Germination Failure Research Articles

Biological treatment of nitrate-contaminated groundwater by Bacillus subtilis: The potential use of treated groundwater as agricultural irrigation water

High levels of nitrate (NO3-) pollution in groundwater can cause potential health problems. In this study, a novel concept for groundwater treatment was designed and implemented for: i) the biological treatment of real nitrate-contaminated groundwater and ii) the use of treated groundwater to enhance plant growth. Plant growth-promoting rhizobacteria (PGPR; Bacillus subtilis) were used to investigate the effect of nitrate on bacterial growth in nitrate-contaminated groundwater. No significant effect of cations on bacterial growth was observed, whereas the presence of nitrate in the growth medium significantly increased the growth rate after 40 h-incubation. The OD600 value of high concentrations of nitrate (100 mg/L) was almost 1.4-fold smaller than that of low concentrations of nitrate (i.e., 10 mg/L) owing to its toxic effects at high concentrations. Plant growth experiments showed that the dried biomass weight of kidney beans watered with B. subtilis-treated groundwater was almost 1.7- to 2.0-fold higher than that of other treated samples, whereas germination failure was observed when plants were directly watered with nitrate-contaminated groundwater. The novel findings of this study highlight the application of B. subtilis for the aerobic denitrification of nitrate-contaminated groundwater and its potential for use in treating nitrate-contaminated groundwater for enhanced plant growth.

Arabidopsis DNA glycosylase MBD4L improves recovery of aged seeds.

DNA glycosylases initiate the base excision repair (BER) pathway by catalyzing the removal of damaged or mismatched bases from DNA. The Arabidopsis DNA glycosylase methyl-CpG-binding domain protein 4 like (MBD4L) is a nuclear enzyme triggering BER in response to the genotoxic agents 5-fluorouracil and 5-bromouracil. To date, the involvement of MBD4L in plant physiological processes has not been analyzed. To address this, we studied the enzyme functions in seeds. We found that imbibition induced the MBD4L gene expression by generating two alternative transcripts, MBD4L.3 and MBD4L.4. Gene activation was stronger in aged than in non-aged seeds. Seeds from mbd4l-1 mutants displayed germination failures when maintained under control or ageing conditions, while 35S:MBD4L.3/mbd4l-1 and 35S:MBD4L.4/mbd4l-1 seeds reversed these phenotypes. Seed nuclear DNA repair, assessed by comet assays, was exacerbated in an MBD4L-dependent manner at 24 h post-imbibition. Under this condition, the BER genes ARP, APE1L, and LIG1 showed higher expression in 35S:MBD4L.3/mbd4l-1 and 35S:MBD4L.4/mbd4l-1 than in mbd4l-1 seeds, suggesting that these components could coordinate with MBD4L to repair damaged DNA bases in seeds. Interestingly, the ATM, ATR, BRCA1, RAD51, and WEE1 genes associated with the DNA damage response (DDR) pathway were activated in mbd4l-1, but not in 35S:MBD4L.3/mbd4l-1 or 35S:MBD4L.4/mbd4l-1 seeds. These results indicate that MBD4L is a key enzyme of a BER cascade that operates during seed imbibition, whose deficiency would cause genomic damage detected by DDR, generating a delay or reduction in germination.

Environmental and seed-position effects on viability and germination of buried seeds of an invasive diaspore-heteromorphic annual grass.

Environmental factors, such as temperature and moisture, and plant factors, such as seed position on the mother plant, can affect seed viability and germination. However, little is known about the viability and germination of seeds in different positions on the mother plant after burial in soil under natural environmental conditions. Here, diaspores from three positions on a compound spike and seeds from two/three positions in a diaspore of the invasive diaspore-heteromorphic annual grass Aegilops tauschii were buried at four depths for more than 2 years (1-26 months) under natural conditions and viability and germination monitored monthly. Viability of seeds in each diaspore/seed position decreased as burial depth and duration increased and was associated with changes in soil temperature and moisture. Germination was highest at 2 cm and lowest at 10 cm soil depths, with peaks and valleys in autumn/spring and winter/summer, respectively. Overall, seeds in distal diaspore and distal seed positions had higher germination percentages than those in basal diaspore and basal seed positions, but basal ones lived longer than distal ones. Chemical content of fresh diaspores/seeds was related to diaspore/seed position effects on seed germination and viability during burial. We conclude that seeds in distal diaspores/seed positions have a 'high risk' strategy and those in basal positions a 'low risk' strategy. The two risk strategies may act as a bet-hedging strategy that spreads risks of germination failure in the soil seed bank over time, thereby facilitating the survival and invasiveness of A. tauschii.

PREVALENCE AND ALLELOPATHIC EFFECT OF PARTHENIUM HYSTEROPHORUS ON CROPS IN SOUTHWEST REGIONS OF BANGLADESH

Periodical weed surveys were conducted during 2020-21in Jashore, Jhenaidah, Chuadanga, Meherpur and Khustia districts of Bangladesh to observethe severity and allelopathic effect of Parthenium hysterophorus on field crops. Parthenium infected the crops differently as observed in rice ( 8.75), maize (11.45%), lentil (12.45%), chickpea (32.40%), field pea (57.63%), jute (57.63%), cotton (13.45%), mustard (63.85%), sesame (17.50%), groundnut (28.35%), pointed gourd(11.50%), pumpkin (8.45%),onion (30.47%), garlic(26.25%), turmeric (17.50%), potato (38.75%), banana(24.33%), sugarcane (60.25%), napiergrass (55.00%) and marigold (11.25%).Allelopathic effect was examinedusing 5% aqueousleaf extract of P. hysterophorus ingermination test and results showedcomplete failure of germination in seeds of sesame, jute, pumpkin, red amaranth, chili, radish and tomato. Seeds of other crops germinated poorly in aqueous solution of parthenium with reduced radicle and plumule growth. Among the different crops, wheat had the highest reduction in radicle (96%) and plumule (94%) length compared to their control.

First Report of Seedling Damping-Off of industrial Hemp (Cannabis sativa L.) caused by seed-transmitted Alternaria rosae in Italy.

In the years 2020-2021 as part of the activity of the Campania region hemp fiber project, variety comparison trials were carried out on 7 hemp varieties among those relevant for bast fiber production. During the trials, in particular on the cv. Fibrante, a consistent problem was noted: a noticeable germination failure (80-90%) occurred during the emergence of seedlings. Therefore, experiments were conducted to ascertain the possible presence of seed-borne pathogens. Tests were carried out on 100 seeds that were surface disinfected with 2% sodium hypochlorite solution for 3 min, rinsed in sterile distilled water three times and dried on sterile filter paper. The seeds were plated on potato dextrose agar (PDA Oxoid™) amended with 100 mg L-1 of streptomycin sulphate, kept at 24°C in the dark and observed daily. Growing colonies were subcultured on PDA for 10 days and, subsequently, twenty purified fungal isolates were obtained by single spore isolation. Colonies of these isolates on PDA were initially grayish-white and then turned dark olive green with abundant cotton-like aerial hyphae. On potato carrot agar (PCA) medium, these isolates produced light brown and solitary conidiophore with septum. Conidia were obclavate or pyriform, brown, with 1-3 transverse septa and 0-3 longitudinal septa, and measured 12.5 to 28.5 × 5 to 15 µm (n=50). The morphological characteristics observed under the light microscope were consistent with that of Alternaria spp. (Simmons 2007). In order to characterize the representative isolate, total DNA was extracted using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and 3 genes were PCR-amplified: the ITS spacer using the primer pair ITS1-ITS4 (White et al., 1990), the transcription elongation factor 1- using the primer pair EF1-983F/ EF1-2218R (Rehner and Buckley., 2005) and the RNA polymerase II second largest subunit (RPB2) using the primer pair RPB2-5F2/fRPB2-7cR (Sung et al 2007; Liu et al 1999). The size-expected amplicons were purified and sequenced at the BMR Genomics (Padova, Italy) and the resulting sequences were deposited in GenBank under the accession numbers ON556507, ON601003, ON601004. BLAST-n analysis revealed 98 to 99% nucleotide identity with some representative isolates of Alternaria rosae E.G. Simmons & C.F. Hill (KU375630.1, XM_046169884.1, XM_046168987.1). To fulfill Koch's postulates, 100 hemp-certified seed were disinfected as mentioned above, left to germinate on the water-agar to discard potentially infected seeds and finally sowed in sterile peat-soil mix (1:1 v/v). The inoculum consisted of 10 mL of 105 conidial suspension obtained by the representative isolate (Ar_H1). Negative control seeds were inoculated with sterile water. After 5-7 days 100% of inoculated seedlings showed weak germinative vigor with yellowing of the epicotyls and dark areas on the root. The tissue narrowed and turned necrotic with abundant white mycelium covering the entire seedling. Small pieces of necrotic roots were plated on PDA and the same Alternaria-like colonies grew in 10 days. DNA sequencing confirmed the presence of A. rosae. Alternaria spp. are fungi that produce a wide range of toxic metabolites, harmful to food safety in the food uses of the seed. This finding further highlights that the quality of the hemp seed must be considered as a priority aspect in the entire hemp supply chain. To the best of our knowledge, this is the first report of A. rosae as seed-borne fungus on hemp.

Multiple omics datasets reveal significant physical and physiological dormancy in alfalfa hard seeds identified by multispectral imaging analysis

Physical dormancy (PY) commonly present in the seeds of higher plants is believed to be responsible for the germination failure by impermeable seed coat in hard seeds of legume species, instead of physiological dormancy (PD). In this study, a non-destructive approach involving multispectral imaging was used to successfully identify hard seeds from non-hard seeds in Medicago sativa, with accuracy as high as 96.8%–99.0%. We further adopted multiple-omics strategies to investigate the differences of physiology, metabolomics, methylomics, and transcriptomics in alfalfa hard seeds, with non-hard seeds as control. The hard seeds showed dramatically increased antioxidants and 125 metabolites of significant differences in non-targeted metabolomics analysis, which are enriched in the biosynthesis pathways of flavonoids, lipids and hormones, especially with significantly higher ABA, a hormone known to induce dormancy. In our transcriptomics results, the enrichment pathway of “response to abscisic acid” of differential expressed genes (DEG) supported the key role of ABA in metabolomics results. The methylome analysis identified 54,899, 46,216 and 54,452 differential methylation regions for contexts of CpG, CHG and CHH, and 344 DEGs might be regulated by hypermethylation and hypomethylation of promoter and exon regions, including four ABA- and JA-responsive genes. Among 8% hard seeds in seed lots, 24.5% still did not germinate after scarifying seed coat, and were named as non-PY hard seeds. Compared to hard seeds, significantly higher contents of ABA/IAA and ABA/JA were identified in non-PY hard seeds, which indicated the potential presence of PD. In summary, the significantly changed metabolites, gene expressions, and methylations all suggested involvement of ABA responses in hard seeds, and germination failure of alfalfa hard seeds was caused by combinational dormancy (PY + PD), rather than PY alone.

Kaempferol-3-rhamnoside overaccumulation in flavonoid 3'-hydroxylase tt7 mutants compromises seed coat outer integument differentiation and seed longevity.

Seeds slowly accumulate damage during storage, which ultimately results in germination failure. The seed coat protects the embryo from the external environment, and its composition is critical for seed longevity. Flavonols accumulate in the outer integument. The link between flavonol composition and outer integument development has not been explored. Genetic, molecular and ultrastructural assays on loss-of-function mutants of the flavonoid biosynthesis pathway were used to study the effect of altered flavonoid composition on seed coat development and seed longevity. Controlled deterioration assays indicate that loss of function of the flavonoid 3' hydroxylase gene TT7 dramatically affects seed longevity and seed coat development. Outer integument differentiation is compromised from 9 d after pollination in tt7 developing seeds, resulting in a defective suberin layer and incomplete degradation of seed coat starch. These distinctive phenotypes are not shared by other mutants showing abnormal flavonoid composition. Genetic analysis indicates that overaccumulation of kaempferol-3-rhamnoside is mainly responsible for the observed phenotypes. Expression profiling suggests that multiple cellular processes are altered in the tt7 mutant. Overaccumulation of kaempferol-3-rhamnoside in the seed coat compromises normal seed coat development. This observation positions TRANSPARENT TESTA 7 and the UGT78D1 glycosyltransferase, catalysing flavonol 3-O-rhamnosylation, as essential players in the modulation of seed longevity.

TrLys9 participates in fungal development and lysine biosynthesis in Trichoderma reesei.

Fungi uniquely synthesize lysine through the α-aminoadipate pathway. The saccharopine reductase ScLys9 catalyzes the formation of saccharopine from ɑ-aminoadipate 6-semialdehyde, the seventh step in the lysine biosynthesis pathway in Saccharomyces cerevisiae. Here, we characterized the functions of TrLys9, an ortholog of S. cerevisiae ScLys9 in the industrial filamentous fungus Trichoderma reesei. Transcriptional level analysis indicated that TrLYS9 expression was higher in the conidial stage than in other stages. Disruption of TrLYS9 led to lysine auxotrophy. Phenotype analysis of the ΔTrlys9 mutant showed that TrLYS9 was involved in fungal development including vegetative growth, conidiation, and conidial germination and lysine biosynthesis. Cellulase production was also impaired in the ΔTrlys9 mutant due to the failure of conidial germination in liquid cellulase-inducing medium. Defects in radial growth and asexual development of the ΔTrlys9 mutant were fully recovered when exogenous lysine was added to the medium. These results imply that TrLys9 is involved in fungal development and lysine biosynthesis in T. reesei.

Effects of damping-off fungus on seed germination of amaranth (Amaranthus Hybridus)

Seed borne pathogens are microorganisms that can prevent seed germination and cause serious threats to seedling development in the field. The research was conducted on the effects of damping off fungus on seed germination of Amaranth (Amaranthus hybridus) collected from some Agricultural farmland in Lapai Local Government Area of Niger State, North central Nigeria. The isolation of fungal species from Amaranthus hybridus seeds of the infected plants having symptoms of damping off disease using agar plate method and was identified using the morphological characteristics features from mycological atlas. Isolation from the infected seeds revealed that Rhizoctonia solani were associated with the plants. Seed weight (mg) and seed germination (%) were determined using the international rules for seed testing and the physiological seed quality indices were determined; these are germination index (GI), germination rate index (GRI) and seedling vigor index were arranged in Randomized Complete Block Design (RCBD) all in triplicates. The result indicated that seeds from uninfected plants recorded seed weight (8.97mg) as compared with the infected seeds (5.21mg), there was significantly higher germination (98.67%) observed in uninfected seeds compared with seeds of Amaranthus plants that were infected (32.13%) with damping off fungus. Germination index was observed to be higher in seeds of uninfected plants (9.34) and lower in seeds of infected plants (4.34). The significant effects observed of the fungus on both seed and seedlings are highly virulence on the infected plants. The research revealed that a very good association between Rhizoctonia solani causing damping off disease and seed germination failure of Amaranthus hybridus plants. In the cultivation of Amaranthus hybridus, seed weight, and physiological seed quality attributes should be considered for an effective damping off disease suppression.

FUSARIUM SPECIES FROM AN INDONESIAN GENOTYPE OF FOXTAIL MILLET SEEDS

<p class="abstrakinggris"><span lang="EN-US">As a generalist pathogen in cereals, <em>Fusarium </em>spp. become the most threatening fungi which can conduct its saprogenesis by infecting seeds. Determination of fungal identity and the yield loss risk is needed to modify the effective controlling strategies. However, there is no report on implementing methods for controlling <em>Fusarium </em>spp. on foxtail millet (<em>Setaria italica </em>L. Beauv.). This research was undertaken from July to September 2020 and November to December 2021 under ambient laboratory conditions to identify and evaluate the pathogenicity of seed-borne <em>Fusarium </em>species in foxtail millet. One hundred colonies of seed-borne fungi were isolated from foxtail millet genotype ICERI-6 which was dominated by <em>Fusarium </em>spp. Morphological characterization by observing the structure of colonies and microscopical features indicated that the six isolates (Fu1–Fu6) were identical to <em>Fusarium solani, F. chlamydosporum, F. oxysporum, F. equiseti, F. proliferatum, </em>and <em>F. graminearum</em>, respectively.<em> </em>Molecular identification for the 5.8s rDNA target gene with ITS1 and ITS4 primers has confirmed that the <em>Fusarium</em> spp. were determined as mentioned species. Pathogenicity test using potato dextrose agar medium showed that the germination percentage of seed inoculated by <em>Fusarium</em> spp. was only 1.2% on average at 7 days after incubation. These species led to germination failure as the seeds were covered by fungal mycelia. Seeds that could escape from germination failure performed necrotic spots on the seedlings. These abnormalities would contribute to low productivity in the field. The study has implication in controlling seed-borne disease and that resistant variety breeding becomes important issues to be addressed for future research.</span></p>

Tree recruitment after native frugivore extinction? A field experiment to test the impact of fruit flesh persistence in a tropical oceanic island

AbstractThe loss of large frugivores leads to seed dispersal loss and regeneration failure of numerous large-seeded trees near mother trees. Although Janzen–Connell effects are considered as the primary underlying cause, other factors remain understudied. Here, we used a field experiment to test the impact of flesh persistence on the recruitment of two large-seeded Sapotaceae species that lost their dispersers. In the rainforest of Mare Longue (Réunion), we sowed 3840 seeds in a four-factor design: seed treatment (seed cleaning; flesh persistence), canopy closure (understory; gap), year of sowing (01/2018; 11/2019) and species (Labourdonnaisia calophylloides, Mimusops balata). We also used camera traps to evaluate the impact of extant vertebrates. Seed treatment was by far the most influential factor: flesh persistence led to seedling recruitment divided by 3,2 on average, mainly due to failure of germination or seedling emergence. There were also significant variations in recruitment between species, years and canopy closure levels, notably due to the behaviour of the invasive fauna, especially giant snails that could unexpectedly restore recruitment by feeding on fruit flesh. Together, our results demonstrate strongly depleted recruitment due to flesh persistence and the importance of field experiments to understand the processes at work in complex ecosystems with novel plant–animal interactions.

Why is the Shaw's Agave (Agave shawii subsp. Shawii) Not Reproducing? Investigating a Rare Species' Pollination and Germination in a Fragmented Urban Park

Shaw's Agave (Agave shawii subsp. shawii) is a rare plant found in only a handful of occurrences within the extreme southwestern corner of the USA in a highly urbanized region. Seedling recruitment of Shaw's Agave in California is visibly low, and viable seed production appears to have been very low in recent years, and has been identified as a primary threat to the persistence of these populations. We performed pollination trials, seed germination studies, and inventoried floral visitors and potential pollinators (including the collection of invertebrates) to determine if pollination and/or germination failure is limiting reproduction. We placed bat detectors and camera traps near blooming agaves, and observed bird and insect visitation to the flowers. Pollination treatments included hand pollination with cross-individual and selfing trials. Our results found a low amount of seed produced per fruit across the pollination trials. Seedling herbivory was also very high (85% and 100%) in the two treatments. The combination of low seed set and high herbivory may help explain the lack of recruitment observed at multiple sites in recent years. No nectar feeding bats utilized the Shaw's agave in our study area. The only significant insect visiting flowers was the honey bee (Apis mellifera), which gathered nectar without touching the anthers. Hummingbird species were also frequent visitors but generally avoided touching the agave anthers. Only the Hooded Oriole (Icterus cucullatus), a migratory bird, appeared to regularly visit flowers for their nectar, while standing on the flowers and brushing against the anthers, potentially providing some pollination but only for plants blooming during the period the oriole is present in the region. Seedling predation was significant, and poses a considerable threat to this population. Further research into seed set and pollination treatments is recommended.

Risks affecting hybrid rice yield in Bangladesh: two-tier approach of appraisal and management

Purpose: Bangladesh faces a growing food demand from a growing population under the continuous shrinking of arable land. Most Bangladeshi farmers produce inbred rice. Hybrid rice has been shown, in China, to be far more productive per hectare. Bangladesh cannot feed itself long-term without ample produce of hybrid rice. Yet, fewer Bangladeshi farmers are growing hybrid rice at present; they perceive hybrid rice cultivation as too risky. The present study was conducted to define the yield risks of hybrid rice and develop management strategies to allow hybrid rice to contribute more to food production. Research Method: Both quantitative and qualitative methods were used to evaluate the risks of hybrid rice production from the farmers’ perspective and the experts’. Three hundred fifty-four randomly-sampled hybrid rice farmers were interviewed with key informants, focus group discussions, experts’ opinion surveys, and workshops. A fuzzy triangular scale was used in calculating the yield risks of hybrid rice production. Findings: From the results, unexpected yield performance, germination failure, unavailability of seed in sowing seasons, and crop failure due to pest infestation were identified as the critical yield risks. A regression model determined that education, family income, innovativeness, hybrid rice cultivation experience, and rice selling in public procurement are lower yield risks in growing hybrid rice. Therefore, educated farmers from high-income families, innovative farmers, experienced farmers, and farmers who sell rice in public procurement face lower yield risk in hybrid rice production. Originality/value: This study mainly identified the critical risk and management strategies for hybrid rice production in Bangladesh. The policy advises encouraging hybrid rice cultivation by reducing yield risk, which is also offered.

Seed security among smallholder farmers in semi-arid Ghana

The Intergovernmental Panel on Climate Change's recent projections indicates that sensitivity to climate risks is likely to increase in the coming decades, with more erratic rainfall, prolonged dry periods, shorter growing seasons, and seed germination failures. The impacts of these risks on food, nutrition, and seed security among smallholder households are well-documented in literature. However, in the African context, the mechanisms through which the intersection of these ecological stressors and other factors affect seed security are poorly understood. We used a case study of semi-arid Ghana to examine seed security among smallholder farmers. We adopted a mixed-methods approach with intensive fieldwork in two farming villages. The study used multinomial logistic regression and qualitative interviews to understand how climatic and non-climatic factors determine seed security. Data collection methods included a household survey (n = 429), and in-depth interviews integrated with human-environment timelines (n = 20). Overall, the findings show that the significant determinants of seed security in semi-arid Ghana include village location, access to information, access to credit, and access to tractor plowing services. The results further showed that seed security is often disrupted by factors other than climate change, including farmer-herder conflicts, and the use of synthetic farming inputs. We found that some of the identified determinants are also evident in related food security studies. Ultimately, we argue that holistic efforts to resolving such factors is required to achieve both seed and food security among smallholders.

Germination and growth responses to water stress of three agroforestry tree species from Bangladesh

Globally, tree plantations are considered one of the most effective solutions in tackling the climate crisis, and by incorporating trees, agroforestry plays an essential role in mitigating climate change. However, the productivity and sustainability of this commendable solution are often impeded by the wide range of abiotic stresses, including drought. Species selection is always considered as one of the major challenges in a drought-prone area to ensure maximum productivity and halting tree mortality. In this study, seedling responses such as germination, survival, and growth were examined for Swietenia macrophylla, Acacia nilotica and Pithecellobium dulce in variable soil moisture regimes with 100%, 50% and 25% soil water content (SWC). Despite complete failure of germination at 25% SWC, S. macrophylla showed a significantly higher germination percent at both 100% and 50% SWCs (p < 0.05). Irrespective of species, the 25% SWC showed reductions of germination percent, survivability and total dry biomass in comparison with the higher moisture regimes. The study also showed that P. dulce and A. nilotica seedlings were able to survive and maintain growth at low moisture regimes. The significant interaction effect in most parameters highlighted that both species and moisture regimes played an important role in germination and total biomass production, but this interaction had an insignificant effect on the survivability of all species. The result from this study highlights that species-specific responses to water stress could contribute to the species selection policies in drought-prone areas.

Allelopathic, Phytotoxic, and Insecticidal Effects of Thymus proximus Serg. Essential Oil and Its Major Constituents.

The chemical profile of Thymus proximus essential oil (EO) and its allelopathic, phytotoxic, and insecticidal activity was evaluated. Carvacrol, p-cymene, and γ-terpinene were detected as the major components of the EO, representing 85.9% of the total oil. About 50 g fresh plant material of T. proximus in a 1.5-L air tight container completely inhibited the seed germination of Amaranthus retroflexus and Poa anuua. Meanwhile, the EO exhibited potent phytotoxic activity, which resulted in 100% germination failure of both the test species when 2 mg/ml (for A. retroflexus) and 5 mg/ml (for Poa annua) oil was applied. The EO also triggered a significant insecticidal activity on Aphis gossypii with a LC50 value of 6.34 ppm. Carvacrol was identified as the main active compound responsible for both the plant suppressing effect and the insecticidal activity of the EO. Our study is the first on the allelopathic, phytotoxic, and insecticidal activity of T. proximus EO, and the determination of the responsible compound, which indicated their potential of being further explored as environment friendly biopesticides.

Bioefficacy of Piper extracts in the management of chilli anthracnose

Chilli anthracnose, caused by a complex of Colletotrichum species, is a major disease of chilli worldwide. The objective of this research was to evaluate the efficacy of crude extracts obtained from plants in the genus Piper (Piperaceae) in a reduction of chilli anthracnose severity under controlled conditions. Inhibitory effects of the extracts were preliminary screened against Colletotrichum capsici and C. gloeosporioides on the agar medium using the disc diffusion technique. The crude extracts were obtained from either leaves or stems of 25 species of Piper, and each part of the plant was extracted with ethyl acetate and ethanol. From a total of 91 samples screened, the mycelial growth of C. capsici and C. gloeosporioides was suppressed by 12 and 13 crude extracts, respectively. The effective extracts were further studied at varying concentrations for their ability to decrease anthracnose severity. The experiments were conducted on detached red fruits and attached leaves, and each Piper extract was applied 24 h before inoculation with the pathogen. The effective concentrations of most extracts used in the fruit treatment varied from 40 to 100 mg/mL, while the concentration of all extracts in the leaf treatment was 10 mg/mL. Among nine species of Piper evaluated in vivo, P. betle, P. retrofractum, and P. griffithii showed the maximum reduction of disease severity to pathogen infestation. Scanning electron microscope (SEM) observations on the effect of the P. griffithii crude extract on C. gloeosporioides revealed significant effect on the morphological characteristics of conidia, resulting in the failure of germination and pathogen growth.

Assessment of plant growth performance and nutrient release for application of phosphorus-loaded layered double hydroxides as fertilizer

Abstract Seed germination and early growth assays of lettuce (Lactuca sativa L.) were used as means in the evaluation of different dosage performances of P-loaded layered double hydroxides (P-LDHs). Of these two experiments, results from the former showed that P-LDH application at lower concentrations (0.5 and 1.0 g) influenced the slightly delayed germination, which decreased by no more than approximately 12% compared to that of untreated seeds, whereas the total germination failure was observed once seeds were established with higher ones (2.5 and 5.0 g) because of Al toxicity. Statistical analysis also revealed that a significant dose-dependent inhibition of seed germination was attained after P-LDH administration of at least 1.0 g. On the contrary, beneficial effects were obtained in the successive experiments, where P-LDHs at 0.5, 1.0, 2.5, and 5.0% (w/w) were applied to the growing media. P-LDHs applied at 1.0% outperformed other treatments as well as the control in stimulating plant improvement. The length of lettuce shoots and roots was improved by at least 6.75% compared to those of the non-treated samples and by 10.80% to 30.83% compared with other application rates. The greatest biomass accumulation (1.723 g) was also found in lettuce supplemented with 1.0% of P-LDHs, whereas those without P-LDHs reached their lowest fresh weight (1.422 g). In this experiment, an inadequate supply of Mg could be detrimental to plants from the last two treatment groups. In addition, findings of nutrient leaching verified that P stored in these products was released slowly, and thus they were able to deliver this essential nutrient to plants gradually over a longer period. In summary, this study pointed out that post-adsorption LDHs did not have the ability to boost seed germination, regardless, they could be reused as an agricultural fertilizer to encourage crop quality cultivated under substrate or soil conditions, where an application rate of 1.0% (w/w) was recommended in order to avoid the exposure of excess nutrient levels to the targeted plants.

First report of rhizome rot of banana caused by Klebsiella variicola in India.

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

High-temperature Stress and the Fate of Pollen Germination and Yield in Lentil (Lens culinaris Medikus)

Background: High temperatures adversely affect the growth and development of plants at vegetative, reproductive and maturity stages of their life cycle. The maximum air temperature of higher than 25oC frequently encountered in lentil at the reproductive stage mainly in West Bengal rice-lentil cropping pattern. Such high temperatures in rabi season impair the crop growth and productivity. Added to this, future climate predictions are indicating 27-28oC during this period. Methods: The field-laboratory experiment was conducted during 2014, with 20 genotypes of lentil. The field experiment was laid in split plot design with 3 different windows of sowing, while the laboratory investigation was carried out in completely randomized design with pollen collected from the field experiment.Result: The present investigation reveals that high air temperature greater than 25oC resulted in the failure of pollen germination, increase in abnormal pollen tube and aborted pollen. A drastic effect in seed filling and pod development in lentil was observed. Out of 20 lentil genotypes studied, ILL-10893 and L-13-113 emerged as tolerant genotypes while, BM-6 and L-4076 as susceptible with special emphasis on physiological characters.