Genetic Polymorphisms In Patients Research Articles

The role of tissue persistent organic pollutants and genetic polymorphisms in patients with benign and malignant kidney tumors

This study aimed to explore whether there is an association between environmental exposure to POPs and kidney tumor induction, and whether blood POP concentrations reflect kidney tissue concentrations. POP derivatives were determined in blood, tumor tissue, tumor surrounding tissue, and perirenal fat tissue samples taken from patients who underwent surgery for renal tumors. A voluntary control group was recruited for blood and urine samples as well. Urinary excretions of o,o′-dityrosine, chlorotyrosine, nitrotyrosine, and 8-OHdG were measured in the same patients. The possible role of genetic polymorphisms in CYP1A1, GST isozymes P, M, and T, and hOGG1 genes on the predisposition to renal cancer was investigated. Some POPs have been found to be associated with kidney cancer, as evidenced by their significantly high ORs. 8-OHdG levels were significantly higher compared to the control group. The GSTT1 null polymorphism can be a risk factor for malignant but not for benign kidney tumors.

Tumor necrosis factor‑α ‑308 G/A genetic polymorphism in patients with chronic obstructive pulmonary disease presenting with hyperactive airways.

Chronic obstructive pulmonary disease (COPD) is the fourth leading cause of death worldwide. COPD is often diagnosed late in the disease leading to a delay in management. Notably, tumor necrosis factor-α (TNF-α) polymorphisms may serve an important role in the development of COPD. A single-center, case-control study was conducted to determine the presence of the TNF-α -308 G/A polymorphism among patients diagnosed with COPD presenting with hyperactive airways, patients without COPD presenting with hyperactive airways, and normal study participants without pulmonary comorbidities. Three genotypes: G/G (94%; 157/167), G/A (5%; 9/167) and A/A (1%; 1/167) were detected by quantitative PCR. The present study showed that the presence of the TNF-α -308 G/A polymorphism reduced the odds of having hyperactive airways with COPD by 29.3% and hyperactive airways without COPD by 26.3%. Multinomial logistic regression analysis showed that having the TNF-α -308 G/A polymorphism did not significantly reduce the odds of having hyperactive airways with COPD and without COPD compared to those with the G/G genotype. In conclusion, the presence of the TNF-α -308 G/A gene polymorphism showed no significant association with patients with COPD with or without hyperactive airways. The presence of the TNF-α -308 G/A polymorphism instead had a weak association with the reduction in the development of COPD regardless of the presence or absence of airway hyperactivity.

Novel progressive deep learning algorithm for uncovering multiple single nucleotide polymorphism interactions to predict paclitaxel clearance in patients with nonsmall cell lung cancer.

The rate at which the anticancer drug paclitaxel is cleared from the body markedly impacts its dosage and chemotherapy effectiveness. Importantly, paclitaxel clearance varies among individuals, primarily because of genetic polymorphisms. This metabolic variability arises from a nonlinear process that is influenced by multiple single nucleotide polymorphisms (SNPs). Conventional bioinformatics methods struggle to accurately analyze this complex process and, currently, there is no established efficient algorithm for investigating SNP interactions. We developed a novel machine-learning approach called GEP-CSIs data mining algorithm. This algorithm, an advanced version of GEP, uses linear algebra computations to handle discrete variables. The GEP-CSI algorithm calculates a fitness function score based on paclitaxel clearance data and genetic polymorphisms in patients with nonsmall cell lung cancer. The data were divided into a primary set and a validation set for the analysis. We identified and validated 1184 three-SNP combinations that had the highest fitness function values. Notably, SERPINA1, ATF3 and EGF were found to indirectly influence paclitaxel clearance by coordinating the activity of genes previously reported to be significant in paclitaxel clearance. Particularly intriguing was the discovery of a combination of three SNPs in genes FLT1, EGF and MUC16. These SNPs-related proteins were confirmed to interact with each other in the protein-protein interaction network, which formed the basis for further exploration of their functional roles and mechanisms. We successfully developed an effective deep-learning algorithm tailored for the nuanced mining of SNP interactions, leveraging data on paclitaxel clearance and individual genetic polymorphisms.

Immune system parameters in patients with chronic opistorchiasis based on genetic polymorphism associated with carbohydrate and lipid metabolism disorders

A study assessing differences in the immunopathogenesis of chronic opisthorchiasis with or without genetic polymorphisms in patients associated with predisposition to type II diabetes mellitus and lipid metabolism disorders was carried out. Venous blood samples from 89 patients were collected to analyze immunological parameters and genetic polymorphisms by using pyrosequencing. In the presence of mutations affecting regulation of carbohydrate metabolism, patients with opisthorchiasis had less pronouncedly increased phagocytic activity, a lower monocyte count, higher total T-lymphocyte count, lower T-cytotoxic cell and B-lymphocyte counts, lower IgA, IgG but higher IgM concentration. This indicates a moderately compromised nonspecific resistance, imbalanced effector T- and B-immunity, but in most cases (PPARG, TCF7L2 rs12255372, CDKAL1, CDKN2A/2B, SLC30A8) aggravated humoral immune reaction to invasion particularly revealed by lower B-lymphocyte count. The presence of polymorphisms that alter lipid metabolism regulation bidirectionally affects the parameters of immune response. An increased B-lymphocyte count and other indicators of humoral immune activation to invasion, which are detected in groups with mutations in the APOE (rs429358), PCSK9, ABCA1, APOC3 rs2854117 genes, can contribute to a more effective response to sustained antigenic stimulation. Changes in the T-lymphocytes subpopulations, characteristic of opisthorchiasis invasion, are aggravated in the presence of mutations in the PCSK9, ABCA1, and APOC3 rs2854117 genes. Mutations in the genes APOC3 rs5128, LPL rs268 activate patients’ nonspecific resistance, although this effect may also be associated with exhaustion of neutrophil bactericidal reserve. In general, minor alleles of the APOE (rs429358), APOC3 rs2854117, LPL rs268, LPL rs328, PON1 rs662 genes can be considered “protective” for the immunopathogenesis of chronic opisthorchiasis. Thus, patients with chronic opisthorchiasis with different genotypes predisposing to carbohydrate and lipid metabolism disorders had significant differences in immune system parameters, which can also affect the disease course. Mutations in different loci of the PCSK9, ABCA1, APOE, APOC3, and PON1 genes have opposite effects on the analyzed immune parameters. In the presence of mutations in other genes (PPARG, TCF7L2 rs12255372, CDKAL1, CDKN2A/2B, SLC30A8, LPL), opisthorchiasis invasion leads to more pronounced alterations in immune response; mutations in the lipoprotein lipase gene may have some “protective” immune-related effect in opisthorchiasis. The effect of all studied genetic polymorphisms associated with a predisposition to developing type II diabetes mellitus was predominantly negative.

FNDC5 genetic polymorphism in patients with peripartum cardiomyopathy.

Late in pregnancy or soon after delivery, peripartum cardiomyopathy (PPCM) which is an uncommon type of cardiomyopathy, can develop. To assess the association between the level of irisin expression and (FNDC5) (rs3480) gene polymorphism with peripartum cardiomyopathy. This is a case control study included a thirty female patients with new-onset PPCM and sixty healthy females at the at the peripartum period in same time window for PPCM as a control. For each patient, comprehensive medical history was taken, full clinical assessment was done, ECHO., FNDC5 (rs3480) & Irisin assay. The left ventricle end diastolic dimensions &left atrium diameters were statistically significant higher in patients' group than controls' group (P=0.000 for all), Also left ventricular ejection fraction (%) was statistically significant lower in patients than controls and as regards irisin, its Mean ±SD was lower in patient group than control group (8.44±1.1 vs 10.65±2.31) with (p <0.001) which is considered a significant difference statistically. Irisin level was lower in peripartum cardiomyopathic patients when compared with normal individuals and regarding its genotype, the homotype A/A was higher than homotype G/G.

Cytochrome P450 2C19*2 Genetic Polymorphism in Patients with Acute Coronary Syndrome

Objectives: The study aimed to investigate the association between CP2C19*2 loss of function polymorphism and acute coronary syndrome (ACS) patients receiving Clopidogrel. It compared genotype frequencies of heterozygous GA, homozygous GG, and homozygous AA between ACS patients and healthy controls. The study assessed the statistical significance of the association in the Pakistani cohort. It contributed to understanding the role of genetic polymorphisms in response to Clopidogrel therapy in ACS patients and provided insights into the need for pharmacogenomics testing for patients with CAD, particularly in the Asian population, who are poor metabolizers and require long-term Clopidogrel therapy.&#x0D; Methodology: COHORT Study.&#x0D; Results: The study found no statistically significant association between the CYP2C19*2 loss of function polymorphism and acute coronary syndrome (ACS) in the Pakistani cohort. The frequency of the CP2C19*2 heterozygous GA genotype was 38.3% in ACS patients and 29.5% in control subjects, while the homozygous GG genotype was 58.7% in patients and 59.0% in controls. The homozygous AA genotype was 3.4% in patients and 11.4% in controls.&#x0D; The genotype frequency analysis showed that the wild type GG genotype was lower in patients (58.7%) compared to controls (59.0%), while the mutant AA genotype was also lower in patients (3.4%) compared to controls (11.4%). The heterozygous GA genotype was higher in patients (38.3%) compared to controls (29.5%).&#x0D; The population studied was in Hardy Weinberg equilibrium, with a frequency of mutant allele A at 0.26 and wild type allele G at 0.73.&#x0D; Conclusion: The study concludes that the CYP2C19*2 loss of function polymorphism is not associated with acute coronary syndrome (ACS) in the Pakistani cohort. The distribution of the CP2C19*2 genetic polymorphism was not statistically significant between ACS patients and healthy controls.&#x0D; The genotype frequency analysis showed no significant differences in the distribution of the heterozygous GA, homozygous GG, and homozygous AA genotypes between the patient and control groups.&#x0D; The population studied was in Hardy Weinberg equilibrium, with a frequency of mutant allele A at 0.26 and wild type allele G at 0.73.

Difference of genetic polymorphisms in patients with type 2 diabetes mellitus with absence or presence of chronic heart failure with preserved ejection fraction

Background. It is important to note a close comorbidity of type 2 diabetes mellitus (DM2) and cardiovascular issues, in particular, chronic heart failure (CHF) among the elderly patients. Research of predisposing genes’ polymorphisms allows to connect genotype particularities with the development of such conditions.&#x0D; Aim. Identify genetic polymorphisms in patients with DM2 and CHF with preserved ejection fraction.&#x0D; Materials and methods. Polymorphisms of genes of folate cycle, metabolism, hemostasis, neurohumoral status were studied in 106 patients (age 69.7±10.1 years) with DM2 and hypertension with and without CHF.&#x0D; Results. In patients with DM2 without CHF, the frequency of polymorphisms of these genes is comparable to the population. There are MTHFR: 677 CT, MTR: A2756G, ITGB3: T1565C, PAI-1: -675 5G4G, NOS3: -786 TC, PPARG: C1431T was found in patients with DM2 and CHF, a statistically significant increase in the frequency of gene polymorphisms was found, compared with patients with DM2 without CHF.&#x0D; Conclusion. The identified polymorphisms in patients with type 2 diabetes and CHF with preserved LV ejection fraction are associated with such phenotypic manifestations as: a tendency to thrombophilia, realized through a violation of homocysteine, vascular tone and trophism, immune response, as well as the oxidation of free fatty acids and the activation of the inflammation process.

Assessment of the distribution of PCSK9 E670G genetic polymorphism in patients with heterozygous familial hypercholesterolemia depending on the presence of diabetes mellitus

Assessment of the distribution of PCSK9 E670G genetic polymorphism in patients with heterozygous familial hypercholesterolemia depending on the presence of diabetes mellitus

Plasma Cytokine Levels and Cytokine Genetic Polymorphisms in Patients with Metastatic Breast Cancer Receiving High-Dose Chemotherapy

Differences in the baseline levels of serum cytokines or in single-nucleotide polymorphisms (SNPs) in cytokine genes may be useful to predict outcomes for patients being treated for metastatic breast cancer. We have measured the plasma levels and characterized individual SNPs for IL-1RA, IL-1β, IL-2, IL-6 and TNFα in 130 patients with metastatic breast cancer treated with high-dose chemotherapy. Patients were treated with high-dose cyclophosphamide (Group 1, 74 patients) or high-dose paclitaxel-containing regimens (Group 2, 56 patients). A high plasma level of IL-1RA and a SNP in the IL-1RA gene indicated a better prognosis for patients in Group 1 (but not Group 2). However, the level of plasma IL-1RA did not correlate with the SNP genotype. A high plasma level of IL-6 or TNFα indicated a poorer outcome for patients in Group 1 although the SNP genotypes for the IL-6 and TNFα SNPs were not associated with differences in outcome. The plasma levels of IL-1β and IL-2 and the genotype of the IL-1β SNPs did not indicate differences in outcome. Although, individually, plasma levels of cytokine or “risk” SNP genotypes may not indicate outcome, in combination there was an increased trend to predict outcome for patients treated with high-dose cyclophosphamide but not high-dose paclitaxel. These results suggest that the immune cytokines may be useful as prognostic biomarkers in the treatment of patients with metastatic breast cancer treated with different types of chemotherapy.

Genetic Polymorphism in Patients with Diabetic Nephropathy and Retinopathy: A Cross-sectional Study

Introduction: The chronic persistence of diabetes leads to microvascular complications, such as Diabetic Nephropathy (DN) and Diabetic Retinopathy (DR). Both of these are progressive disorders involving pathological changes in capillaries. A few biochemical pathways have been suggested to link hyperglycaemia and microvascular complications. The probability of developing and progressing DN and DR is associated with the duration of diabetes. These complex disorders are strongly influenced by both genetics and environmental factors. Several candidate genes have been reported to be associated with DN and DR in different populations. Aim: To determine the co-existence of DN and DR in relation to gene polymorphisms of Angiotensin-Converting Enzyme (ACE), Angiotensinogen (AGT), Receptor for Advanced Glycation End-products (RAGE), Aldose reductase (ALR2), and Vascular Endothelial Growth Factor (VEGF). Materials and Methods: The present DN and DR cross-sectional study was conducted at the Department of Endocrinology, University College of Medical Sciences, University of Delhi and GTB, New Delhi, India, and the Discipline of Biochemistry, Indira Gandhi National Open University, New Delhi, India. The study was conducted from October 2019 to August 2022. All the participants under uniform diabetes management were divided into two groups (100 in each group): Group 1 included Type-II diabetic patients with DN and DR, and Group 2 comprised Type-II diabetic patients with DN only. Polymorphisms in all genes were determined using Polymerase Chain Reaction (PCR), followed by digestion with restriction enzymes and visualisation through an ultraviolet transilluminator. The analysis of biochemical parameters and association of gene polymorphisms was performed using Statistical Package for Social Sciences (SPSS) version 26.0 software. Results: There were 57 males and 43 females in the DN+DR group, and 51 males and 49 females in the DN-DR group. The mean age of study subjects in the DN+DR group was 52.60±9.08 years, compared to the DN-DR group (47.33±10.68 years). The DN+DR group had a significantly higher mean duration of diabetes (11.78±6.86 vs. 5.13±4.78, p≤0.001) and a significantly lower mean waist circumference (91.30±13.99 vs. 95.11±9.95 cm, p≤0.02). The DN+DR group also had significantly higher urea (34.34±16.32 vs. 26.43±12.34 cm, p≤0.001), creatinine (1.34±0.90 vs. 0.89±0.25 cm, p≤0.03) and significantly lower estimated Glomerular Filtration Rate (eGFR) levels compared to the DN-DR group. The distribution of genotypes of ALR2 (p≤0.04) and VEGF genes (p≤0.001) showed a significant difference between both DN+DR and DN-DR groups. The frequency of the D allele of the VEGF gene (p≤0.02) (OR=1.94, 95% Confidence Interval (CI)=1.10-3.40) was higher in the DN+DR group. The DN+DR group also had a significantly lower frequency of the CT+TT dominant model of the ALR2 gene (p≤0.04) as well as an increased frequency of the ID+DD dominant model of the VEGF gene (p≤0.002). No significant differences were found in genotypic as well as allelic frequencies of ACE, AGT, and RAGE gene polymorphisms between the two groups. Conclusion: The D allele of the VEGF (I/D) gene polymorphism is significantly associated with DR in patients with DN. It can be concluded that the VEGF gene plays an important role in the development of retinopathy in DN patients.

Cytochrome P450 2C19*2 Genetic Polymorphism in Patients with Acute Coronary Syndrome

This study was designed to determine the association of CP2C19*2 loss of function polymorphism with acute coronary syndrome patients receiving clopidogrel. After getting informed consent signed by the participants, 5ml of intravenous blood was collected from 112 acute coronary syndrome patients and 105 healthy controls. CYP2C19*2 genetic polymorphism was determined by polymerase chain reaction followed by restriction fragment length polymorphism. The frequency of CP2C19*2 heterozygous GA was 38.3%, homozygous (wild type) GG was 58.7% and homozygous (mutant) AA was 3.4% in patients while in control subjects the frequency of heterozygous GA was 29.5%, homozygous GG was 59.0% and homozygous AA was 11.4% (p= 0.3513, OR 1.2927, 95% CI 0.75-2.21). The result shows no statistical significance in terms of the distribution of this genetic polymorphism between acute coronary syndrome patients and control individuals. These results suggest that the CYP2C19*2 loss of function polymorphism is not associated with acute coronary syndrome in this Pakistani cohort

Genetic polymorphism of clopidogrel metabolism related gene CYP2C19 gene in Chinese from Foshan area of Guangdong Province

ABSTRACT Background: The CYP2C19 gene is highly polymorphic, and CYP2C19 is involved in the broad interindividual variability of the clinical efficacy of certain clinical medications, such as clopidogrel. However, data on the CYP2C19 genotype in the Chinese population of the Foshan area of Guangdong Province are scarce. The purpose of this study was to determine CYP2C19 genetic polymorphisms in patients in the Foshan area and to compare the CYP2C19 genotype frequencies in different populations to determine the allele distribution pattern to identify the most appropriate prescription. Methods: The CYP2C19 gene was detected in 1231 patients on a gene chip platform, and the genotype frequencies of CYP2C19 in Foshan populations from different populations were compared. Results: The frequencies of CYP2C19*1, *2 and *3 in the Foshan population were 63.89%, 30.46% and 5.65%, respectively. For the three metabolic types, the frequency associated with the rapid metabolism type (*1/*1) was 41.51 [95% confidence interval (CI) 40.11 to 42.91%]; that for the intermediate metabolism type (*1/*2, *1/*3) was 44.76% (95% CI 43.34 to 46.18) and that for the slow metabolism type (*2/*2, *2/*3, *3/*3) was 13.73% (95% CI 12.75 to 14.71%). In the Foshan population, the frequencies of the CYP2C19 *2 and *3 alleles were similar to those previously reported for Chinese and other Asian populations. Conclusion: Our study is a report on the genetic basis of CYP2C19 polymorphism in the Foshan population. Our results will potentially contribute to the improvement of pharmacotherapy effectiveness by providing personalized medicine for the Foshan population.

Polimorfismos genéticos asociados a toxicidad en el tratamiento con 5-fluorouracilo en pacientes con cáncer colorrectal

Introduction: Colorectal cancer is the most common malignancy of the digestive tract. The treatment is based basically on administering antitumor medications, like 5-fluorouracil (5-FU), which belongs to the antimetabolites, antineoplastic agents. However, it has been shown that there is toxicity related to genetic polymorphism in patients treated with 5-FU, including gastrointestinal symptoms, myelosuppression, and neurotoxicity. The genetic variations of four genes have been studied, including ABCB1, DPYD, MTHFR, and TYMS. Methodology: Bibliographic review based on digital articles, starting with the research of information about 5-fluorouracil as treatment of patients with colorectal cancer, its adverse reactions, polymorphisms, and toxicity. The database used is PubMed, ScienceDirect, and Scielo, published within the last ten years. It included scientific articles and studies on patients older than 18. Publications in Spanish and English as well as full-text articles. Additionally, the polymorphisms were analyzed in the NCBI (National Center for Biotechnology Information) database, from which the allelic frequencies at the global and Latin American levels were obtained. Results: A total of 11 articles were reviewed, from where we obtained data about polymorphism that developed in patients with colorectal cancer who receive treatment with 5-fluorouracil. The analyzed genes are ABCB1, DPYD, MTHFR, and TYMS. It was established that the polymorphisms trigger toxicity that manifests in different forms: diarrhea, stomatitis, mucositis, and neutropenia.

Clopidogrel efficacy after percutaneous coronary interventions considering with CYP2C19 genetic polymorphisms in patients with coronary heart disease

Background and Aims : Aim of the study was to estimate the impact of CYP2C19 genetic polymorphisms on the antiplatelet response with clopidogrel and their possible relationship between mean platelet volume (MPV) in patients with coronary heart disease (CHD) after percutaneous coronary interventions (PCI).

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Characterization of clinical, laboratory, IL-6 serum levels, and IL-6-174 G/C genetic polymorphisms in patients with rheumatoid arthritis and Sjögren's syndrome.

This study aimed to characterize the clinical (disease activity and exocrine gland function), laboratory, interleukin 6 (IL-6) serum levels, and IL-6-174G/C (rs1800795) genetic polymorphisms among rheumatoid arthritis (RA), RA plus Sjögren's syndrome (RA+SS), and control subjects. A case-control study enrolling 137 women (52±11 years old) were divided into three groups as follows: RA (n=70), RA+SS (n=29), and healthy control (C, n=38). Individuals underwent clinical evaluation composed of Schirmer's test, unstimulated salivary flow rate, and evaluation of disease activity and functional capacity (Disease Activity Score [DAS28] and Health Assessment Questionnaire [HAQ]). IL-6 serum levels and IL-6-174G/C polymorphisms were assessed. RA and RA+SS presented higher serum levels of IL-6 than controls (p<0.001). Also, higher IL-6 levels were related to swollen joints (p=0.038), limited functional capacity (p=0.004), and disease activity (p≤0.001). However, neither IL-6-174G/C genetic polymorphism nor its allele frequency was associated with RA or RA+SS. IL-6 serum is an important marker of RA activity and functional incapacity, but IL-6-174G/C genetic polymorphism did not differ among healthy controls and cases.

Clinical Implications of LTA4H Genetic Polymorphism in Patients with Chronic Obstructive Pulmonary Disease

Leukotriene A4 hydrolase (LTA4H) is associated with inflammation and emphysema. Nevertheless, clinical implications of LTA4H genetic polymorphism in chronic obstructive pulmonary disease (COPD) has been understudied to date. A prospective study was performed to investigate the clinical implications of LTA4H genetic polymorphism in patients with COPD. AA, GA, and GG types of genetic polymorphism of LTA4H were assayed in patients with COPD at the baseline. Then all patients were followed up for 12 months. At the baseline, the number of participants with AA, GA, and GG type of LTA4H rs7971150 were 22 (14.2%), 43 (27.7%), and 90 (58.1%) in the COPD group (n = 155), whereas 55 (36.7%), 38 (25.3%), and 57 (38.0%) in the control group (n = 150) (p = 0.001). During the follow-up, the variations with respect to forced expiratory volume in one second (FEV1), 6 min walking distance (6MWD), and BODE (body-mass index, obstruction, dyspnea, and exercise capacity) were similar between patients with AA and GA types, which were both lower than those of GG type. The patients with GG type had more hospitalizations than patients with AA (p = 0.001) and GA (p = 0.001) types, respectively. The cumulative hospitalization-free rate in patients with GG type was lower than those of patients with AA and GA types, respectively (p = 0.019). Compared with COPD patients with AA and GA types, patients with GG type were positively correlated with smoking, more hospitalizations, worse FEV1, 6MWD, and BODE index. The current study suggests that GG type of LTA4H is a predisposing factor in COPD development, functional decline, and exacerbation of patients with COPD.

Gephyrin and CYP2C9 Genetic Polymorphisms in Patients with Pharmacoresistant Epilepsy

PurposeGephyrin (GPHN) is an essential protein in the regulation of inhibitory postsynaptic density and polymorphism in the corresponding gene may have a role in the development of pharmacoresistant epilepsy (PRE). For the first time, we aimed to evaluate the association of rs928553T/C variants with PRE susceptibility. Moreover, we have analyzed the genetic polymorphism affecting CYP2C9 “rs12782374G/A” in the same population to detect the effect of SNP on the drug-metabolizing ability of patients with PRE.Patients and MethodsThis case-control study enrolled 100 patients (group A) and 100 healthy, age and sex-matched controls, unrelated to patients (group B). TaqMan™ assays using real-time PCR were run for genotyping of rs928553T/C and rs12782374G/A in all participants.ResultsGPHN T>C polymorphism revealed significant risk association with occurrence of PRE using dominant, recessive and codominant models as follows: TT vs (TC+CC): OR 0.23, 95%CI: 0.13–0.43, P<0.001. In addition, (TT+TC vs CC): OR 0.38, 95%CI: 0.18–0.77, P<0.001. Also, T vs C (OR 0.34, 95%CI: 0.22–0.51, P=<0.001). Similarly, CYP2C9 G>A polymorphism showed a significant increased risk of PRE (GG vs (GA+AA): OR 0.11, 95%CI: 0.05–0.23, P<0.001). Furthermore, (GG+GA vs AA): OR 0.18, 95%CI: 0.084–0.39, P<0.001. Also, G vs A (OR 0.24, 95%CI: 0.15–0.366, P=<0.001).ConclusionMutation of both GPHN (rs928553) and CYP2C9 (rs1278237) genes may be implicated as a genetic mediators of resistance in patients with PRE.

HLA genetic polymorphism in patients with Coronavirus Disease 2019 in Midwestern United States.

The experience of individuals with Coronavirus Disease 2019 (COVID‐19) ranges from asymptomatic to life threatening multi‐organ dysfunction. Specific HLA alleles may affect the predisposition to severe COVID‐19 because of their role in presenting viral peptides to launch the adaptive immune response to severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2). In this population‐based case–control study in the midwestern United States, we performed high‐resolution HLA typing of 234 cases hospitalized for COVID‐19 in the St. Louis metropolitan area and compared their HLA allele frequencies with those of 22,000 matched controls from the National Marrow Donor Program (NMDP). We identified two predisposing alleles, HLA‐DRB1*08:02 in the Hispanic group (OR = 9.0, 95% confidence interval: 2.2–37.9; adjusted p = 0.03) and HLA‐A*30:02 in younger African Americans with ages below the median (OR = 2.2, 1.4–3.6; adjusted p = 0.01), and several candidate alleles with potential associations with COVID‐19 in African American, White, and Hispanic groups. We also detected risk‐associated amino acid residues in the peptide binding grooves of some of these alleles, suggesting the presence of functional associations. These findings support the notion that specific HLA alleles may be protective or predisposing factors to COVID‐19. Future consortium analysis of pooled cases and controls is warranted to validate and extend these findings, and correlation with viral peptide binding studies will provide additional evidence for the functional association between HLA alleles and COVID‐19.

Antiplatelet therapy with clopidogrel taking into account CYP2C19 genetic polymorphisms in patients with coronary heart disease after coronary artery stenting

Background and Aims: Aim of the study was to investigate the influence of CYP2C19 genetic polymorphisms on the antiplatelet therapy with clopidogrel in patients with coronary artery disease (CAD) after percutaneous coronary intervention (PCI) following with DES stenting.