. Selected soil properties were not correlated with potential biocontrol activity of microbes on leafy spurge; however, insect presence and disease ratings were associated with incidence of growth-suppressive microbes. Certain physiological traits (i.e., exopolysaccharides and hydrogen cyanide production) were good indicators of deleterious activity of rhizobacteria. Our study illustrates that the most effective condition for inducing disease and subsequent mortality of leafy spurge includes a synergism between plant-associated microorganisms and root-damaging insects. Furthermore, the results are valuable for identifying sites for collecting soilborne microorganisms on weeds in their native range for evaluation as biocontrol agents in their invasive range.

Characterization of California Isolates of Fusarium oxysporum f. sp. vasinfectum.

Thirty isolates of Fusarium oxysporum f. sp. vasinfectum from California, Australia, China, and the American Type Culture Collection were characterized by partial sequences of translational elongation factor (EF-1α), phosphate permase (PHO), and beta-tubulin (BT) genes, restriction digests of the intergenic spacer (IGS) region of nuclear rDNA, and pathogenicity tests. Based on phylogenetic analysis of combined sequences of EF-1α, PHO, and BT genes, California isolates represented four lineages. Lineage I contained race 3, lineage II contained races 1, 2, and 6, lineage III contained race 8, and lineage IV contained race 4. The Australian isolates formed a strongly supported independent clade. There were nine haplotypes based on restriction digests of the IGS region. In greenhouse pathogenicity tests with California isolates, those from the race 4 lineage were highly aggressive on certain Pima cotton (Gossypium barbadense) cultivars and less aggressive on Upland cotton (Gossypium hirsutum) cultivars. All isolates belonging to the other lineages caused relatively mild symptoms on both Pima and Upland cultivars. This is the first report of the occurrence of races 3, 4, and 8 in California.

Vegetative Compatibility Groups in Cercospora kikuchii, the Causal Agent of Cercospora Leaf Blight and Purple Seed Stain in Soybean

ABSTRACT Nitrogen nonutilizing (Nit) mutants were used to assess vegetative compatibility of 58 isolates of Cercospora kikuchii, 55 of which were isolated from soybean plants in Louisiana. Two isolates were vegetatively self-incompatible. Of 56 self-compatible isolates, 16 were assigned to six multimember vegetative compatibility groups (VCGs), 01 to 06, with 2 or 3 isolates in each VCG. The other 40 isolates each belonged to a distinct VCG. All six multimember VCGs contained isolates from different soy bean cultivars, and three included isolates from different locations. Only one of six multimember VCGs included isolates both from soybean leaves and seed, while the other five included isolates from only leaves or seed. The likelihood of tissue specificity or preference was discussed. All isolates and tested Nit mutants produced cercosporin on potato dextrose agar under light. Significantly different amounts of cercosporin were produced among wild-type isolates, and two Nit mutants produced significantly more cercosporin than their wild-type counterparts. All isolates produced typical Cercospora leaf blight symptoms on soybean plants in greenhouse pathogenicity tests.

Leaf spot on switch grass (Panicum virgatum), symptoms of a new disease caused by Bipolaris oryzae

Switch grass (Panicum virgatum) is a native, perennial warm-season grass used for hay, summer grazing, soil conservation, and wildlife habitat. It is also being developed as a biomass crop for renewable energy. A previously unreported leaf-spot disease on switch grass was observed in North Dakota plantings. From 1999 to 2002, a fungus was consistently isolated from leaf spots on switch grass. It was identified as Bipolaris oryzae (teleomorph: Cochliobolus miyabeanus). Conidial morphology agreed with that of B. oryzae, and comparison of DNA sequences from glyceraldehyde-3-phosphate dehydrogenase also indicated that the isolates were B. oryzae. Greenhouse pathogenicity tests confirmed the ability of B. oryzae to cause symptoms of leaf spot on switch grass. This is the first time that B. oryzae, a common pathogen on rice (Oryza sativa), is reported to cause a disease on switch grass. This pathogen has the potential to diminish yields of switch grass under intensive plantings for high biomass production, particularly if a susceptible cultivar is seeded over a wide area. Additionally, Bipolaris zeae (teleomorph: Cochliobolus zeae) was isolated from switch grass, a new host for this fungus, and is herein reported for the first time from the United States.

Survey of root diseases of wheat and barley in southeastern Idaho

Root diseases of wheat and barley in southeastern Idaho (Intermountain West area of the U.S.A.) have not been extensively studied. Surveys were conducted in 2001 and 2002 to assess root disease severity and to identify soilborne pathogens present in 81 wheat and 52 barley fields in 13 southeastern Idaho counties. Bipolaris sorokiniana and Fusarium culmorum were the most frequent pathogens isolated and also the most virulent in greenhouse pathogenicity tests. Other pathogenic fungi isolated from root lesions included Fusarium spp., Rhizoctonia solani, and Gaeumannomyces graminis var. tritici. Nematode soil assays revealed that 96% of the fields had lesion nematodes (mostly Pratylenchus neglectus) and 78% had stunt nematodes (Tylenchorhynchus spp.). Other nematode species were detected in less than 18% of the fields. The cereal cyst nematode (Heterodera avenae) was found in two fields. Greenhouse experiments with soil cores indicated that disturbing the soil to simulate disking reduced the severity of fusarium root rot. Plant breeders attempting to incorporate resistance to root rot into cereal crops in the Intermountain West should focus on screening with B. sorokiniana and F. culmorum isolates.