Grapevine Yellow Speckle Viroid Research Articles

Occurrence of grapevine yellow speckle viroid 2 and Australian grapevine viroid in Idaho grapevines.

Grapevine yellow speckle viroid 2 (GYSVd-2; Pospiviroidae, Apscaviroid) causes yellow speckle disease in grapevine (Koltunow et al. 1989) and was found in Australia, Iran, Italy, China, and Nigeria (Koltunow et al. 1989; Habili 2017; Zongoma et al. 2018). In the U.S., GYSVd-2 was found in the State of Washington (Vitis vinifera L. cv. Merlot; Alabi et al., 2012). Australian grapevine viroid (AGVd; Pospiviroidae, Apscaviroid) was reported in Australia, Italy, China, Tunisia, Iran, and in the U.S. wine grapes (V. vinifera) (Habili 2017). In the U.S., AGVd was reported from California (Al Rwahnih et al. 2009), from Washington State (V. vinifera cv. Syrah; GU327604), and from the State of New York (an unknown cv. of V. vinifera; KY081960). In Idaho, two other viroids, hop stunt viroid (HSVd; Pospiviroidae, Hostuviroid) and grapevine yellow speckle viroid 1 (GYSVd-1; Pospiviroidae, Apscaviroid), common in grapevines were previously found in wine grapes (Thompson et al. 2019) but neither GYSVd-2 nor AGVd were identified in the same high-throughput sequencing (HTS) outputs. In September 2020, 16 leaf and petiole samples were collected from six vineyards in Canyon and Nez Perce counties of Idaho, representing six different wine grape cultivars and an unknown table grape cultivar, and subjected to HTS analysis. One of the samples was from a table grape plant at the edge of a declining 'Chardonnay' wine grape block that was grown next to a wine tasting room deck for aesthetic, ornamental purposes; the table grape and 'Chardonnay' plants were own-rooted and planted in 1981. Ribodepleted total RNAs prepared from these samples, as described previously, were subjected to a HTS analysis on a NovaSeq platform (Dahan et al. 2023), producing 15,095,042 to 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the V. vinifera, reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Fifteen samples were found infected with HSVd and with GYSVd-1, while one was infected with GYSVd-2 and AGVd; in particular, the table grape plant (arbitrarily designated RBTG) was found infected with all four viroid species. The HTS-derived, 490-nt GYSVd-2-specific contig from the table grape sample represented ∼1.35 genome of the Idaho isolate of GYSVd-2 (GYSVd-2-RBTG) and was 100% identical to the GYSVd-2 sequence JQ686716 from Iran. The HTS-derived, 488-nt AGVd-specific contig represented ∼1.32 genome of the Idaho isolate of AGVd (AGVd-RBTG) and was 100% identical to the AGVd sequence KF876037 from Iran. To validate the HTS data and confirm the presence of the four viroids in the original 16 samples, all of them were subjected to RT-PCR using the viroid-specific primers described by Gambino et al. (2014); all 16 samples were found positive for HSVd and GYSVd-1, and one found positive for AGVd. The RBTG sample was confirmed to be infected with HSVd, GYSVd-1, and AGVd by RT-PCR. GYSVd-2 sequence was not amplified, although primers designed by Gambino et al. (2014) matched the HTS-derived GYSVd-2-RBTG sequence; this may be related to a lower concentration of this viroid in the sample and to properties of the primers. The sampled table grape plant was asymptomatic; all four viroids were apparently not associated with any visible abnormalities in this table grape plant, consistent with the findings that viroids found in grapevines typically do not seem to be associated with visible diseases (Habili 2017).

First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Grapevine Virome of the Don Ampelographic Collection in Russia Has Concealed Five Novel Viruses.

In this study, an analysis of the virome of 51 grapevines from the Don ampelographic collection named after Ya. I. Potapenko (Russia) was performed using high-throughput sequencing of total RNA. A total of 20 previously described grapevine viruses and 4 viroids were identified. The most detected were grapevine rupestris stem pitting-associated virus (98%), hop stunt viroid (98%), grapevine Pinot gris virus (96%), grapevine yellow speckle viroid 1 (94%), and grapevine fleck virus (GFkV, 80%). Among the economically significant viruses, the most present were grapevine leafroll-associated virus 3 (37%), grapevine virus A (24%), and grapevine leafroll-associated virus 1 (16%). For the first time in Russia, a grapevine-associated tymo-like virus (78%) was detected. After a bioinformatics analysis, 123 complete or nearly complete viral genomes and 64 complete viroid genomes were assembled. An analysis of the phylogenetic relationships with reported global isolates was performed. We discovered and characterized the genomes of five novel grapevine viruses: bipartite dsRNA grapevine alphapartitivirus (genus Alphapartitivirus, family Partitiviridae), bipartite (+) ssRNA grapevine secovirus (genus Fabavirus, family Secoviridae) and three (+) ssRNA grapevine umbra-like viruses 2, -3, -4 (which phylogenetically occupy an intermediate position between representatives of the genus Umbravirus and umbravirus-like associated RNAs).

The First Virome of a Russian Vineyard.

Among other pathogens, more than 80 viruses infect grapevine. The aim of this work was to study the virome diversity of grapevine viruses and mycoviruses of a vineyard using high-throughput sequencing technologies. The grapevine virome was studied in symptomatic vines of the Rkatsiteli cultivar (V. vinifera) collected at the vineyards of the Krasnodar Krai in Russia. Ribosomal-depleted total RNA and isolated small RNAs were used for library preparation and high-throughput sequencing. Six grapevine-infecting viruses and two viroids were validated by RT-PCR and analyzed phylogenetically. We identified the presence of grapevine leafroll-associated virus 3, grapevine Pinot gris virus, grapevine virus T, grapevine rupestris stem-pitting-associated virus, grapevine fleck virus, and grapevine rupestris vein feathering virus, as well as two viroids, grapevine yellow speckle viroid 1 and hop stunt viroid. We also studied the mycovirome of the vineyard and identified nine viruses with single-stranded positive-sense RNA genomes: alternaria arborescens mitovirus 1, botrytis cinerea mitovirus 1, botrytis cinerea mitovirus 2, botrytis cinerea mitovirus 3, botrytis cinerea mitovirus 4, sclerotinia sclerotiorum mitovirus 3, botrytis cinerea hypovirus 1, grapevine-associated narnavirus 1, and botrytis virus F. In addition, we identified botrytis cinerea hypovirus 1 satellite-like RNA and two single-stranded negative-sense RNA viruses. This is the first study of grapevine mycoviruses in Russia. The obtained result will contribute to the development of biocontrol strategies in the future.

An Assessment of the Virome of Nigerian Vineyards

The virome of Nigerian vineyards was assessed via diagnostic surveys for viruses and viroids in 40 sites across six states in 2016. Leaf tissues from 360 grapevines were preserved dried under CaCl2. High-throughput sequencing of total RNA extracts from two composite dry leaf samples resulted in the detection of grapevine leafroll-associated virus 1 (GLRaV-1), hop stunt viroid (HSVd), grapevine yellow speckle viroid 1 (GYSVd-1), and GYSVd-2. The incidences and distribution of these agents were assessed via RT-PCR with specific primers and two additional primer pairs targeting grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine red blotch virus (GRBV). Approximately 47% (169/360) of the samples had mixed infections of two to five agents, ∼22% (78/360) had single infections, and ∼31% (113/360) tested negative. HSVd was the most common, with its occurrence in ∼53% (192/360; 39 sites) of samples, followed by GYSVd-2 (∼43%; 155/360; 34 sites), GYSVd-1 (∼33%; 120/360; 26 sites), GLRaV-1 (∼24%; 85/360; 26 sites), and GRSPaV (∼3%; 10/360; 7 sites). All 360 samples were negative for GRBV. In pairwise comparisons, GLRaV-1 isolates from Nigeria shared 97 to 100% nucleotide (nt) and amino acid identities among themselves based on partial HSP70h and complete p24 sequences. The nearly complete genome (18,689 nt) of one GLRaV-1 isolate was determined and it shared 76.5 to 94.5% identity with other fully sequenced GLRaV-1 isolates. The results revealed a simpler virome of Nigerian vineyards and underscore the need to strengthen phytosanitary measures and promote propagation of clean plant materials for vineyard establishment in Nigeria to forestall the introduction of additional viruses and viroids. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

First record of grapevine yellow speckle viroid- 2 infecting grapevines in Pakistan

First record of grapevine yellow speckle viroid- 2 infecting grapevines in Pakistan

A Chronological Study on Grapevine Leafroll-Associated Virus 2 in Australia.

Grapevine leafroll disease affects the health status of grapevines worldwide. Most studies in Australia have focused on grapevine leafroll-associated viruses 1 and 3, while little attention has been given to other leafroll virus types, in particular, grapevine leafroll-associated virus 2 (GLRaV-2). A chronological record of the temporal occurrence of GLRaV-2 in Australia since 2001 is reported. From a total of 11,257 samples, 313 tested positive, with an overall incidence of 2.7%. This virus has been detected in 18 grapevine varieties and Vitis rootstocks in different regions of Australia. Most varieties were symptomless on their own roots, while Chardonnay showed a decline in virus-sensitive rootstocks. An isolate of GLRaV-2, on own-rooted Vitis vinifera cv. Grenache, clone SA137, was associated with severe leafroll symptoms after veraison with abnormal leaf necrosis. The metagenomic sequencing results of the virus in two plants of this variety confirmed the presence of GLRaV-2, as well as two inert viruses, grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine rupestris vein feathering virus (GRVFV). No other leafroll-associated viruses were detected. Among the viroids, hop stunt viroid and grapevine yellow speckle viroid 1 were detected. Of the six phylogenetic groups identified in GLRaV-2, we report the presence of four groups in Australia. Three of these groups were detected in two plants of cv. Grenache, without finding any recombination event. The hypersensitive reaction of certain American hybrid rootstocks to GLRaV-2 is discussed. Due to the association of GLRaV-2 with graft incompatibility and vine decline, the risk from this virus in regions where hybrid Vitis rootstocks are used cannot be overlooked.

First report of grapevine red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) infecting grapevine (Vitis vinifera L.) in Portugal.

Grapevine Red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) are relatively recently described grape viruses that respectively belong to the genera Maculavirus and Marafivirus in the family Tymoviridae [1]. Owing to their rather recent description, still limited information on their biology, on their molecular variability and on their geographic distribution is available. Both viruses are apparently completely or largely asymptomatic in European grapevine and have likely been overlooked in a wide range of situations (Martelli, 2014). According to sequences in GenBank, GRGV has been identified in Asia (Iran, Japan, China), the Americas (USA, Brazil) and Europe (Spain, France, Slovenia, Hungary, Czech Republic and Germany). GRVFV has been reported from the same countries but also in Oceania (New Zealand, Australia) and from a range of other countries including India, Pakistan and South Korea for Asia, Canada for North America and Switzerland, Slovakia, Italy and Russia for Europe. Evidence for the presence of GRGV and GRVFV in grapevine plants from northern Portugal (variety(ies) unknown) was obtained through the bioinformatic analysis [2] of RNASeq Illumina data obtained from phloem scrapings from five grapevine samples collected in different plots in 2016 [3]. Following grapevine genome substraction, contigs assembly and Blast-based contigs annotation using CLC Genomics Workbench, two plants, #4 and #5b, yielded contigs representing near complete GRGV genomes. The plant #4 contig integrated 474 reads (0.15% of reads for an average coverage of 10.1x) while the corresponding values for the contig for plant #5b are 2185 reads (2.4% of total reads) for a coverage of 47.2x. The two GRGV contigs show 91.4% nucleotide (nt) identity and the closest GRGV full genome sequence in GenBank, MZ451067 from Canada, shares respectively 98.9% and 91.6% nt identity with them. The near complete genome contigs have been deposited in GenBank (ON603917 and ON603918). Simultaneously, two near full length genomic contigs for GRVFV were identified from plant #5b and have also been deposited in GenBank (ON603919 and ON603920). These contigs show 84.4% nt identity to each other and were respectively assembled from 4643 (5.2% of total reads) and 5326 reads (6.0% of total reads) for respective average coverages of 102.3x and 117.3x. The closest full GRVFV genome in GenBank is MZ027155 from the USA, with 84.3-85.3% nt identity. Confirmation of the presence of GRVG and GRVFV in the doubly infected plant #5b was achieved by specific RT-PCR assays. A published assay [4] was used for GRGV and primers GRVFV-Cp-F 5'AAYCCTGTCACHCTCCACTG3' and GRVFV-Cp-R 5'TTCATGGTGGTGCCDGTGAG3' (Tm 55°C) were used for GRVFV. The obtained 447nt GRGV amplicon showed a single difference with the HTS contig while the 218 nt GRVFV amplicon showed 3 mutations as compared to one of the HTS contigs. The different grapevines had initially been sampled because they showed relatively poor and stunted growth but besides GRVFV and/or GRGV the HTS analysis indicated that they were also infected by hop stunt viroid, grapevine yellow speckle viroid 1, grapevine rupestris stem pitting virus, plus respectively a novel nepovirus (plant #4) and grapevine leafroll-associated virus 2 and grapevine Pinot gris virus (plant #5b) so that the results reported here do not shed novel light on the potential pathogenicity of GRGV or GRVFV. To the best of our knowledge, this is the first report of GRGV and GRVFV in Portugal.

Diversity of viroids infecting grapevines in the South African Vitis germplasm collection.

Seven viroid species and one putative viroid species have been reported to infect grapevine namely, hop stunt viroid (HSVd), grapevine yellow speckle viroid 1 (GYSVd-1), grapevine yellow speckle viroid 2 (GYSVd-2), Australian grapevine viroid (AGVd), Japanese grapevine viroid (JGVd), grapevine latent viroid (GLVd), and citrus exocortis viroid (CEVd), as well as a grapevine hammerhead viroid-like RNA (GHVd), so far. In this study, RNA sequence (RNA-Seq) data, from 229 Vitis accessions from the field-maintained vineyard of the South African Vitis germplasm collection, were analysed to determine the diversity of the viroids present. Five of the seven known grapevine-infecting viroids and one putative grapevine-infecting viroid species were very commonly found, with 214 of the 229 samples containing at least one viroid species. HSVd, GYSVd-1, GYSVd-2, AGVd, and JGVd, as well as GHVd, were identified in the RNA-Seq data of the samples and confirmed using RT-PCR and Sanger sequencing. The HSVd sequences indicated the presence of two variants, with one showing multiple nucleotide insertions. AGVd and GYSVd-2 did not display significant sequence diversity, confirming past international studies. GYSVd-1 occurs as four major variants worldwide and representatives of all four variants were identified in this vineyard. This is the first report on the diversity of viroids infecting grapevine in South Africa and the first report of JGVd outside of Japan and GHVd in South Africa. Further studies are needed to fully assess the population and to identify potentially new viroid species.

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

First report of Vitis cryptic virus from grapevines in China.

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

Grapevine yellow speckle viroid 2. [Distribution map

Abstract A new distribution map is provided for Grapevine yellow speckle viroid 2. Pospiviroidae: Apscaviroid. Host: grapevine ( Vitis vinifera ). Information is given on the geographical distribution in Africa (Nigeria), Asia (China, Beijing, Shandong, Xinjiang, India, Delhi, Iran, Thailand, Turkey), Europe (Croatia, Greece, Crete, Italy), Oceania (Australia, New South Wales, South Australia, Victoria).

Small RNA Sequencing and Multiplex RT-PCR for Diagnostics of Grapevine Viruses and Virus-like Organisms

Metagenomic approaches used for virus diagnostics allow for rapid and accurate detection of all viral pathogens in the plants. In order to investigate the occurrence of viruses and virus-like organisms infecting grapevine from the Ampelographic collection Kromberk in Slovenia, we used Ion Torrent small RNA sequencing (sRNA-seq) and the VirusDetect pipeline to analyze the sRNA-seq data. The used method revealed the presence of: Grapevine leafroll-associated virus 1 (GLRaV-1), Grapevine leafroll-associated virus 2 (GLRaV-2), Grapevine leafroll-associated virus 3 (GLRaV-3), Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine fanleaf virus (GFLV) and its satellite RNA (satGFLV), Grapevine fleck virus (GFkV), Grapevine rupestris vein feathering virus (GRVFV), Grapevine Pinot gris virus (GPGV), Grapevine satellite virus (GV-Sat), Hop stunt viroid (HSVd), and Grapevine yellow speckle viroid 1 (GYSVd-1). Multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for validation of sRNA-seq predicted infections, including various combinations of viruses or viroids and satellite RNA. mRT-PCR could further be used for rapid and cost-effective routine molecular diagnosis, including widespread, emerging, and seemingly rare viruses, as well as viroids which testing is usually overlooked.

Elimination of Eight Viruses and Two Viroids from Preclonal Candidates of Six Grapevine Varieties (Vitis vinifera L.) through In Vivo Thermotherapy and In Vitro Meristem Tip Micrografting.

Viruses and virus-like organisms are a major problem in viticulture worldwide. They cannot be controlled by standard plant protection measures, and once infected, plants remain infected throughout their life; therefore, the propagation of healthy vegetative material is crucial. In vivo thermotherapy at 36–38 °C for at least six weeks, followed by meristem tip micrografting (0.1–0.2 mm) onto in vitro-growing seedling rootstocks of Vialla (Vitis labrusca × Vitis riparia), was successfully used to eliminate eight viruses (grapevine rupestris stem pitting-associated virus (GRSPaV), grapevine Pinot gris virus (GPGV), grapevine fanleaf virus (GFLV), grapevine leafroll-associated virus 3 (GLRaV-3), grapevine fleck virus (GFkV), grapevine rupestris vein feathering virus (GRVFV), grapevine Syrah virus-1 (GSyV-1), and raspberry bushy dwarf virus (RBDV)), as well as two viroids (hop stunt viroid (HSVd) and grapevine yellow speckle viroid 1 (GYSVd-1)) from preclonal candidates of six grapevine varieties (Vitis vinifera L.). A half-strength MS medium including vitamins supplemented with 30 g/L of sucrose and solidified with 8 g/L of agar, without plant growth regulators, was used for the growth and root development of micrografts and the subsequently micropropagated plants; no callus formation, hyperhydricity, or necrosis of shoot tips was observed. Although the overall regeneration was low (higher in white than in red varieties), a 100% elimination was achieved for all eight viruses, whereas the elimination level for viroids was lower, reaching only 39.2% of HSVd-free and 42.6% GYSVd-1-free vines. To the best of our knowledge, this is the first report of GPGV, GRVFV, GSyV-1, HSVd, and GYSVd-1 elimination through combining in vivo thermotherapy and in vitro meristem tip micrografting, and the first report of RBDV elimination from grapevines. The virus-free vines were successfully acclimatized in rockwool plugs and then transferred to soil.

First Report of Grapevine Virus L Infecting Grapevine in Southeast France.

Grapevine virus L (GVL) is a recently described vitivirus (family Betaflexiviridae) with a positive-sense single-stranded RNA genome. It has so far been reported from China, Croatia, New-Zealand, the United States and Tunisia (Debat et al. 2019; Diaz-Lara et al. 2019; Alabi et al. 2020; Ben Amar et al. 2020). It has significant genetic variability (up to 26% of nucleotide divergence between isolates) and the existence of four phylogroups has been proposed (Alabi et al. 2020). In the frame of a project investigating the possible links between grapevine trunk diseases and grapevine virome, viral high throughput sequencing (HTS)-based testing was performed on symptomatic and asymptomatic grapevines collected in July 2019 in vineyards of four areas in France (Bourgogne, Charentes, Gard, Gironde) corresponding to five cultivars of Vitis vinifera (Cabernet franc, Cabernet Sauvignon, Chardonnay, Sauvignon, Ugni blanc). Total RNAs were purified from powder of 105 trunk wood samples using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, Saint-Quentin-Fallavier, France) and RNA-seq libraries were prepared using Zymo-Seq RiboFree Total RNA Library Prep Kit (Ozyme, Saint Cyr l'Ecole, France). HTS was performed on a S4 lane of Illumina NovaSeq 6000 using a paired-end read length of 2x150 bp. The trimmed sequence reads obtained from Chardonnay plants CH30-75M (99.9 M) and CH37-19S (114 M) from a vineyard in Gard were analyzed using CLC Genomics Workbench v21 (Qiagen, Courtaboeuf, France) and revealed complex mixed infections. Besides contigs representing a complete GVL genome (average scaffold coverage: 6,197x and 2,970x, respectively), contigs from grapevine rupestris stem pitting virus (1,697x ; 1,124x), grapevine virus A (82x ; 95x), grapevine pinot gris virus (1,475x ; 866x), grapevine leafroll-associated virus 3 (5,122x ; 1,042x), hop stunt viroid (13,783x ; 29,514x) and grapevine yellow speckle viroid 1 (690x ; 1158x) were also identified. Plant CH37-19S was also co-infected by grapevine rupestris vein feathering virus (164x). The GVL contigs integrated respectively 320,000 and 152,000 reads (corresponding to 0.32% and 0.11% of filtered/trimmed reads, respectively). The GVL genomic sequences from each sample (7,616 nt) have been deposited in GenBank (Accession nos. OK042110 and OK042111, respectively). The two contigs are nearly identical (99.9% nt identity) and share respectively 97.5% and 95.9% with GVL-KA from the USA (MH643739) and GVL-RS from China (MH248020), the closest isolates present in GenBank. To confirm the presence of GVL, the original grapevines were resampled in the field and total RNAs were extracted as described above from cambial scrappings and leaves. Total RNAs were used for RT-PCR tests using primers targeting a 279-bp fragment corresponding to the 3' end of the coat protein gene and part of the nucleic acid binding protein gene (Debat et al. 2019). The Sanger-derived sequences from the amplicons shared 100% nt identities with the corresponding sequences of the HTS assembled genomes, confirming the presence of GVL in both tissues of both grapevine samples. To our knowledge, this represents the first report of the occurrence of GVL in vineyards in France. Given the complex mixed infection present in the two analyzed grapevines, no conclusions can be drawn on the pathogenicity of GVL. Further efforts are needed to better understand GVL distribution and its potential pathogenicity to grapevine. References Alabi, O J., et al. 2020. Arch. of Virol. 165:1905-1909. Ben Amar, A., et al. 2020. Plant disease 104:3274. Debat, H., et al. 2019. Eur J Plant Pathol. 155:319. Diaz-Lara, A., et al. 2019. Arch. of Virol. 164:2573. Acknowledgments The authors are grateful to the "Plan National Dépérissement du Vignoble" (Mycovir project) for the financial support.

The first report of grapevine yellow speckle viroid 2 in Korea

The first report of grapevine yellow speckle viroid 2 in Korea

First Report of Grapevine Kizil Sapak Virus in Grapevine in China.

Grapevine Kizil Sapak virus (GKSV) is a novel member of the family Betaflexiviridae classified into the proposed genus Fivivirus within the subfamily Trivirinae. It was first discovered in USA from a grapevine originating from Turkmenistan (Al Rwahnih et al. 2019) and later in France from a grapevine accession from Iran (Marais et al. 2020). In October 2019, an asymptomatic grapevine cv. 'Crimson Seedless' (native to USA) was collected from Xinjiang province in China and analyzed by high-throughput sequencing (HTS). Ribosome-depleted RNA preparations were used for library synthesis followed by HTS on an Illumina HiSeq X-ten platform. A total of 29,141,024 cleaned reads were obtained, and 7,878 contigs were generated using CLC Genomics Workbench 9.5 (QIAGEN). One long contig (7,328 bp) showed 88.2% nucleotide (nt) identity with the sequence of GKSV-127 (MN172165) via Blastx, with an average coverage of 284-X. Bioinformatic analysis of the remaining contigs showed the presence of Grapevine leafroll-associated virus 4, Grapevine rupestris vein feathering virus, Grapevine fabavirus, grapevine yellow speckle viroid-1 (GYSVd-1), GYSVd-2 and Hop stunt viroid in the sample. The presence of GKSV was checked by RT-PCR using the primer GKSV-F/R (Al Rwahnih et al. 2019); the 1,240 bp PCR product was cloned using a pTOPO-T vector (Aidlab, China) and sequenced. In pairwise comparison, the obtained nt sequences shared 92.6 to 95.2% identity to the corresponding HTS sequence, confirming the presence of GKSV in the sample. The complete GKSV genome sequence was obtained as two pieces of overlapping DNA sequence using primers GKSV-20A/20B (5'-TAGTCTGGATTTCCCTACCT/5'-CTCCCTAAACTGATTTGATG) and GKSV-25A/25B (5'-GCCACTGGTGAATGAAAAGA/5'-CTAAATGAATGGGCAGGTAT) designed based on the HTS-generated sequence. The 5' and 3' termini were determined by rapid amplification of cDNA ends using SMARTer RACE 5'/3' Kit (Takara, Dalian, China). The complete genome of GKSV isolate CS (MW582898) comprised 7,604 nt (without the polyA tail) and shared 77.8 to 89.2% identities with the other nine reported GKSV isolates, among which it shared the highest nt identity (89.2%) with GKSV-127. In phylogenetic analysis based on complete or nearly complete genome sequences of representative members of Betaflexiviridae, GKSV-CS clustered with the nine known GKSV isolates, forming a subclade with GKSV-127 (Supplementary Fig. 1). To determine the incidence and distribution of GKSV in China, 476 grapevine samples of 75 cultivars were collected from 20 provinces and tested by RT-PCR using primers GKSV-F/R (Al Rwahnih et al. 2019) and Vini-F1/R1 (Marais et al. 2020). The results showed that 0.42% (2 of 476) of the samples tested positive with both primers, including samples GKSV-CS and a 'Black Monukka' grape (native to India) also sampled from Xinjiang. Both PCR products of 'Black Monukka' were cloned and sequenced (MZ311588 to MZ311602) and they showed 85.1 to 88.9% nt identities to the GKSV-CS sequence. This is the first report of GKSV infecting grapevine in China. Although the pathogenicity of GKSV is yet to be determined, it has been found in several countries such as USA (Al Rwahnih et al. 2019), France (Marais et al. 2020) and China (this study). Both positive samples in this study were collected from Nanjiang region in Xinjiang province, indicating the sporadic occurrence of GKSV in this area.

High-Throughput Sequencing of Small RNAs for Diagnostics of Grapevine Viruses and Viroids in Russia.

The use of high-throughput sequencing (HTS) technology has led to significant progress in the identification of many viruses and their genetic variants. In this study, we used the HTS platform to sequence small RNAs (sRNAs) of grapevine to study the virome. Isolation of RNA was performed using symptomatic grapevines collected from commercial vineyards in Krasnodar Krai in 2017–2018. To determine the viromes of vineyards, we used an integrated approach that included a bioinformatic analysis of the results of sRNA HTS and the molecular method RT-PCR, which made it possible to identify 13 viruses and 4 viroids. Grapevine leafroll-associated virus 4 (GLRaV-4), Grapevine Syrah Virus-1 (GSyV-1), Raspberry bushy dwarf virus (RBDV), Australian grapevine viroid (AGVd), and Grapevine yellow speckle viroid 2 (GYSVd-2) were identified for the first time in Russia. Out of 38 samples analyzed, 37 had mixed infections with 4–11 viruses, indicating a high viral load. Analysis of the obtained sequences of fragments of virus genomes made it possible to identify recombination events in GLRaV-1, GLRaV-2, GLRaV-3, GLRaV-4, GVT, GPGV, GRSPaV, GVA, and GFLV. The obtained results indicate a wide spread of the viruses and a high genetic diversity in the vineyards of Krasnodar Krai and emphasize the urgent need to develop and implement long-term strategies for the control of viral grapevine diseases.

First report of Grapevine yellow speckle viroid 1 infecting grapevine (Vitis vinifera L.) in Canada.

Quebec is the third largest wine grape producer in Canada in acreage, tonnage, and wine grape sales (Carisse et al. 2017; Ben Moussa et al. 2019). To evaluate the diversity of viruses infecting grapevine in Quebec, a total of 77 leaf tissue samples (cv. Vidal) were collected from July to October in 2020 in three different vineyards located in Frelighsburg, Hemmingford and Saint-Jacques-le-Mineur in Quebec, Canada. Double-stranded RNA was extracted from each sample and used for cDNA library preparation with the Nextera XT DNA Library Preparation Kit (Illumina) as described previously (Kesanakurti et al. 2016). High-throughput sequencing (HTS, 2x300 bp) was conducted on dual-indexed libraries in a v3 flow cell using the Illumina MiSeq platform (Adkar-Purushothama et al. 2020). The obtained raw FASTQ data was de-multiplexed into 154 separate sequence files, and the adapters and barcode sequences were trimmed. The quality of the sequences was verified using Trimmomatic V.0.32 and the "clean" sequences were analyzed using Virtool and VirFind virus detection pipelines described elsewhere (Ho and Tzanetakis 2014; Rott et al. 2017) to screen for all possible viruses in the databases. Over 100,000 reads per sample were obtained with a percentage of mapped viral reads ranging from 1.47 to 19.43% of total number of reads. Out of 77 samples, 16 revealed the sequence of grapevine yellow speckle viroid 1 (GYSVd-1), for which the length coverage ranged from 98.5 to 99.1%; the depth ranged from 2X to 856X. The GYSVd-1 positive sequence files were subjected to whole genome assembly on CLC genomics Workbench v20.0.4 with the isolate SY-BR from Brazil (KU880715) used as reference. Seven complete genomes of GYSVd-1 of 366-368 nucleotides (nt) in size were deposited (GenBank Acc. MW732682 to MW732688). BLASTN analysis of the sequences showed 98-100% nt identities with isolate SY-BR. Other viruses and viroids such as Grapevine fleck virus, Grapevine rupestris stem pitting-associated virus, Grapevine rupestris vein feathering virus and Hop stunt viroid were also detected. To confirm GYSVd-1 presence in Quebec vineyards, seven of the 16 HTS-positive grapevine leaf tissue samples were subjected to total RNA extraction, followed by RT-PCR assay as before (Adkar-Purushothama et al. 2015; Sahana et al. 2013); all were positive by RT-PCR. The PCR products were directly Sanger-sequenced, and they showed 100% nt identity to the HTS derived sequences. Three of the seven GYSVd-1 positive grapevines exhibited yellow leaf spots and flecks and tiny yellow leaves, but their mixed infection status makes definitive symptoms association difficult to determine. Previously, Hop stunt viroid was reported from grapevines in Canada (Xiao et al. 2019; Fall et al. 2020) but to the best of our knowledge, this is the first report of GYSVd-1 infecting grapevines in Canada, specifically in the province of Quebec. Further research is required to assess the GYSVd-1 related yield loss. Monitoring and testing for GYSVd-1 infection is necessary to prevent propagation of infected materials, spread, and potential negative impact for the Canadian grapevine industry.

First report of grapevine yellow speckle viroid-1 infecting grapevines in Pakistan

First report of grapevine yellow speckle viroid-1 infecting grapevines in Pakistan