Grapevine Red Globe Virus Research Articles

A Synoptic Review of Plant Disease Epidemics and Outbreaks Published in 2022.

This scientometric study reviews the scientific literature and CABI distribution records published in 2022 to find evidence of major disease outbreaks and first reports of pathogens in new locations or on new hosts. This is the second time we have done this, and this study builds on our work documenting and analyzing reports from 2021. Pathogens with three or more articles identified in 2022 literature were Xylella fastidiosa, Bursaphelenchus xylophilus, Meloidogyne species complexes, 'Candidatus Liberibacter asiaticus', Raffaelea lauricola, Fusarium oxysporum formae specialis, and Puccinia graminis f. sp. tritici. Our review of CABI distribution records found 29 pathogens with confirmed first reports in 2022. Pathogens with four or more first reports were Meloidogyne species complexes, Pantoea ananatis, grapevine red globe virus, and Thekopsora minima. Analysis of the proportion of new distribution records from 2022 indicated that grapevine red globe virus, sweet potato chlorotic stunt virus, and 'Ca. Phytoplasma vitis' may have been actively spreading. As we saw last year, there was little overlap between the pathogens identified by reviewing scientific literature versus distribution records. We hypothesize that this lack of concordance is because of the unavoidable lag between first reports of the type reported in the CABI database of a pathogen in a new location and any subsequent major disease outbreaks being reported in the scientific literature, particularly because the latter depends on the journal policy on types of papers to be considered, whether the affected crop is major or minor, and whether the pathogen is of current scientific interest. Strikingly, too, there was also no overlap between species assessed to be actively spreading in this year's study and those identified last year. We hypothesize that this is because of inconsistencies in sampling coverage and effort over time and delays between the first arrival of a pathogen in a new location and its first report, particularly for certain classes of pathogens causing only minor or non-economically damaging symptoms, which may have been endemic for some time before being reported. In general, introduction of new pathogens and outbreaks of extant pathogens threaten food security and ecosystem services. Continued monitoring of these threats is essential to support phytosanitary measures intended to prevent pathogen introductions and management of threats within a country.

Multiple Infections with Viruses of the Family Tymoviridae in Czech Grapevines.

This study focused on the viruses of the Tymoviridae family that infect grapevines in the Czech Republic. Complete sequences of GFkV (grapevine fleck virus) and GRGV (grapevine red globe virus) from the genus Maculavirus and GRVFV (grapevine rupestris vein feathering virus) and GSyV-1 (grapevine Syrah virus 1) from the genus Marafivirus were obtained using high-throughput sequencing of small RNAs and total RNAs. Mixed infections with these viruses were observed, as well as several variants of these viruses in the same plant. Phylogenetic analysis showed the position of the newly obtained virus isolates within the Tymoviridae family. Recombinant analysis provided evidence of single and multiple intraspecific recombinations in GRGV, GSyV-1, and GRVFV. Additionally, GAMaV, a grapevine virus from the genus Marafivirus, was reported for the first time in the Czech Republic.

First report of grapevine asteroid mosaic-associated virus in grapevines in China.

Grapevine asteroid mosaic-associated virus (GAMaV), a member of the genus Marafivirus of the family Tymoviridae, was first described to infect grapevines in California (Abou Ghanem-Sabanadzovic et al. 2003). Since then, GAMaV has been reported from Greece, Japan, Canada, Uruguay, France, Hungary, Italy, Spain, Switzerland and Russia, and also in some free-living grapevines in North America (Kyriakopoulou, 1991; Morán et al., 2021; Reynard et al., 2022; Shvets et al., 2022; Thompson et al., 2021). GAMaV may be associated with grapevine asteroid mosaic disease (Martelli 2014). In August 2022, a grapevine cv. Cabernet Sauvignon exhibiting chlorotic mottling was collected in Ningxia, China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNAs were then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting in 39,297,567 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (GenBank accession no PN40024) were removed using hisat2 2.1.0 software. The 15,003,158 unmapped reads were de novo assembled into 70,512 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters and analyzed through BLASTn and BLASTx analysis. Five viruses and two viroids were identified: GAMaV (5 contigs), grapevine Pinot gris virus (3 contigs), grapevine berry inner necrosis virus (3 contigs) , grapevine rupestris stem pitting-associated virus (4 contigs), grapevine red globe virus (2 contigs), grapevine yellow speckle 1 viroid (4 contigs) and hop stunt viroid (3 contigs). The five contigs of GAMaV were 352 nt~2, 224 nt in length, which were assembled from 3, 308 reads and shared 85.56%~91.81% nt identity with the genome of the GAMaV isolate GV30 (KX354202) with 93.3% coverage. To further confirm the infection of GAMaV, we designed two pairs of primers, GAMaV-mel1a/1b (5'-CACCTCGCCCCCTACCTTGAC-3'/5'-AAGAGGACGCCTTTGCGGGAG-3') and GAMaV-cp1a/1b (5'-CTAGCGACGACCGCACTGATC-3'/5'-GTCGGTGTACGAGATTTGGTC-3'), which were used to amplify the 329-bp and 440-bp fragments in the helicase (Hel) domain and coat protein (CP) gene of GAMaV genome in RT-PCR, respectively. The amplified PCR products were cloned and sequenced and the two sequences (OQ676951 and OQ676958) showed 91.2% and 93.4% nt identity with the isolate GV30, respectively. Furthermore, 429 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using the above primer pairs. The results showed that 1.4% (6/429) of the samples tested positive, including one 'Autumn seedless' grapevine (Liaoning province), two 'Dawuhezi' (Liaoning), one 'Cabernet Gernischt' (Liaoning) and two 'Cabernet Sauvignon' (Tianjing and Shandong respectively). The partial sequences of the Hel domain (OQ676952-57) and CP gene (OQ676959-61) obtained from the positive samples by sequencing showed 89.1% to 84.5% and 93.6% to 93.9% nt identity with the isolate GV30, respectively. Because these GAMaV-positive grapevines did not show distinct symptoms, GAMaV pathogenicity remains challenging to confirm. This is the first report of GAMaV in grapevines in China, extending the information on its geographical distribution.

High-Throughput Sequencing of Grapevine in Mexico Reveals a High Incidence of Viruses including a New Member of the Genus Enamovirus.

This is the first viral metagenomic analysis of grapevine conducted in Mexico. During the summer of 2021, 48 plants displaying virus-like symptoms were sampled in Queretaro, an important grapevine-producing area of Mexico, and analyzed for the presence of viruses via high-throughput sequencing (HTS). The results of HTS were verified by real-time RT-PCR following a standardized testing scheme (Protocol 2010). Fourteen different viruses were identified, including grapevine asteroid mosaic-associated virus (GAMaV), grapevine Cabernet Sauvignon reovirus (GCSV), grapevine fanleaf virus (GFLV), grapevine fleck virus (GFkV), grapevine Pinot gris virus (GPGV), grapevine red globe virus (GRGV), grapevine rupestris stem pitting-associated virus (GRSPaV), grapevine rupestris vein feathering virus (GRVFV), grapevine Syrah virus 1 (GSyV-1), grapevine virus B (GVB), and grapevine leafroll-associated viruses 1, 2, 3, 4 (GLRaV1, 2, 3, 4). Additionally, divergent variants of GLRaV4 and GFkV, and a novel Enamovirus-like virus were discovered. This is the first report of GAMaV, GCSV, GLRaV4, GPGV, GRGV, GRVFV, and GSyV-1 infecting grapevines in Mexico; the impact of these pathogens on production is unknown.

First report of grapevine red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) infecting grapevine (Vitis vinifera L.) in Portugal.

Grapevine Red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) are relatively recently described grape viruses that respectively belong to the genera Maculavirus and Marafivirus in the family Tymoviridae [1]. Owing to their rather recent description, still limited information on their biology, on their molecular variability and on their geographic distribution is available. Both viruses are apparently completely or largely asymptomatic in European grapevine and have likely been overlooked in a wide range of situations (Martelli, 2014). According to sequences in GenBank, GRGV has been identified in Asia (Iran, Japan, China), the Americas (USA, Brazil) and Europe (Spain, France, Slovenia, Hungary, Czech Republic and Germany). GRVFV has been reported from the same countries but also in Oceania (New Zealand, Australia) and from a range of other countries including India, Pakistan and South Korea for Asia, Canada for North America and Switzerland, Slovakia, Italy and Russia for Europe. Evidence for the presence of GRGV and GRVFV in grapevine plants from northern Portugal (variety(ies) unknown) was obtained through the bioinformatic analysis [2] of RNASeq Illumina data obtained from phloem scrapings from five grapevine samples collected in different plots in 2016 [3]. Following grapevine genome substraction, contigs assembly and Blast-based contigs annotation using CLC Genomics Workbench, two plants, #4 and #5b, yielded contigs representing near complete GRGV genomes. The plant #4 contig integrated 474 reads (0.15% of reads for an average coverage of 10.1x) while the corresponding values for the contig for plant #5b are 2185 reads (2.4% of total reads) for a coverage of 47.2x. The two GRGV contigs show 91.4% nucleotide (nt) identity and the closest GRGV full genome sequence in GenBank, MZ451067 from Canada, shares respectively 98.9% and 91.6% nt identity with them. The near complete genome contigs have been deposited in GenBank (ON603917 and ON603918). Simultaneously, two near full length genomic contigs for GRVFV were identified from plant #5b and have also been deposited in GenBank (ON603919 and ON603920). These contigs show 84.4% nt identity to each other and were respectively assembled from 4643 (5.2% of total reads) and 5326 reads (6.0% of total reads) for respective average coverages of 102.3x and 117.3x. The closest full GRVFV genome in GenBank is MZ027155 from the USA, with 84.3-85.3% nt identity. Confirmation of the presence of GRVG and GRVFV in the doubly infected plant #5b was achieved by specific RT-PCR assays. A published assay [4] was used for GRGV and primers GRVFV-Cp-F 5'AAYCCTGTCACHCTCCACTG3' and GRVFV-Cp-R 5'TTCATGGTGGTGCCDGTGAG3' (Tm 55°C) were used for GRVFV. The obtained 447nt GRGV amplicon showed a single difference with the HTS contig while the 218 nt GRVFV amplicon showed 3 mutations as compared to one of the HTS contigs. The different grapevines had initially been sampled because they showed relatively poor and stunted growth but besides GRVFV and/or GRGV the HTS analysis indicated that they were also infected by hop stunt viroid, grapevine yellow speckle viroid 1, grapevine rupestris stem pitting virus, plus respectively a novel nepovirus (plant #4) and grapevine leafroll-associated virus 2 and grapevine Pinot gris virus (plant #5b) so that the results reported here do not shed novel light on the potential pathogenicity of GRGV or GRVFV. To the best of our knowledge, this is the first report of GRGV and GRVFV in Portugal.

Complete Genome Sequences of Grapevine Red Globe Virus in Japan.

Two complete and three partial genome sequences of grapevine red globe virus (GRGV) from grapevines (Vitis spp.) in Japan were determined.

First Report of Grapevine Red Globe Virus, Grapevine Rupestris Vein Feathering Virus, and Grapevine Syrah Virus-1 Infecting Grapevine in Slovenia.

To investigate the virome status of preclonal grapevine candidates, 82 dormant cuttings of six grape cultivars ('Laški rizling', 'Refošk', 'Rebula', 'Malvazija', 'Zeleni Sauvignon' and 'Pokalca') were taken in 2019 from vines in second cycle of clonal selection in Vipavska dolina (Primorska wine-growing region). All samples were pooled in twelve groups (1x 'Laški rizling', 1x 'Pokalca', 2x 'Rebula', 2x 'Zeleni Sauvignon', 3x 'Malvazija', and 3x 'Refošk') from which small RNAs were isolated using the mirVana miRNA Isolation Kit (Ambion, Life Technolgies), twelve cDNA libraries were constructed and sequenced on an Ion Proton Sequencer (Ion Torrent, Life Technologies, Waltham, MA, USA). The VirusDetect pipeline (Zheng et al. 2017) was used for bioinformatics analysis and 3.6 - 13.9 million reads per library were processed. According to the VirusDetect pipeline, grapevine red globe virus (GRGV; genus Maculavirus, family Tymoviridae) was detected in two libraries of cv. 'Refošk'. In one library, GRGV showed the highest coverage of 63.6% and nt identity of 92.71% with GRGV isolate Graciano-T101 (accession no. KX171166) from Spain, and was represented by 40 contigs with sequence depth of 53.0X. In the second library, GRGV showed the highest coverage of 45.8% and nt identity of 94.49% with GRGV isolate Graciano-T90 (accession no. KX109927) from Spain, and was represented by 36 contigs with sequence depth of 22.9X. Grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) was found in eleven libraries representing six different cultivars. In six libraries, GRVFV showed the highest coverage of 37%-85% and nt identity of 88.53%-94.05% with GRVFV isolate CHASS (accession no. KY513702) from Switzerland, and was represented by 34-90 contigs with sequence depth of 11.0X-93.3X. In the other four libraries, GRVFV showed the highest coverage of 27.5%-64.8% and nt identity of 92.36%-93.87% with GRVFV isolate Mauzac (accession no. KY513701) from France, and was represented by 30-94 contigs with sequence depth of 5.4X-20.7X, while in one library, GRVFV showed the highest coverage of 30.2% and nt identity of 95.30% with GRVFV isolate SK925 (accession no. MH544692) from Slovakia, and was represented by three contigs with sequence depth of 5.6X. Grapevine Syrah virus-1 (GSyV-1; genus Marafivirus, family Tymoviridae) was detected in two libraries of cvs 'Laški rizling' and 'Malvazija'. In the library of cv. 'Laški rizling', GSyV-1 showed the highest coverage of 44.9% and nt identity of 95.36% with GSyV-1 isolate SK351 (accession no. KP221269) from Slovakia, and was represented by three contigs with sequence depth of 20.9X. In the library of cv. 'Malvazija', GSyV-1 showed the highest coverage of 48.8% and nt identity of 92.06% with GSyV-1 isolate SK30 (accession no. KP221256) from Slovakia, and was represented by 25 contigs with sequence depth of 29.4X. Results obtained by HTS were confirmed in individual samples using reverse transcription-polymerase chain reaction (RT-PCR). GRGV was amplified using specific primer pair RG6061F: 5'-CCGAGCTTCTCTCCAAGATCA-3' and RG6801R: 5'-ACTTAACGTAGGCCACTGGGT-3' (Cretazzo and Velasco 2017). GRVFV was amplified using specific primer pair GRVFV_6090F: 5'-CATCGTTCTGATCCTCAGCC-3' and GRVFV_6605R: 5'-AGAGACGCTGACCATGCCAC-3' (Glasa et al. 2019). GSyV-1 was amplified using specific primer pair SY5922F: 5'-CCAATGGGTCGCACTTGTTG-3' and SY6295R: 5'- ACTTCATGGTGGTGCCGGTG -3' (Glasa et al. 2015). Three out of 13 samples of 'Refošk' tested for GRGV, 44 out of 78 samples tested for GRVFV (2 'Laški rizling', 12 'Refošk', 9 'Rebula', 7 'Malvazija', 8 'Zeleni Sauvignon' and 6 'Pokalca') and 3 out of 8 samples tested for GSyV-1 (1 'Laški rizling' and 2 'Malvazija') were positive. Further verification of the amplicons was performed by bidirectional Sanger sequencing and the generated sequences were submitted to GenBank: GRGV (MW446914-MW446916), GRVFV (MW446917-MW446938) and GSyV-1 (MW446939-MW446941). Phylogenetic analysis showed that Slovenian GRGV isolates clustered separately from other GRGV isolates retrieved from the NCBI. Phylogenetic analysis showed that some Slovenian GRVFV isolates clustered with those from France or Slovakia, while some of them clustered separately. Phylogenetic analysis showed that Slovenian GSyV-1 isolates clustered with GSyV-1 isolates from Hungary and Slovakia. To our knowledge, this is the first report of GRGV, GRVFV and GSyV-1 infecting grapevine in Slovenia. Further analysis will be necessary to assess the prevalence of these viruses in Slovenian vineyards and to evaluate their impact on grapevine production.

First report of Grapevine red globe virus in grapevine in the United Kingdom

In August 2019 a sample of grapevine (Vitis sp.) leaves was submitted to Fera Science Ltd. from a vineyard in the south of England. The sample was sent following the appearance of an unknown disease. Symptoms included red colouration and flecking (Figures 1, 2). The sample was tested by DAS-ELISA for the presence of Arabis mosaic virus (DSMZ, Germany), Raspberry ringspot virus (DSMZ, Germany), Strawberry latent ringspot virus, Tobacco ringspot virus (Agdia, USA), Tomato black ring virus (DSMZ, Germany and Bioreba, Switzerland), Tomato ringspot virus (Loewe, Germany), and plate trap ELISA for potyviruses using a generic potyvirus antisera (DSMZ, Germany). The sample gave negative results for all tests. The sample was then tested by high throughput sequencing (HTS) on a MiSeq Sequencer (Illumina, UK) (Fowkes et al., 2021). The total number of reads for the sample was 342,422 with 5 (0.001%) being mapped to the genome of Grapevine red globe virus (GRGV, genus Maculavirus). The sequence contig of 217 nt obtained by HTS was checked by nucleotide comparison through BLAST against publicly available sequences. The partial sequence of the replicase gene had 94% identity to a GRGV sequence (GenBank Accession No. MZ451066.1), a historical isolate sequenced from the Sidney live plant collection, country of origin unknown (Mike Rott, CFIA, Pers. Comm.). The genome fragment of GRGV was uploaded to GenBank (ON187032). Sequencing data has been submitted to the NCBI short read archive, BioProject (PRJNA817416). Other grapevine viruses were also inferred from the sequence data, namely Grapevine rupestris stem pitting-associated virus (genus Foveavirus, ON187034) and Grapevine fleck virus (genus Maculavirus, ON187033). In each case these have been previously reported from the UK (Silva et al., 2017). To further confirm infection by GRGV, the sample was tested by RT-PCR using primers specific for GRGV (Ruiz-Garcia et al., 2018). A product of 418 bp was obtained (ON187031). The product was analysed by Sanger sequencing (MWG GmbH, Germany) and checked by nucleotide sequence comparison against sequences publicly available through BLAST. The sequence had 95% identity to the sequence of a GRGV isolate from Washington State, USA (MT749359.1). GRGV was first reported in Italy (Sabanadzovic et al., 2000) and has since been found in China, Croatia, France, Germany, Greece, Iran, Slovenia, Spain and the USA (Nourinejhad Zarghani et al., 2021; EPPO Global database, 2022). No specific symptoms have been associated with GRGV (Ruiz-Garcia et al., 2018), and as the detection of GRGV was in co-infection with other viruses, no conclusion can be drawn on the cause of the observed symptoms. To our knowledge this is the first report of GRGV in the UK. This suggests a broader distribution than previously reported and indicates the need for further surveillance of grapevine to establish current distribution. This work was funded under the Defra-Fera Long Term Service Agreement.

Virome of Grapevine Germplasm from the Anapa Ampelographic Collection (Russia).

Grapevine germplasm collections are unique repositories of grape cultivars; therefore, it is necessary to minimize their infection with pathogens, including viruses, and develop various programs to maintain them in a virus-free state. In our study, we examined the virome of the largest Russian grapevine germplasm collection, the Anapa Ampelographic Collection, using high-throughput sequencing of total RNAs. As a result of bioinformatics analysis and validation of its results by reverse transcription PCR (RT-PCR) and quantitative RT-PCR (RT-qPCR), we identified 20 viruses and 3 viroids in 47 libraries. All samples were infected with 2 to 12 viruses and viroids, including those that cause economically significant diseases: leafroll, fleck, and rugose wood complex. For the first time in Russia, we detected Grapevine virus B (GVB), Grapevine virus F (GVF), Grapevine asteroid mosaic-associated virus (GAMaV), Grapevine Red Globe virus (GRGV), Grapevine satellite virus (GV-Sat), Grapevine virga-like virus (GVLV), Grapevine-associated jivivirus 1 (GaJV-1) and Vitis cryptic virus (VCV). A new putative representative of the genus Umbravirus with the provisional name Grapevine umbra-like virus (GULV) was also identified in Russian grape samples.

Complete genome sequence of a novel citrus virus with characteristics of members of the family Tymoviridae.

A novel positive-stranded RNA virus provisionally named "citrus virus C" (CVC) was discovered in citrus trees displaying mottling symptoms. Its genome comprises 7,215 nucleotides (nt), excluding the 3' poly(A) tail, and contains two open reading frames (ORFs) that encode a replication-associated polyprotein (RP) and a putative coat protein (CP). The CVC genome contains a 16-nt 'marafibox', which is highly conserved in most viruses belonging to the genus Marafivirus of the same family. Sequence analysis suggested that the virus is most closely related to grapevine Red Globe virus (GRGV), which is yet to be officially classified in the family Tymoviridae. The sequence identities between CVC and GRGV in the whole genome (50.7%, nt) and CP (49.4% for amino acid, and 53.9% for nt) are lower than the thresholds (80% in the genome and 90% in the CP) for species demarcation in the family. Therefore, it is legitimate to propose that CVC is a member of new species in the family Tymoviridae.

First report of grapevine red globe virus in grapevine in Iran

First report of grapevine red globe virus in grapevine in Iran

First Report of grapevine red globe virus in grapevines in Washington State.

Grapevine red globe virus (GRGV; genus Maculavirus, family Tymoviridae) has been reported in grapevines (Vitis spp.) from Italy, Greece, France, China, Spain and Germany and in California, U.S.A. (Sabanadzovic et al. 2000; Cretazzo et al. 2017; Fan et al. 2016; Ruiz-Garcia et al., 2018). During surveys of grapevine nurseries, a total of 241 composite samples, each consisting of four petioles from mature leaves/vine from five asymptomatic grapevines, from 33 grapevine (Vitis vinifera) cultivars were collected. Total RNA isolated from these samples using Spectrum Total RNA isolation kit (Sigma-Aldrich, St. Louis, MO) was subjected to high-throughput sequencing (HTS) on an Illumina HiSeq2500 or Novaseq 6000 platforms in paired-end mode (Genomics Core Facility, Huntsman Cancer Institute, Utah University, Salt Lake City, UT). After trimming raw reads based on quality and ambiguity, the paired-end quality reads of approximately 120 (HiSeq) or 145 (Novaseq) base pair (bp) length were assembled de novo into a pool of contigs (CLC Genomics workbench 12). These contigs were subjected to BLASTn analysis against the nonredundant virus database from GenBank (http://www.ncbi.nlm.nih.gov/blast). A total of 49 contig sequences, ranging from 200 to 1645 bp in length with an average coverage ranging up to 418.7, aligning with GRGV genome were detected in cvs. Aglianico, Cabernet franc, Pinot gris and Riesling. BLASTn analysis of contigs greater than 500 bp length showed sequence identity between 88.5% and 95% with corresponding GRGV sequences reported from other countries. These results indicated the presence of genetically distinct isolates of GRGV. HTS data also revealed coinfection of GRGV in all samples with one or more of the following virus and/or viroids: grapevine rupestris stem pitting associated virus, grapevine rupestris vein feathering virus, hop stunt viroid or grapevine yellow speckle viroid-1. To further confirm infection by GRGV, total RNA was extracted from two asymptomatic Pinot gris vines previously tested positive in HTS using Spectrum Total RNA isolation kit and subjected to reverse transcription-PCR using primers specific to the replicase polyprotein gene of the virus (RG4847F: 5'-TGGTCTGTTGTTCGCATCTT-3' and RG6076R: 5' CGGAAGGGGAAGCATTGATCT-3', Cretazzo et al., 2017). Sequence analysis of the approximately1,250 bp amplicons (accession number MT749359) showed 91.2 % nt sequence identity with corresponding sequence of GRGV isolate from Brazil (KX828704.1). To our knowledge, this is the first report of GRGV in Washington State. Together with the report of the occurrence of GRGV in California (Sabanadzovic et al. 2000), these/span> results indicate wide geographical distribution of the virus. Although GRGV can cause asymptomatic infections in grapevines (Martelli et al. 2002), the economic importance of GRGV as single or coinfections with other viruses needs to be examined to assess the potential significance of the virus to grape production and grapevine certification programs.

First report of Grapevine asteroid mosaic associated virus in grapevine in Spain.

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

First Report of Grapevine Virus T Infecting Grapevine in China

Grapevine virus T (GVT), a putative new member of the genus Foveavirus in the family Betaflexiviridae, was first described from transcriptomic data of the cultivar Teroldego (Jo et al. 2017). Since then, GVT has been reported from grapevines in Germany (Ruiz-Garcia et al. 2018), Croatia (Voncina et al. 2018), and other European countries (Glasa et al. 2018; Nourinejhad Zarghani et al. 2018). It is closely related to Grapevine rupestris stem pitting-associated virus and exhibited relatively high intraspecies variability. In June 2017, a field survey of grapevine disease in Yanqing district of Beijing was conducted, and grapevine plants with the symptoms of chlorosis and leaf rolling were observed with an incidence of 5 to 40%. Total RNA was extracted from leaf samples of a symptomatic Red Globe grapevine plant and used for constructing a transcriptome library followed by high-throughput sequencing on an Illumina HiSeq 4000 platform. De novo assembly of the 8,290,478 reads was performed by Trinity, and the BLASTn and BLASTX analysis of the assembled 14,834 contigs revealed the presence of one contig related to GVT (8,653 nt in length), with a nucleotide similarity ranging from 81 to 92%, together with the contigs related to Grapevine leafroll-associated virus 1, Grapevine Red Globe virus, and Grapevine Pinot gris virus. Furthermore, the complete genome of this GVT isolate (GVT-BJ) was amplified with conventional reverse transcription PCR (RT-PCR) using the primer pairs F1:5′-TGCTTTCACGTAATGGCTCTTCAC-3′/R1:5′- CCTCAGCAACTCAAAAATGTCAGAAT-3′ and F2:5′-GTGGTGGTCCTTGATGAAATTCAGCT-3′/R2:5′-AGTACGGTATGCCAGCGAACATATGC-3′ designed for the assembled contig and RACE (5′-GATTACGCCAAGCTTCGGGGGTATGAGATTTGCCAATGTTGGC-3′ for 5′ RACE and 5′-GATTACGCCAAGCTTGATGAAAGTGCTTTGGAGCCGGAAGG-3′ for 3′ RACE), and the PCR products were cloned and Sanger sequenced. The genome length of GVT-BJ was 8,700 nt (GenBank no. MH158659) with the typical foveavirus genomic organization with five open reading frames. A pairwise sequence comparison revealed GVT-BJ shared highest nucleotide sequence identity of 92.3% with the French isolate CF-3 (MH674180). Furthermore, 36 symptomatic grapevine samples from nine vineyards in Yanqing district were screened for the presence of GVT by RT-PCR with the primer pair targeting the CP region (CPf 5′-ATGGCGTCAAATGAGGAGC-3′/CPr 5′-TTATGAATCTCCCCCAAATGGATTG-3′); four were positive, and the presence of GVT was further confirmed by sequencing the PCR products. These four grapevine samples were also positive for Grapevine leafroll-associated virus 1 identified by RT-PCR with the reported primers pORF9F and pORF9R (Little and Rezaian 2006). This is the first report of GVT in China in mixed infection with other viruses. A larger-scale survey of commercial vineyards for the prevalence of GVT in China and its association with the observed symptoms is needed.

First Report of Grapevine Red Globe Virus in Grapevine in Germany

First Report of Grapevine Red Globe Virus in Grapevine in Germany

Viral Diversity in Autochthonous Croatian Grapevine Cultivars.

A survey was conducted on nine autochthonous grapevine cultivars grown along the Croatian coastal region. In total, 48 vines (44 from germplasm collection, 4 from vineyards) originating from 23 sites were tested for 26 viruses using molecular methods. Results revealed high infection rates with Grapevine leafroll-associated virus 3 (GLRaV-3); Grapevine virus A (GVA, both 91.7%); Grapevine fleck virus (GFkV, 87.5%); and Grapevine rupestris stem pitting-associated virus (GRSPaV, 83.3%). Other detected viruses were: Grapevine fanleaf virus (GFLV); Grapevine leafroll-associated viruses 1, 2, and strains of 4 (GLRaV-1, GLRaV-2, GLRaV-4); Grapevine viruses B, D, F (GVB, GVD, GVF); Grapevine red globe virus (GRGV); Grapevine vein feathering virus (GVFV); Grapevine Syrah virus 1 (GSyV-1); and Grapevine Pinot gris virus (GPGV). No virus-free vine was found. Mixed infections were determined in all vines, the number of viruses in a single vine ranged from three to nine. GLRaV-3 variant typing confirmed presence of group I, II, and III. Four vines with leaf deformation and mottling were positive for GPGV. Seven viruses (GLRaV-4-like group, GVD, GVE, GVF, GRGV, GSyV-1, and GVFV) were detected for the first time in Croatia. This survey confirmed the deteriorated sanitary status of autochthonous Croatian grapevine cultivars.

High-throughput sequencing applied for the identification of viruses infecting grapevines in Brazil and genetic variability analysis

The application of high-throughput sequencing technologies (HTS) enables the recovery of many nucleotide sequence fragments from diseased plants and may help in pathogen identification. This study was designed to identify viruses infecting 15 grapevine (Vitis spp.) samples collected from experimental fields and vine collections and assess the genetic variability of the identified viruses. The virus-enriched dsRNAs were extracted from bark scrapings and sequenced using an Illumina platform. The paired-end reads were analyzed, assembled contigs were generated and identified as related to viruses. Contigs of 14 viruses have been identified, some of them covering large extensions of viral genomes or resulting in assembly of near-complete or complete genomes. Grapevine virus infections are usually mixed and the HTS assays were suitable to identify ten viruses already reported that traditionally infect grapevines in Brazil, one that has been recently identified (Grapevine Syrah virus 1) and others (Grapevine Cabernet Sauvignon reovirus, Grapevine Red Globe virus and Grapevine vein clearing virus) not previously reported in this country. Nucleotide identities among Brazilian isolates identified by HTS and homologous grapevine virus sequences in GenBank were high, ranging from 77% to 99%. Genetic variability analysis of viral sequences obtained by HTS and sequences available in GenBank indicated that the coding regions in the different viral species are under purifying selection, and that recombination events occurred in the majority of the viral species analyzed. The coat protein genes, generally, had lower genetic variability than the replicase and movement protein genes.

High‐throughput sequencing allowed the completion of the genome of grapevine Red Globe virus and revealed recurring co‐infection with other tymoviruses in grapevine

Grapevine Red Globe virus (GRGV) is a member of family Tymoviridae tentatively assigned to genus Maculavirus. There is evidence that the distribution of this virus may be widespread. In a recent report, the authors of the present study described the presence of GRGV in Spain. To further estimate its incidence, a survey was carried out that allowed the detection of the virus using RT‐PCR in a germplasm collection in northern Spain. In the present study, three isolates were selected to obtain full‐length genome sequences using high‐throughput sequencing (HTS) of RNA combined with Sanger sequencing. The GRGV complete genome consists of 6850 nucleotides, excluding the polyA tail. Two ORFs could be identified as the putative replicase and coat protein. Although comparison of the complete genomes provided no evidence for the presence of the additional ORF previously described, another ORF was identified within the coat protein ORF, but it probably lacks functional significance. Phylogenetic analysis supported the ascription of GRGV to genus Maculavirus. The profile of vsiRNA (virus‐derived small interfering RNA) distribution along the GRGV genomes suggested the presence of a subgenomic RNA corresponding to the coat protein ORF. To improve detection of GRGV, new primer sets were designed based on consensus sequences. HTS revealed a frequent co‐infection of GRGV and grapevine rupestris vein feathering virus (GRVFV). Biological indexing by grafting two GRGV‐infected vines on indicator plants and the visual inspection of symptoms in other infected plants revealed that the virus has a negligible impact on grapevine.

First Report of Grapevine Red Globe virus in grapevine in Spain

First Report of Grapevine Red Globe virus in grapevine in Spain

First Report of Grapevine red globe virus (GRGV) in Grapevines in China

First Report of <i>Grapevine red globe virus</i> (GRGV) in Grapevines in China