Grapevine Buds Research Articles

Physiological and transcriptomic characterization of cold acclimation in endodormant grapevine under different temperature regimes.

It is essential for the survival of grapevines in cool climate viticultural regions where vines properly acclimate in late fall and early winter and develop freezing tolerance. Climate change-associated abnormities in temperature during the dormant season, including oscillations between prolonged warmth in late fall and extreme cold in midwinter, impact cold acclimation and threaten the sustainability of the grape and wine industry. We conducted two experiments in controlled environment to investigate the impacts of different temperature regimes on cold acclimation ability in endodormant grapevine buds through a combination of freezing tolerance-based physiological and RNA-seq-based transcriptomic monitoring. Results show that exposure to a constant temperature, whether warm (22 and 11°C), moderate (7°C), or cool (4 and 2°C) was insufficient for triggering cold acclimation and increasing freezing tolerance in dormant buds. However, when the same buds were exposed to temperature cycling (7±5°C), acclimation occurred, and freezing tolerance was increased by 5°C. We characterized the transcriptomic response of endodormant buds to high and low temperatures and temperature cycling and identified new potential roles for the ethylene pathway, starch and sugar metabolism, phenylpropanoid regulation, and protein metabolism in the genetic control of endodormancy maintenance. Despite clear evidence of temperature-responsive transcription in endodormant buds, our current understanding of the genetic control of cold acclimation remains a challenge when generalizing across grapevine tissues and phenological stages.

Relationships between freezing resistance and biochemicals in grapevine buds and canes: Different soluble carbohydrates accumulate in several cultivars during cold acclimation

Owing to recent warming trends during the growing season, wine grapevine (Vitis vinifera) production has increased in subarctic areas such as Hokkaido. However, high freezing resistance remains essential for grapevines due to the severe winter temperatures in these regions. Here, we investigated the seasonal variation in freezing resistance, as well as the water, soluble carbohydrate, proline, and total phenolic content (TPC) in the buds and canes of two V. vinifera cultivars and a Vitis riparia hybrid, Maeve. We found that freezing resistance in the buds and canes increased from fall to winter, with Maeve exhibiting higher freezing resistance than the V. vinifera cultivars during both seasons. Maeve experienced a faster rate of deacclimation, leading to comparable spring freezing resistance among all cultivars. The water content in the buds and canes of all three cultivars decreased during the fall, with Maeve showing an earlier reduction compared to the others. Most soluble carbohydrates increased in winter and decreased in spring. Notably, Maeve, which had higher winter freezing resistance, accumulated more sucrose in its buds and a higher concentration of soluble carbohydrates, particularly monosaccharides, in its canes compared to the other two cultivars. Proline and TPC levels were not linked to freezing resistance. Grapevine buds and canes appeared to accumulate soluble carbohydrates, especially monosaccharides, during winter, while reducing water content in fall to enhance freezing resistance. This study suggests that grapevine cultivars in Hokkaido may utilize different types of soluble carbohydrates to improve the freezing resistance of their buds and canes.

Genes contrastingly regulated by short days and low temperature are key players in the onset and cessation of endodormancy in grapevine buds

Genes contrastingly regulated by short days and low temperature are key players in the onset and cessation of endodormancy in grapevine buds

Cold Acclimation and Deacclimation Processes in Grapevine Buds: Insights into the Regulation of Cod Hardiness and ICE-CBF-COR Gene Expression

Cold Acclimation and Deacclimation Processes in Grapevine Buds: Insights into the Regulation of Cod Hardiness and ICE-CBF-COR Gene Expression

Cold Hardiness in ‘Alphonse Lavallee’ (Vitis vinifera L. cv) Grape Dormant Buds and Phloem Tissue: Seasonal Insights and Some Treatment Impacts

Grapes are highly susceptible to cold damage during critical developmental stages, impacting viticulture. Understanding the intricate dynamics of cold hardiness in grape dormant buds and phloem tissue is crucial for developing effective mitigation strategies. In this study, we investigated the LT50 values, representing the temperature at which 50% of buds are damaged, under different treatments and sampling times. In our research, we evaluated the effects of four treatments—potassium oxide (K2O), calcium chloride (CaCl2), seaweed (SW), and a control—on the cold hardiness of grapevine buds and phloem tissue. Primary bud LT50 values varied across seasons, with January at −22.46 °C, February at −22.35 °C, and March at −20.45 °C. K2O treatment showed a trend toward improvement, although the difference from the control (−21.99 °C) was not statistically significant. Regarding LT50 values, CaCl2 and SW applications did not significantly differ from the control. Tertiary buds, however, exhibited a substantial enhancement in cold hardiness with K2O application, displaying significantly lower LT50 values compared to the control (−23.55 °C). Phloem tissue LT50 values did not significantly differ among treatments, showing less variability. Bud water content significantly increased with K2O application in all sampling periods (January: 35.41% vs. 35.61%; February: 34.03% vs. 39.16%; March: 42.40% vs. 37.82%), while shoot water content remained stable. In conclusion, K2O emerges as a key influencer, particularly in enhancing the cold hardiness of tertiary buds. These insights contribute to the knowledge base for targeted frost mitigation strategies in viticulture.

Early molecular response of cold-deacclimated grapevine buds to late frost occurrences

Early molecular response of cold-deacclimated grapevine buds to late frost occurrences

Micellar and Solvent Loan Chemical Extraction as a Tool for the Development of Natural Skin Care Cosmetics Containing Substances Isolated from Grapevine Buds

The present study aimed to evaluate the possibility of using micellar and solvent loan chemical extraction (LCE) to isolate valuable components from grapevine leaf buds, subsequently utilizing them to prepare functional and safe-to-use cosmetic preparations, specifically facial serums. An aqueous solution of polyglyceryl-4 laurate/sebacate and polyglyceryl-6 caprylate/caprate was employed for a micellar LCE, while an aqueous solution of 1,3-propanediol was used for a solvent LCE. Importantly, the extraction medium was exclusively comprised of components from the designed final cosmetic product. Consequently, no additional substances were present in the cosmetics developed, and the formulation was notably enhanced by compounds extracted from grapevine buds. The antioxidant properties and compound characterization of the obtained micellar (SurfE) and solvent (SolvE) extracts based on grapevine buds were tested and compared. UPLC-MS/MS results indicated that the extracts were rich in phenolic and flavonoid compounds, exhibiting antioxidant activity as measured using the DPPH and ABTS scavenging ability. The extracts were used to prepare model facial serums, which underwent evaluation based on fundamental functionality-related parameters (e.g., rheological characteristics and color) and their impact on the skin through cytotoxicity assessment. The results demonstrated that facial serums with extracts based on grapevine buds provided safe, natural cosmetics.

Systematic evaluation of chromatin immunoprecipitation sequencing to study histone occupancy in dormancy transitions of grapevine buds.

The regulation of DNA accessibility by histone modification has emerged as a paradigm of developmental and environmental programming. Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a versatile tool to investigate in vivo protein-DNA interaction and has enabled advances in mechanistic understanding of physiologies. The technique has been successfully demonstrated in several plant species and tissues; however, it has remained challenging in woody tissues, in particular complex structures such as perennating buds. Here we developed a ChIP method specifically for mature dormant buds of grapevine (Vitis vinifera cv. Cabernet Sauvignon). Each step of the protocol was systematically optimized, including crosslinking, chromatin extraction, sonication and antibody validation. Analysis of histone H3-enriched DNA was performed to evaluate the success of the protocol and identify occupancy of histone H3 along grapevine bud chromatin. To our best knowledge, this is the first ChIP experiment protocol optimized for the grapevine bud system.

Contrasting seasonal dynamics of dormancy, respiratory metabolism and cell cycle state in grapevine buds of a subtropical and Mediterranean climate

AbstractGrapevine (Vitis vinifera L.) is the most widely cultivated fruit crop worldwide, contributing substantially to rural economies. The production cycle and productivity depend on seasonal cues and can range from a strongly deciduous habit in cool‐temperate climates to evergreen in subtropical and tropical climates. The influence of the different seasonal conditions on the dynamics of the perennating bud, including the degree of growth and metabolic quiescence, cell cycle status and internal tissue oxygen status between different climatic zones is largely unknown. This knowledge is important for adapting to changing climate conditions and for crop expansion to wider regions. This study investigated the growth and metabolic physiology of the perennating bud of commercially grown cv. Flame Seedless table grapes from Mediterranean and subtropical climate in Western Australia, from summer until late winter. Climate data were obtained, showing differences in minimum (night) temperature between the two climates, reflected by differences in calculated chilling units. Bud dormancy increased during autumn of both climates;however, the onset and depth of dormancy of buds from the subtropical region were attenuated relative to the Mediterranean condition. Stark contrasts were also observed in metabolism. The respiration of subtropical‐grown buds increased over fivefold during late autumn and winter, while that of Mediterranean‐grown buds increased less than twofold. This was also reflected in less desiccation of the subtropical‐grown buds, and an apparently greater degree of hypoxia within the bud during late winter, prior to bud burst. Collectively, these data show pronounced differences in growth and metabolic physiology of commercially grown table grapes, which provide a foundation for investigating the influence of differing climate and seasonality on the growth and productivity of table grapes and how these may be managed through breeding and agronomy.

First report of Vitis cryptic virus from grapevines in China.

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

Phenotypic Plasticity in Bud Fruitfulness Expressed in Two Distinct Wine Grape Cultivars Grown under Three Different Pedoclimatic Conditions

The effects of interactions between the genotype and environmental conditions are expressed in the phenotype. Comparing the performances of genotypes under the same range of environmental conditions allows for relative measurements to be made of the different levels of plasticity among those genotypes. The objective of this research was to evaluate the different responses of two wine grape cultivars, native Aglianico and international Cabernet Sauvignon, under different pedoclimatic conditions in terms of the functional traits that govern grapevine bud fruitfulness, vegetative growth, and yield development. The study was conducted over two consecutive seasons (2020 and 2021), in six commercial Vitis vinifera L. vineyards, located in three distinct viticultural regions of central-southern Italy (Molise, Campania, and Sicily). In each experimental vineyard, the bud fruitfulness, number of leaves, total leaf area per vine, midday vine water status, and fruit yield were measured. The obtained results showed that bud fruitfulness was higher for Aglianico than for Cabernet Sauvignon in each experimental site, while the variability of plant responses between the vineyards was lower for Cabernet Sauvignon cultivar compared to those for Aglianico. The genetic × environmental interactions were expressed predominantly during berry ripening stages, while plasticity was generally greater in Aglianico than in Cabernet Sauvignon.

Evaluation of Sample Preparation Practices Common with Differential Thermal Analysis of Grapevine Bud Cold Hardiness

<h3>Background and goals</h3> Differential thermal analysis (DTA) is a popular semi-automated method to determine the temperature at which plant tissues freeze. It is used to evaluate effects of environmental variables, genotypes, and agronomic practices on cold hardiness, and as an Extension tool to monitor cold hardiness and provide decision support for growers of many specialty crops. <h3>Methods and key findings</h3> This study evaluated common approaches in sampling and preparation of dormant grapevine compound buds for DTA to provide a reference point as to which adjustments might cause excessive variation in subsequent data. Common adjustments in sample preparation, such as using foil packets, moistened tissue paper, or bud orientation, had no consistent effects on DTA values, typically resulting in a variation of &lt;1°C. The same was true for storage (or shipping conditions) of 24 hrs or less, provided samples were maintained at low, but above-freezing temperatures (1.6 to 4°C). Finally, influence of bud position along the length of the cane was also inconsistent. <h3>Conclusions and significance</h3> The robust nature of DTA for estimating grapevine cold hardiness offsets the potential impact of variation introduced from different sample preparation methods. These results can help those wishing to develop DTA protocols or expand their capacity to conduct DTA analysis to design protocols to best suit their individual program needs. Consistency in DTA approach is likely more important than the specific methods used, especially when comparing relative differences in observed lethal temperatures.

Sucrose accumulation and endodormancy are synchronized events induced by the short-day photoperiod in grapevine buds

At the end of the summer season, grapevine buds (Vitis vinifera L) grown in temperate climates enter a state of winter recess or endodormancy (ED), which is induced by the shortening of the photoperiod, and during this period, the buds accumulate sucrose. In this study, we investigated whether the shortening of the photoperiod regulates the accumulation of sucrose in the buds in the same way as it regulates its entry into the ED. Because sucrose accumulation is regulated by genes that control its transport and degradation, the effect of the SD photoperiod and the transition of buds from paradormancy (PD) to ED on the expression of sucrose transporter (VvSUTs) and invertase genes (VvINVs) was studied. To analyze the possible role of sucrose during ED development, its effect on bud swelling and sprouting was studied on dormant and nondormant buds under forced growth conditions. The results showed that the SD photoperiod upregulates the expression of the VvSUT genes and downregulates that of the VvINV genes in grapevine buds. Additionally, during the transition of buds from PD to ED, the sucrose content increased, the expression of the VvINV genes decreased, and the expression of the VvSUT genes did not change significantly. Sucrose delayed bud swelling and sprouting when applied to dormant buds but had no effect when applied to nondormant buds. Therefore, we concluded that ED development and sucrose accumulation were synchronized events induced by the SD photoperiod and that a sucrose peak marks the end of ED development in grapevine buds.

Insight into Carbohydrate Metabolism and Signaling in Grapevine Buds during Dormancy Progression.

Perennial fruit crops enter dormancy to ensure bud tissue survival during winter. However, a faster phenological advancement caused by global warming exposes bud tissue to a higher risk of spring frost damage. Tissue dehydration and soluble sugars accumulation are connected to freezing tolerance, but non-structural carbohydrates also act as metabolic substrates and signaling molecules. A deepened understanding of sugar metabolism in the context of winter freezing resistance is required to gain insight into adaptive possibilities to cope with climate changes. In this study, the soluble sugar content was measured in a cold-tolerant grapevine hybrid throughout the winter season. Moreover, the expression of drought-responsive hexose transporters VvHT1 and VvHT5, raffinose synthase VvRS and grapevine ABA-, Stress- and Ripening protein VvMSA was analyzed. The general increase in sugars in December and January suggests that they can participate in protecting bud tissues against low temperatures. The modulation of VvHT5, VvINV and VvRS appeared consistent with the availability of the different sugar species; challenging results were obtained for VvHT1 and VvMSA, suggesting interesting hypotheses about their role in the sugar–hormone crosstalk. The multifaceted role of sugars on the intricate phenomenon, which is the response of dormant buds to changing temperature, is discussed.

An Evaluation of Nuclei Preparation of the Dormant Axillary Bud of Grapevine for Cell Cycle Analysis by Flow Cytometry.

Whether the division of cells of a dormant meristem may be arrested, e.g., in the G1 phase, has proven to be an extremely difficult hypothesis to test. This is particularly so for woody perennial buds, where dormant and quiescent states are diffuse, and the organ may remain visibly unchanged for 6–9 months of the year. Flow cytometry (FCM) has been widely applied in plant studies to determine the genome size and endopolyploidy. In this study, we present the application of FCM to measure the cell cycle status in mature dormant buds of grapevine (Vitis vinifera cv. Cabernet Sauvignon), which represent a technically recalcitrant structure. This protocol illustrates the optimisation and validation of FCM data analysis to calculate the cell cycle status, or mitotic index, of dormant grapevine buds. We have shown how contamination with debris can be experimentally managed and give reference to the more malleable tomato leaves. We have also given a clear illustration of the primary pitfalls of data analysis to avoid artefacts or false results. Data acquisition and analysis strategies are detailed and can be readily applied to analyse FCM data from other recalcitrant plant samples.

The bud dormancy disconnect: latent buds of grapevine are dormant during summer despite a high metabolic rate.

Grapevine (Vitis vinifera L.) displays wide plasticity to climate; however, the physiology of dormancy along a seasonal continuum is poorly understood. Here we investigated the apparent disconnect between dormancy and the underlying respiratory physiology and transcriptome of grapevine buds, from bud set in summer to bud burst in spring. The establishment of dormancy in summer was pronounced and reproducible; however, this was coupled with little or no change in physiology, indicated by respiration, hydration, and tissue oxygen tension. The release of dormancy was biphasic; the depth of dormancy declined substantially by mid-autumn, while the subsequent decline towards spring was moderate. Observed changes in physiology failed to explain the first phase of dormancy decline, in particular. Transcriptome data contrasting development from summer through to spring also indicated that dormancy was poorly reflected by metabolic quiescence during summer and autumn. Gene Ontology and enrichment data revealed the prevailing influence of abscisic acid (ABA)-related gene expression during the transition from summer to autumn, and promoter motif analysis suggested that photoperiod may play an important role in regulating ABA functions during the establishment of dormancy. Transcriptomic data from later transitions reinforced the importance of oxidation and hypoxia as physiological cues to regulate the maintenance of quiescence and resumption of growth. Collectively these data reveal a novel disconnect between growth and metabolic quiescence in grapevine following bud set, which requires further experimentation to explain the phenology and dormancy relationships.

Climate Change Impacts on Plant Phenology: Grapevine (Vitis vinifera) Bud Break in Wintertime in Southern Italy.

The effects of global warming on plants are not limited to the exacerbation of summer stresses; they could also induce dormancy dysfunctions. In January 2020, a bud break was observed in an old poly-varietal vineyard. Meteorological data elaboration of the 1951–2020 period confirmed the general climatic warming of the area and highlighted the particular high temperatures of the last winter. Phenological records appeared to be significantly correlated to wood hydration and starch reserve consumption, demonstrating a systemic response of the plant to the warm conditions. The eight cultivars, identified by single-nucleotide polymorphism (SNP) profiles and ampelographic description, grown in this vineyard showed different behaviors. Among them, the neglected Sprino, Baresana, Bianco Palmento, and Uva Gerusalemme, as well as the interspecific hybrid Seyve Villard 12.375, appeared to be the most interesting. Among the adaptation strategies to climate changes, the cultivar selection should be considered a priority, as it reduces the inputs required for the plant management over the entire life cycle of the vineyard. Hot Mediterranean areas, such as Salento, are a battlefront against the climate change impacts, and, thus, they represent a precious source of biodiversity for viticulture.

Dynamics of Diaporthe ampelina Conidia Released from Grape Canes that Overwintered in the Vineyard.

Phomopsis cane and leaf spot (PCLS) is an important disease of grapevines that is mainly caused by Diaporthe ampelina. Dispersal dynamics of D. ampelina spores were investigated in two vineyards, one in northern Italy and one in Montenegro, by using spore samplers that collected α- and β-conidia from rain water running off from PCLS-affected canes. The canes were collected from each vineyard, deployed, and overwintered in the corresponding vineyards. In each of three years (2016, 2017, and 2018), conidial dispersal was investigated during one (Montenegro) or two (Italy) growing seasons following the deployment of the PCLS-affected canes. In the first growing season following cane deployment in both vineyards, α-conidia were mostly found in runoff water after grapevine bud break, especially in April and May, and β-conidia were regularly found in numbers comparable to those of α-conidia, most frequently from June to September. In Italy, high numbers of α- and β-conidia were also collected during the second growing season following cane deployment. The dispersal dynamics of α-conidia over time were described by a Gompertz equation using hydrothermal time (i.e., the accumulated effect of temperature on the maturation rate of pycnidia on days in which the number of hours of wetness was ≥6 or 9 h), with R2 and concordance correlation coefficient >0.9. Rain (≥0.2 mm) was a good predictor of conidial dispersal, with an overall accuracy of 0.97. These results increase our understanding of D. ampelina spore dispersal and should be integrated into warning systems for PCLS management.

Determination of the Characteristic Structures of Low Temperature Exotherm in Grapevine Buds and Their Relationship with the Bud Structure

Determination of the Characteristic Structures of Low Temperature Exotherm in Grapevine Buds and Their Relationship with the Bud Structure

Identifying reliable methods for evaluating cold hardiness in grapevine buds and canes

Identifying reliable methods for evaluating cold hardiness in grapevine buds and canes