Grapevine Rupestris Stem Pitting-associated Virus Research Articles

First report of grapevine asteroid mosaic-associated virus in grapevines in China.

Grapevine asteroid mosaic-associated virus (GAMaV), a member of the genus Marafivirus of the family Tymoviridae, was first described to infect grapevines in California (Abou Ghanem-Sabanadzovic et al. 2003). Since then, GAMaV has been reported from Greece, Japan, Canada, Uruguay, France, Hungary, Italy, Spain, Switzerland and Russia, and also in some free-living grapevines in North America (Kyriakopoulou, 1991; Morán et al., 2021; Reynard et al., 2022; Shvets et al., 2022; Thompson et al., 2021). GAMaV may be associated with grapevine asteroid mosaic disease (Martelli 2014). In August 2022, a grapevine cv. Cabernet Sauvignon exhibiting chlorotic mottling was collected in Ningxia, China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNAs were then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting in 39,297,567 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (GenBank accession no PN40024) were removed using hisat2 2.1.0 software. The 15,003,158 unmapped reads were de novo assembled into 70,512 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters and analyzed through BLASTn and BLASTx analysis. Five viruses and two viroids were identified: GAMaV (5 contigs), grapevine Pinot gris virus (3 contigs), grapevine berry inner necrosis virus (3 contigs) , grapevine rupestris stem pitting-associated virus (4 contigs), grapevine red globe virus (2 contigs), grapevine yellow speckle 1 viroid (4 contigs) and hop stunt viroid (3 contigs). The five contigs of GAMaV were 352 nt~2, 224 nt in length, which were assembled from 3, 308 reads and shared 85.56%~91.81% nt identity with the genome of the GAMaV isolate GV30 (KX354202) with 93.3% coverage. To further confirm the infection of GAMaV, we designed two pairs of primers, GAMaV-mel1a/1b (5'-CACCTCGCCCCCTACCTTGAC-3'/5'-AAGAGGACGCCTTTGCGGGAG-3') and GAMaV-cp1a/1b (5'-CTAGCGACGACCGCACTGATC-3'/5'-GTCGGTGTACGAGATTTGGTC-3'), which were used to amplify the 329-bp and 440-bp fragments in the helicase (Hel) domain and coat protein (CP) gene of GAMaV genome in RT-PCR, respectively. The amplified PCR products were cloned and sequenced and the two sequences (OQ676951 and OQ676958) showed 91.2% and 93.4% nt identity with the isolate GV30, respectively. Furthermore, 429 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using the above primer pairs. The results showed that 1.4% (6/429) of the samples tested positive, including one 'Autumn seedless' grapevine (Liaoning province), two 'Dawuhezi' (Liaoning), one 'Cabernet Gernischt' (Liaoning) and two 'Cabernet Sauvignon' (Tianjing and Shandong respectively). The partial sequences of the Hel domain (OQ676952-57) and CP gene (OQ676959-61) obtained from the positive samples by sequencing showed 89.1% to 84.5% and 93.6% to 93.9% nt identity with the isolate GV30, respectively. Because these GAMaV-positive grapevines did not show distinct symptoms, GAMaV pathogenicity remains challenging to confirm. This is the first report of GAMaV in grapevines in China, extending the information on its geographical distribution.

Grapevine Virome of the Don Ampelographic Collection in Russia Has Concealed Five Novel Viruses.

In this study, an analysis of the virome of 51 grapevines from the Don ampelographic collection named after Ya. I. Potapenko (Russia) was performed using high-throughput sequencing of total RNA. A total of 20 previously described grapevine viruses and 4 viroids were identified. The most detected were grapevine rupestris stem pitting-associated virus (98%), hop stunt viroid (98%), grapevine Pinot gris virus (96%), grapevine yellow speckle viroid 1 (94%), and grapevine fleck virus (GFkV, 80%). Among the economically significant viruses, the most present were grapevine leafroll-associated virus 3 (37%), grapevine virus A (24%), and grapevine leafroll-associated virus 1 (16%). For the first time in Russia, a grapevine-associated tymo-like virus (78%) was detected. After a bioinformatics analysis, 123 complete or nearly complete viral genomes and 64 complete viroid genomes were assembled. An analysis of the phylogenetic relationships with reported global isolates was performed. We discovered and characterized the genomes of five novel grapevine viruses: bipartite dsRNA grapevine alphapartitivirus (genus Alphapartitivirus, family Partitiviridae), bipartite (+) ssRNA grapevine secovirus (genus Fabavirus, family Secoviridae) and three (+) ssRNA grapevine umbra-like viruses 2, -3, -4 (which phylogenetically occupy an intermediate position between representatives of the genus Umbravirus and umbravirus-like associated RNAs).

A NitroPure Nitrocellulose Membrane-Based Grapevine Virus Sampling Kit: Development and Deployment to Survey Japanese Vineyards and Nurseries.

We developed a NitroPure Nitrocellulose (NPN) membrane-based method for sampling and storing grapevine sap for grapevine virus detection. We devised an efficient nucleic acid extraction method for the NPN membrane, resulting in 100% amplification success for grapevine leafroll-associated virus 2 (GLRaV2) and 3 (GLRaV3), grapevine rupestris stem pitting-associated virus (GRSPaV), grapevine virus A, grapevine virus B, and grapevine red blotch virus (GRBV). This method also allowed the storage of recoverable nucleic acid for 18 months at room temperature. We created a sampling kit to survey GLRaV2, GLRaV3, and GRBV in Japanese vineyards. We tested the kits in the field in 2018 and then conducted mail-in surveys in 2020-2021. The results showed a substantial prevalence of GLRaV3, with 48.5% of 132 sampled vines being positive. On the other hand, only 3% of samples tested positive for GLRaV2 and none for GRBV.

Molecular and Metagenomic Analyses Reveal High Prevalence and Complexity of Viral Infections in French-American Hybrids and North American Grapes.

French-American hybrids and North American grape species play a significant role in Canada's grape and wine industry. Unfortunately, the occurrence of viruses and viral diseases among these locally important non-vinifera grapes remains understudied. We report here the results from a large-scale survey to assess the prevalence of 14 viruses among 533 composite samples representing 2665 vines from seven French-American hybrid wine grape cultivars, two North American juice grape cultivars (Concord and Niagara), and the table grape cultivar Sovereign coronation. Based on reverse transcription polymerase chain reaction (RT-PCR) assays, ten viruses were detected. Grapevine rupestris stem pitting-associated virus, grapevine leafroll-associated virus 3, grapevine Pinot gris virus and grapevine red blotch virus were detected with the highest frequency. As expected, mixed infections were common; 62% of the samples contained two or more viruses. Overall, hybrid wine grapes were infected with more viruses and a higher prevalence of individual viruses than juice and table grapes. To validate these findings and to refine the virome of these non-European grapes, high-throughput sequencing (HTS) analyses of five composite samples representing each category of grapevine cultivars was performed. Results from HTS agreed with those from RT-PCR. Importantly, Vidal, a widely grown white-wine grape with international recognition due to its use in the award-winning icewine, is host to 14 viruses, four of which comprise multiple and distinct genetic variants. This comprehensive survey represents the most extensive examination of viruses among French-American hybrids and North American grapes to date.

An Assessment of the Virome of Nigerian Vineyards

The virome of Nigerian vineyards was assessed via diagnostic surveys for viruses and viroids in 40 sites across six states in 2016. Leaf tissues from 360 grapevines were preserved dried under CaCl2. High-throughput sequencing of total RNA extracts from two composite dry leaf samples resulted in the detection of grapevine leafroll-associated virus 1 (GLRaV-1), hop stunt viroid (HSVd), grapevine yellow speckle viroid 1 (GYSVd-1), and GYSVd-2. The incidences and distribution of these agents were assessed via RT-PCR with specific primers and two additional primer pairs targeting grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine red blotch virus (GRBV). Approximately 47% (169/360) of the samples had mixed infections of two to five agents, ∼22% (78/360) had single infections, and ∼31% (113/360) tested negative. HSVd was the most common, with its occurrence in ∼53% (192/360; 39 sites) of samples, followed by GYSVd-2 (∼43%; 155/360; 34 sites), GYSVd-1 (∼33%; 120/360; 26 sites), GLRaV-1 (∼24%; 85/360; 26 sites), and GRSPaV (∼3%; 10/360; 7 sites). All 360 samples were negative for GRBV. In pairwise comparisons, GLRaV-1 isolates from Nigeria shared 97 to 100% nucleotide (nt) and amino acid identities among themselves based on partial HSP70h and complete p24 sequences. The nearly complete genome (18,689 nt) of one GLRaV-1 isolate was determined and it shared 76.5 to 94.5% identity with other fully sequenced GLRaV-1 isolates. The results revealed a simpler virome of Nigerian vineyards and underscore the need to strengthen phytosanitary measures and promote propagation of clean plant materials for vineyard establishment in Nigeria to forestall the introduction of additional viruses and viroids. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

High-Throughput Sequencing of Grapevine in Mexico Reveals a High Incidence of Viruses including a New Member of the Genus Enamovirus.

This is the first viral metagenomic analysis of grapevine conducted in Mexico. During the summer of 2021, 48 plants displaying virus-like symptoms were sampled in Queretaro, an important grapevine-producing area of Mexico, and analyzed for the presence of viruses via high-throughput sequencing (HTS). The results of HTS were verified by real-time RT-PCR following a standardized testing scheme (Protocol 2010). Fourteen different viruses were identified, including grapevine asteroid mosaic-associated virus (GAMaV), grapevine Cabernet Sauvignon reovirus (GCSV), grapevine fanleaf virus (GFLV), grapevine fleck virus (GFkV), grapevine Pinot gris virus (GPGV), grapevine red globe virus (GRGV), grapevine rupestris stem pitting-associated virus (GRSPaV), grapevine rupestris vein feathering virus (GRVFV), grapevine Syrah virus 1 (GSyV-1), grapevine virus B (GVB), and grapevine leafroll-associated viruses 1, 2, 3, 4 (GLRaV1, 2, 3, 4). Additionally, divergent variants of GLRaV4 and GFkV, and a novel Enamovirus-like virus were discovered. This is the first report of GAMaV, GCSV, GLRaV4, GPGV, GRGV, GRVFV, and GSyV-1 infecting grapevines in Mexico; the impact of these pathogens on production is unknown.

Metaviromic Characterization of Betaflexivirus Populations Associated with a Vitis cultivar Collection in South Africa.

South Africa is associated with a centuries-old viticultural industry, accompanied by a diverse range of wine and table grape cultivars and an extensive history of pervasive introductions of vine material and associated viruses. The Vitis D2 collection in Stellenbosch represents the most comprehensive collection of Vitis species, hybrids, and cultivars in South Africa. We collected leaf petiole material from 229 accessions from this collection. Our metaviromic analyses revealed a total of 406 complete/near complete genomes of various betaflexiviruses. Among these, we identified the presence of grapevine rupestris stem pitting-associated virus and grapevine viruses A, B, E, F, H (GVH), I (GVI), and M (GVM). Notably, this study marks the first report of GVH, GVI, and GVM in South Africa, which were confirmed via RT-PCR. This research significantly contributes to our understanding of viral diversity and introductions in South African viticulture and emphasizes the need for vigilant monitoring and management of viral infections. Our findings lay the groundwork for strategies that mitigate the impact of viruses on South Africa's wine industry, which generates an annual revenue of approximately 500 million USD.

A Chronological Study on Grapevine Leafroll-Associated Virus 2 in Australia.

Grapevine leafroll disease affects the health status of grapevines worldwide. Most studies in Australia have focused on grapevine leafroll-associated viruses 1 and 3, while little attention has been given to other leafroll virus types, in particular, grapevine leafroll-associated virus 2 (GLRaV-2). A chronological record of the temporal occurrence of GLRaV-2 in Australia since 2001 is reported. From a total of 11,257 samples, 313 tested positive, with an overall incidence of 2.7%. This virus has been detected in 18 grapevine varieties and Vitis rootstocks in different regions of Australia. Most varieties were symptomless on their own roots, while Chardonnay showed a decline in virus-sensitive rootstocks. An isolate of GLRaV-2, on own-rooted Vitis vinifera cv. Grenache, clone SA137, was associated with severe leafroll symptoms after veraison with abnormal leaf necrosis. The metagenomic sequencing results of the virus in two plants of this variety confirmed the presence of GLRaV-2, as well as two inert viruses, grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine rupestris vein feathering virus (GRVFV). No other leafroll-associated viruses were detected. Among the viroids, hop stunt viroid and grapevine yellow speckle viroid 1 were detected. Of the six phylogenetic groups identified in GLRaV-2, we report the presence of four groups in Australia. Three of these groups were detected in two plants of cv. Grenache, without finding any recombination event. The hypersensitive reaction of certain American hybrid rootstocks to GLRaV-2 is discussed. Due to the association of GLRaV-2 with graft incompatibility and vine decline, the risk from this virus in regions where hybrid Vitis rootstocks are used cannot be overlooked.

Early detection of grapevine graft incompatibility: Insights into translocated and virus-induced incompatibility

In vineyards to control phylloxera (Daktulosphaira vitifolia Ficth) attacks in Vitis vinifera L., heterografted vines are planted using American vines hybrids as rootstocks. However, graft incompatibilities can affect grape yield and plant longevity. Thus, to identify early graft incompatibility factors, we established in vitro micrografting protocols coupled with histology and histochemistry analysis in grapevine graft combinations of known compatibility behavior. The histochemical characterization of the graft union revealed irregular cell arrangement, slower vascular differentiation, persistence of the necrotic layer, accumulation of starch, and lower differentiation of phloem cells in hetero- compared to homografts, indicating the presence of translocated incompatibility symptoms. We highlight the utility of evaluating the graft interface cellular arrangement and starch content via calcofluor and I2KI staining, respectively, as allowed to identify the graft combinations with lower graft success. Wounded and grafted Syrah plantlets pointed out an impaired sucrose distribution in these plants and levels of Grapevine Rupestris Stem Pitting associated Virus (GRSPaV) infections correlated with graft (un)-success in two Syrah clones micrografted onto 110-Ritcher rootstock. Furthermore, silencing GRSPaV before grafting increased graft success rates. We propose that grapevine graft incompatibility is mainly a virus-induced phenomenon that can arise even in certified plants.

Genome Sequences of Two Grapevine Rupestris Stem Pitting-Associated Virus Variants from Vitis vinifera cv. Riesling in Idaho, USA.

We report the genome sequences of two genetic variants of grapevine rupestris stem pitting-associated virus (GRSPaV) from Idaho, USA. The coding-complete, positive-strand RNA genome of 8,700 nucleotides contains six open reading frames characteristic of foveaviruses. The two Idaho genetic variants belong to GRSPaV phylogroup 1.

Occurrence of Nine Grapevine Viruses in Commercial Vineyards of Mendoza, Argentina

Grapevine is a widely grown fruit crop that is seriously affected by different viruses, reducing grape yield and quality, as well as threatening profitability. Vineyard disease management requires accurate identification of viral infections. This study aimed to survey the presence of ten grapevine viruses in four geographic sites in the Mendoza province of Argentina. Two hundred twenty-three composite cane samples from 1060 plants of six cultivars were collected from 26 blocks distributed across 11 vineyards. The cane samples were screened by RT-PCR for the following viruses: grapevine leafroll-associated viruses 1-4 (GLRaV 1, 2, 3, and 4), grapevine fanleaf virus (GFLV), grapevine fleck virus (GFkV), grapevine virus A (GVA) and B (GVB), grapevine rupestris stem pitting associated virus (GRSPaV), and arabis mosaic virus (ArMV). The results showed an uneven occurrence of viruses through the sampled regions, with GRSPaV being prevalent (71.1%), followed by GFLV (28.9%), GFkV (20.6%), and GLRaV-2 (14.7%). GVB was not detected. This study revealed a moderate prevalence of viruses associated with economically impactful diseases in the vineyards surveyed.

First report of Grapevine red globe virus in grapevine in the United Kingdom

In August 2019 a sample of grapevine (Vitis sp.) leaves was submitted to Fera Science Ltd. from a vineyard in the south of England. The sample was sent following the appearance of an unknown disease. Symptoms included red colouration and flecking (Figures 1, 2). The sample was tested by DAS-ELISA for the presence of Arabis mosaic virus (DSMZ, Germany), Raspberry ringspot virus (DSMZ, Germany), Strawberry latent ringspot virus, Tobacco ringspot virus (Agdia, USA), Tomato black ring virus (DSMZ, Germany and Bioreba, Switzerland), Tomato ringspot virus (Loewe, Germany), and plate trap ELISA for potyviruses using a generic potyvirus antisera (DSMZ, Germany). The sample gave negative results for all tests. The sample was then tested by high throughput sequencing (HTS) on a MiSeq Sequencer (Illumina, UK) (Fowkes et al., 2021). The total number of reads for the sample was 342,422 with 5 (0.001%) being mapped to the genome of Grapevine red globe virus (GRGV, genus Maculavirus). The sequence contig of 217 nt obtained by HTS was checked by nucleotide comparison through BLAST against publicly available sequences. The partial sequence of the replicase gene had 94% identity to a GRGV sequence (GenBank Accession No. MZ451066.1), a historical isolate sequenced from the Sidney live plant collection, country of origin unknown (Mike Rott, CFIA, Pers. Comm.). The genome fragment of GRGV was uploaded to GenBank (ON187032). Sequencing data has been submitted to the NCBI short read archive, BioProject (PRJNA817416). Other grapevine viruses were also inferred from the sequence data, namely Grapevine rupestris stem pitting-associated virus (genus Foveavirus, ON187034) and Grapevine fleck virus (genus Maculavirus, ON187033). In each case these have been previously reported from the UK (Silva et al., 2017). To further confirm infection by GRGV, the sample was tested by RT-PCR using primers specific for GRGV (Ruiz-Garcia et al., 2018). A product of 418 bp was obtained (ON187031). The product was analysed by Sanger sequencing (MWG GmbH, Germany) and checked by nucleotide sequence comparison against sequences publicly available through BLAST. The sequence had 95% identity to the sequence of a GRGV isolate from Washington State, USA (MT749359.1). GRGV was first reported in Italy (Sabanadzovic et al., 2000) and has since been found in China, Croatia, France, Germany, Greece, Iran, Slovenia, Spain and the USA (Nourinejhad Zarghani et al., 2021; EPPO Global database, 2022). No specific symptoms have been associated with GRGV (Ruiz-Garcia et al., 2018), and as the detection of GRGV was in co-infection with other viruses, no conclusion can be drawn on the cause of the observed symptoms. To our knowledge this is the first report of GRGV in the UK. This suggests a broader distribution than previously reported and indicates the need for further surveillance of grapevine to establish current distribution. This work was funded under the Defra-Fera Long Term Service Agreement.

Raman Spectroscopy Applications in Grapevine: Metabolic Analysis of Plants Infected by Two Different Viruses.

Grapevine is one of the most cultivated fruit plant among economically relevant species in the world. It is vegetatively propagated and can be attacked by more than 80 viruses with possible detrimental effects on crop yield and wine quality. Preventive measures relying on extensive and robust diagnosis are fundamental to guarantee the use of virus-free grapevine plants and to manage its diseases. New phenotyping techniques for non-invasive identification of biochemical changes occurring during virus infection can be used for rapid diagnostic purposes. Here, we have investigated the potential of Raman spectroscopy (RS) to identify the presence of two different viruses, grapevine fan leaf virus (GFLV) and grapevine rupestris stem pitting-associated virus (GRSPaV) in Vitis vinifera cv. Chardonnay. We showed that RS can discriminate healthy plants from those infected by each of the two viruses, even in the absence of visible symptoms, with accuracy up to 100% and 80% for GFLV and GRSPaV, respectively. Chemometric analyses of the Raman spectra followed by chemical measurements showed that RS could probe a decrease in the carotenoid content in infected leaves, more profoundly altered by GFLV infection. Transcriptional analysis of genes involved in the carotenoid pathway confirmed that this biosynthetic process is altered during infection. These results indicate that RS is a cutting-edge alternative for a real-time dynamic monitoring of pathogens in grapevine plants and can be useful for studying the metabolic changes ensuing from plant stresses.

Virus and Virus-like Pathogens in the Grapevine Virus Collection of Croatian Autochthonous Grapevine Cultivars.

Grapevine collections play an important role, especially in the study of viruses and virus-like pathogens. In 2009, after an initial ELISA screening for eight viruses (arabis mosaic virus, grapevine fanleaf virus, grapevine fleck virus, grapevine leafroll-associated viruses 1, 2, and 3, and grapevine viruses A and B), a collection of 368 grapevine accessions representing 14 different Croatian autochthonous cultivars and containing single or mixed infection of viruses was established to further characterize the viral pathogens. Subsequently, Western blot, RT-PCR, cloning, and sequencing revealed that grapevine rupestris stem pitting-associated virus was frequently found in accessions of the collection, with isolates showing substantial genetic diversity in the helicase and coat protein regions. High-throughput sequencing of 22 grapevine accessions provides additional insight into the viruses and viroids present in the collection and confirms the fact that Croatian autochthonous grapevine cultivars have high infection rates and high virome diversity. The recent spread of “flavescence dorée” phytoplasma in Europe has not spared the collection. After the first symptoms observed in 2020 and 2021, the presence of phytoplasma was confirmed by LAMP in six grapevine accessions and some of them were lost. Single or multiple viruses and viroids, as well as own rooted grapevines in the collection, make the plants susceptible to various abiotic factors, which, together with the recent occurrence of “flavescence dorée”, makes the maintenance of the collection a challenge. Future efforts will be directed towards renewing the collection, as 56% of the original collection has been lost in the last 13 years.

First Report of Grapevine Polerovirus 1 in Grapevine in China.

Xinjiang Uygur Autonomous Region is the largest grape-producing area in China, with a grape output of 3.05 million tons in 2020, accounting for nearly 20% of the total grape output in China (National Bureau of Statistics, 2021). Viral disease is a major factor threatening the grape industry and results in large economic losses by affecting the quality of grapes and wines. Actually, nearly 80 different viruses have been recorded in grapevine (Fuchs, 2020). To identify viruses that infect grapevine in Xinjiang, leaves of four vines of cultivar Cabernet Sauvignon with symptoms of chlorotic spots and crinkling were collected from a vineyard at Shihezi University in Shihezi City in May 2019 and pooled for total RNA extraction (Invitrogen™ PureLink ® Plant RNA Reagent, USA). After ribodepletion, a cDNA library was prepared using the Ribo-ZeroTM Kit (Illumina, San Diego, USA) and subjected to high-throughput sequencing (HTS) on the Illumina NovaSeq 6000 platform (Novogene, China). In total, 41,799,420 paired-end reads (150 nt × 2) were obtained after performing quality control using Trimmomatic version 0.39 (Bolger et al., 2014). These reads were de novo assembled into 154,716 contigs using the rnaSPAdes method in SPAdes software with default parameters (Bankevich et al., 2012). BLASTn analysis of these contigs led to the identification of 59 viral-related contigs from 248 -18476 bp. These contigs belonged to six positive-stranded RNA viruses, namely, grapevine polerovirus 1 (GPoV-1; 2 contigs), grapevine berry inner necrosis virus (GBINV; 4 contigs), grapevine leafroll-associated virus 3 (GLRaV-3; 2 contigs), grapevine Pinot gris virus (GPGV; 3 contigs), grapevine rupestris stem pitting-associated virus (GRSPaV; 4 contigs), and grapevine fleck virus (GFkV; 17 contigs); one DNA virus, grapevine geminivirus A (GGVA; 2 contigs); and one viroid, Australian grapevine viroid (AGVd; 1 contig). Among them, GPoV-1 is a newly discovered grape-infecting virus that has recently been reported from Japan and France (Candresse et al., 2020; Chiaki and Ito, 2020). The two contigs of GPoV-1 were assembled manually into a 5627-nt scaffold that covers 99.6% of the genome of the reference GPoV-1 isolate (MT008025). The scaffold shared 98.5% and 98.2% nucleotide (nt) sequence identities with the French GPoV-1 isolate KT (MT008025) and the Japanese GPoV-1 isolate KC (LC505098), respectively. To confirm the GPoV-1 infection of the grapevines used for HTS analysis, we designed a primer pair targeting the coding region of the P1 protein GP30F (5'-CCTCTTTCGCTGCCATAGGC-3') and GP2180R (5'-CCTGGAGCCTTAAGCTGGTG-3') and applied them in revere transcription (RT)-PCR using a PrimeScriptTM One Step RT-PCR Kit (Takara, China) to detect GPoV-1. The expected 2151-bp fragment was amplified from one of the four grapevine samples. The amplicon was cloned into the pMD19-T vector (TaKaRa, China) and Sanger sequenced. BLASTn analysis showed that the sequence of the amplicon (GenBank accession no. OK574336) shared 98% identity with the scaffold obtained from HTS and shared 98.5% and 97.4% identity with the GPoV-1 isolates KT and KC, respectively. To determine the occurrence of GPoV-1 in the vineyard, 8 and 20 leaves were randomly collected from grapevines of cvs. Black Monukka and Cabernet Sauvignon, respectively. We designed a primer pair of GPoV4264F (5'-ACTGCACAGACTCTCACACG-3') and GPoV4657R (5'- TCCTTCGCGCAGTCACTATC-3'), which target the coding region of the P3-P5 fusion protein. An expected 394-bp amplicon was detected in 2 out of the 8 Black Monukka and 7 out of the 20 Cabernet Sauvignon leaf samples. Sanger sequencing confirmed the GPoV-1 identity of the amplicons. Although all the samples used for HTS analysis displayed symptoms, 4 of 9 samples in which GPoV-1 infection was detected were asymptomatic, suggesting that GPoV-1 may be latent, as reported previously (Candresse et al., 2020). To the best of our knowledge, this is the first report of GPoV-1 infection of grapevine in China. Although most members of the genus Polerovirus (family Solemoviridae) are transmitted by aphids, how GPoV is transmitted remains unknown, representing an increased risk for its spread. Therefore, attention should be given to reducing the prevalence of GPoV-1 in grape-producing areas in China, especially in Xinjiang.

Small RNA Sequencing and Multiplex RT-PCR for Diagnostics of Grapevine Viruses and Virus-like Organisms

Metagenomic approaches used for virus diagnostics allow for rapid and accurate detection of all viral pathogens in the plants. In order to investigate the occurrence of viruses and virus-like organisms infecting grapevine from the Ampelographic collection Kromberk in Slovenia, we used Ion Torrent small RNA sequencing (sRNA-seq) and the VirusDetect pipeline to analyze the sRNA-seq data. The used method revealed the presence of: Grapevine leafroll-associated virus 1 (GLRaV-1), Grapevine leafroll-associated virus 2 (GLRaV-2), Grapevine leafroll-associated virus 3 (GLRaV-3), Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine fanleaf virus (GFLV) and its satellite RNA (satGFLV), Grapevine fleck virus (GFkV), Grapevine rupestris vein feathering virus (GRVFV), Grapevine Pinot gris virus (GPGV), Grapevine satellite virus (GV-Sat), Hop stunt viroid (HSVd), and Grapevine yellow speckle viroid 1 (GYSVd-1). Multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for validation of sRNA-seq predicted infections, including various combinations of viruses or viroids and satellite RNA. mRT-PCR could further be used for rapid and cost-effective routine molecular diagnosis, including widespread, emerging, and seemingly rare viruses, as well as viroids which testing is usually overlooked.

Elimination of Eight Viruses and Two Viroids from Preclonal Candidates of Six Grapevine Varieties (Vitis vinifera L.) through In Vivo Thermotherapy and In Vitro Meristem Tip Micrografting.

Viruses and virus-like organisms are a major problem in viticulture worldwide. They cannot be controlled by standard plant protection measures, and once infected, plants remain infected throughout their life; therefore, the propagation of healthy vegetative material is crucial. In vivo thermotherapy at 36–38 °C for at least six weeks, followed by meristem tip micrografting (0.1–0.2 mm) onto in vitro-growing seedling rootstocks of Vialla (Vitis labrusca × Vitis riparia), was successfully used to eliminate eight viruses (grapevine rupestris stem pitting-associated virus (GRSPaV), grapevine Pinot gris virus (GPGV), grapevine fanleaf virus (GFLV), grapevine leafroll-associated virus 3 (GLRaV-3), grapevine fleck virus (GFkV), grapevine rupestris vein feathering virus (GRVFV), grapevine Syrah virus-1 (GSyV-1), and raspberry bushy dwarf virus (RBDV)), as well as two viroids (hop stunt viroid (HSVd) and grapevine yellow speckle viroid 1 (GYSVd-1)) from preclonal candidates of six grapevine varieties (Vitis vinifera L.). A half-strength MS medium including vitamins supplemented with 30 g/L of sucrose and solidified with 8 g/L of agar, without plant growth regulators, was used for the growth and root development of micrografts and the subsequently micropropagated plants; no callus formation, hyperhydricity, or necrosis of shoot tips was observed. Although the overall regeneration was low (higher in white than in red varieties), a 100% elimination was achieved for all eight viruses, whereas the elimination level for viroids was lower, reaching only 39.2% of HSVd-free and 42.6% GYSVd-1-free vines. To the best of our knowledge, this is the first report of GPGV, GRVFV, GSyV-1, HSVd, and GYSVd-1 elimination through combining in vivo thermotherapy and in vitro meristem tip micrografting, and the first report of RBDV elimination from grapevines. The virus-free vines were successfully acclimatized in rockwool plugs and then transferred to soil.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar 'Meunier' in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

Prevalence of Virus Infections and GLRaV-3 Genetic Diversity in Selected Clones of Croatian Indigenous Grapevine Cultivar Plavac Mali.

The cultivar Plavac Mali (Vitis vinifera L.), the most important indigenous red grapevine cultivar in Croatia, was tested for the presence of 16 grapevine viruses. Thirty-five samples from the collection vineyard were tested for the presence of grapevine leafroll-associated viruses-1, -2, and -3 (GLRaV-1, GLRaV-2 and GLRaV-3, respectively), grapevine fanleaf virus (GFLV), arabis mosaic virus (ArMV), grapevine virus-A (GVA), -B (GVB), -G (GVG), -H (GVH), -I (GVI), -J (GVJ), grapevine fleck virus (GFkV), grapevine rupestris stem pitting associated virus (GRSPaV), and grapevine pinot gris virus (GPGV) by reverse transcription–polymerase chain reaction (RT-PCR). Furthermore, standard PCR was conducted for grapevine badnavirus 1 (GBV-1) and grapevine red blotch virus (GRBV). Mixed infections were most common and GLRaV-3, the most abundant virus found in 85.71% of the vines tested, was further molecularly characterised. Different genomic variants of the heat shock protein homologue (HSP70h) were separated by cloning, detected by single-strand conformation polymorphism (SSCP) analysis, sequenced, and phylogenetically analysed. The presence of phylogenetic groups I and II was only confirmed. This study demonstrates the high virus infection rate of Plavac Mali vines and the heterogeneity of GLRaV-3 present nowadays in a collection vineyard.

Genetic diversity analysis of grapevine rupestris stem pitting-associated virus from grapevine by colony PCR-SSCP and -RFLP.

We have developed methods for detecting the genetic diversity of grapevine rupestris stem pitting-associated virus (GRSPaV) based on restriction fragment length polymorphism (RFLP) and single stranded conformational polymorphism (SSCP) in the 905 nt 3' sequence. The amplicons were cloned from six grapevine cultivars, and colony polymerase chain reaction (colony PCR) using recombination bacteria was subsequently analyzed by RFLP and SSCP. Four haplotypes of SSCP and six haplotypes of Sac IRFLPs were defined. The two methods had a40% discrepancy rate in showing the degree of diversity. All clones were sequenced and were used to construct aphylogenetic tree with seven previously reported GRSPaV sequences. In the tree, all the newly acquired sequences were divided into three clusters, I, II, and III, which corresponded to haplotypes I, II, and III of SSCP, respectively. Haplotype IV of SSCP was grouped into cluster II. Arecombination analysis showed that haplotype IV has undergone arecombination event. Together, these results indicate that the SSCP assay is useful for the rapid identification of genetic diversity of GRSPaV. This is the first report of an analysis of the large fragment of GRSPaV by colony PCR-SSCP. Keywords: grapevine; grapevine rupestris stem pitting-associated virus (GRSPaV); RFLP; SSCP; genetic diversity analysis.