Gene-specific Primers Research Articles

Long-term co-circulation of multiple arboviruses in southeast Australia revealed by xeno-monitoring and viral whole genome sequencing

Abstract Arbovirus surveillance of wild-caught mosquitoes is an affordable and sensitive means of monitoring virus transmission dynamics at various spatial-temporal scales, and emergence and re-emergence during epidemic and interepidemic periods. A variety of molecular diagnostics for arbovirus screening of mosquitoes (known as xeno-monitoring) are available, but most provide limited information about virus diversity. PCR-based screening coupled with RNA sequencing is an increasingly affordable and sensitive pipeline for integrating complete viral genome sequencing into surveillance programs. This enables large-scale, high-throughput arbovirus screening from diverse samples. We collected mosquitoes in CO2-baited light traps from five urban parks in Brisbane from March 2021 to May 2022. Mosquito pools of ≤200 specimens were screened for alphaviruses and flaviviruses using virus genus-specific primers and reverse transcription quantitative PCR (qRT-PCR). A subset of virus-positive samples was then processed using a mosquito-specific ribosomal RNA depletion method and then sequenced on the Illumina NextSeq. Overall, 54,670 mosquitoes, representing 26 species were screened in 382 pools. Thirty detections of arboviruses were made in 28 pools. Twenty of these positive pools were further characterised using RNA sequencing generating 18 full-length genomes. These full-length sequences belonged to four medically relevant arboviruses: Barmah Forest, Ross River, Sindbis-like and Stratford viruses. Phylogenetic and evolutionary analyses revealed the evolutionary progression of arbovirus lineages over the last 100 years, demonstrating that different epidemiological, immunological, and evolutionary processes may actively shape the evolution of Australian arboviruses. These results underscore the need for more genomic surveillance data to explore the complex evolutionary pressures acting on arboviruses. Overall, our findings highlight the effectiveness of our methodology, which can be applied broadly to enhance arbovirus surveillance in various ecological contexts and improve understanding of transmission dynamics.

First Report of Cucurbit Aphid-Borne Yellows Virus on Sicyos angulatus in Korea.

Bur cucumber (Sicyos angulatus), known as gasibak in Korea, is an invasive species that has spread widely since its introduction. In July 2024, populations were surveyed along riverbanks in five southeastern regions of South Korea (Andong, Daegu, Cheongsong, Chilgok, and Gunwi). Across these locations, approximately 5% of the plants displayed viral symptoms such as yellowing and mosaic. A total of 25 symptomatic and asymptomatic leaf samples were collected. To identify viral infections, RT-PCR was conducted to detect nine cucurbit viruses common in Korea (Kwak et al., 2018; Park et al., 2011): cucumber mosaic virus (CMV, Cucumovirus CMV), cucumber green mottle mosaic virus (CGMMV, Tobamovirus viridimaculae), cucurbit aphid-borne yellows virus (CABYV, Polerovirus CABYV), cucurbit chlorotic yellows virus (CCYV, unclassified genus Crinivirus), kyuri green mottle mosaic virus (KGMMV, Tobamovirus kyuri), melon necrotic spot virus (MNSV, Gammacarmovirus melonis), papaya ringspot virus (PRSV, Potyvirus papayanuli), watermelon mosaic virus (WMV, P. citrulli), and zucchini yellow mosaic virus (ZYMV, P. cucurbitaflavitesselati). WMV and WMV+CABYV were present in 16 and 6 samples, respectively, across four regions, with no viral infections detected in Andong. All positive samples were infected with WMV, with no CABYV alone and none of the other seven viruses were detected. WMV-infected samples primarily showed mosaic symptoms with irregular discoloration and mottling, while co-infected samples displayed more pronounced yellowing or chlorosis in addition to mosaic patterns. This suggests a specific association of CABYV with the yellowing symptoms, significantly contributing to chlorosis alongside WMV. The observed co-infection aligns with prior reports of WMV and CABYV in cucurbits, emphasizing the need for monitoring both viruses due to their combined impact on symptom severity and yield losses (Rabadán and Gómez, 2023). Asymptomatic samples tested negative for viral infections. To confirm the CABYV infection, cDNA synthesis was conducted on a CABYV-positive sample, followed by PCR with newly designed coat protein gene-specific primers (5'-GTCTCGTTACCAAGAGTCCA/CGACGAACTCACCATCAGC-3'). The resulting amplicon was cloned, sequenced, and submitted to GenBank (accession no. PQ303621.1). This CABYV sequence, designated as isolate Gasibak, showed 100% identity (600/600 bp) with five isolates (KR231962.1, KR231961.1, KR231959.1, KR231949.1, and KR231944.1) previously identified from Korean melons through a BLASTn search. This marks the first report of bur cucumber as a natural host of CABYV worldwide. CABYV belongs to the genus Polerovirus in the family Solemoviridae (Sõmera et al., 2021). Although not commonly found in Korea in the past, this virus has become increasingly prevalent, particularly in oriental melon crops. Recently, Korean authorities recognized that CABYV causes yellowing symptoms in various cucurbit crops, leading to economic damage. While WMV has been reported in bur cucumber (Park et al., 2020), details remain limited. Both WMV and CABYV are known to be transmitted by aphids, raising the possibility that bur cucumber may contribute to the spread of these viruses, particularly in areas near cucurbit crops. Previous studies have shown that bur cucumber can rapidly spread along riverbanks and into agricultural areas, potentially impacting nearby ecosystems and crops (Osawa et al., 2013).

Isolation and characterization of halophilic Bacillus thuringiensis from local Egyptian sites and their potential against Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae)

BackgroundBacillus thuringiensis (Bt) serves as a peculiar soil microbe that is Gram-positive, rod-shaped, spore-forming, and aerobic facultative. It endures across a range of conditions and has been demonstrated to be an effective biological pest control agent against several insect pests. The main objective of the study is to isolate and recognize Bt bacteria from saline environments in Egyptian soil for biological surveillance uses.ResultsIsolates three, four, five, ten, eleven, twelve, and thirteen were found to be moderately tolerant, while isolate eight showed highly tolerant, but isolate six was found to be borderline extreme halophile. On the other hand, the other isolates showed extreme halophiles. To find out the presence of crystals, a scanning electron microscope was carried out and the result showed that the crystals ranged from spherical to bi-pyramidal spherical. Molecular analysis was carried out using universal primers to confirm the presence of cry genes. The results showed that 84.6% of the isolates contain cry seven and eight, whereas cry one and four are distributed by 92.3%. Cry two genes were found to be 100 percent in all tested and isolated cultures. Cry genes were present and distribution among isolated was detected using gene-specific primers. cry3Ba1 and cry8B showed the lowest and equal distribution among the isolates, while the cry2Ab2gene frequency distribution was (84.6%) among isolated cultures. Around six cry genes were found to be absent in all isolated cultures. The bioinsecticidal activity and bioassays were carried out to check the potential effect of halophilic Bt isolates against 1st instar larvae of the Fall Armyworm (FAW) Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae). Mortality was calculated after infecting S. frugiperda with thirteen Bt isolates. The most virulent Bt isolate was isolate 7, followed by isolate 10, with LC50 values of 9.542 × 107 spores/ml and 1.289 × 108 spores/ml, respectively, after 72 h. Morphological traits of the larvae were carried out, to check the effect of Bt isolates as a biological control against the FAW.ConclusionTo protect and enhance the sustainability of field crops and vegetables, especially in new high salinity lands, from disease-causing insects such as FAW, it is necessary to identify new strains of Bt from these saline lands. In this field, local isolates of Bt from several regions in Egypt known for their high levels of salinity were documented and showed an effective bioinsecticide on FAW larvae.

DeLTa-Seq: High-Throughput Targeted RNA-Seq of Rice Leaves Without RNA Purification.

DeLTa-seq is a high-throughput RNA-seq library preparation method that enables quantification of the expression of hundreds of arbitrarily selected genes without RNA purification. This method involves direct reverse transcription using rice leaf lysate and targeted RNA-seq library preparation. DeLTa-seq enables the precise quantification of gene expression with a small number of sequencing reads. This chapter provides detailed information on the design of gene-specific primers, sampling of rice leaves, preparation of lysates, direct-lysate reverse transcription, targeted RNA-seq library preparation, and bioinformatic analysis of DeLTa-seq data.

Molecular characterization of rabies virus from wild and domestic animals in the Sultanate of Oman.

Rabies virus (RV) is endemic in some Arabian countries. However, it is difficult to control RV without understanding the epidemiological evolution of endemic RV isolates. The current study aimed to characterize RV from domestic and wild animal clinical cases in Oman. Twelve brain samples from domestic (Five camels, three goats and one cattle) and wild animals (Two foxes and one honey badger) were investigated from different locations in Oman between 2017 and 2020. All samples were confirmed by RV nucleoprotein (N) gene-specific primers. Seven out of the 12 amplified samples were successfully sequenced and subjected to sequence and phylogenetic analysis. The detected RVs shared an in-between 96.8%-98.7% and 96.9%-99% nucleotide and amino acid identities, respectively. However, the wild animal RVs shared only 92.6%-93.9% and 95.9% nucleotide and amino acid identities with the domestic animal RVs, respectively. Negri bodies were detected histologically in six brain samples from camels (n = 3), goats (n = 1) and foxes (n = 2). The RVs from domestic animals shared 97%-98.7% and 98%-100% nucleotide and amino acid identities with the previously published fox RVs from Oman and Gulf countries. Phylogenetic analysis suggested that all RV sequences belong to a distinct clade confined to the previously reported clade V within the Middle Eastern Cluster. As indicated by the analysis of RVs from different locations between 2017 and 2020, a genetic variant isolated to the Gulf region may exist within the Middle East clade. Moreover, it appears that new RV lineages are emerging rapidly within this region. Therefore, a comprehensive genomic and phylogenetic analysis of the circulating RV is important for the development of future prevention and control strategies.

Rapid Identification of Lactobacillus acidophilus and Bifidobacterium by a 16S rRNA PCR Method

Background: Probiotics are live microorganisms that, when administered, have beneficial effects on human health. Hence, various probiotic organisms belonging to the genera Lactobacillus and Bifidobacterium are being increasingly used in food and pharmaceutical products. For regulatory compliance, simple and reliable analytical methods are required for selective enumeration of different probiotic organisms present in food and pharmaceutical formulations. Objective: This study aimed to establish a rapid PCR-based method for the identification and differentiation of Lactobacillus acidophilus and Bifidobacterium strains. Methods: Species-specific and genus-specific primers for Lactobacillus and Bifidobacterium were designed based on their 16S rRNA gene sequence. Genomic DNA of different Lactobacillus and Bifidobacterium strains were subjected to PCR with annealing temperature specific for respective primer pairs. Results: Lactobacillus acidophilus primers gave positive PCR results only with Lactobacillus acidophilus strains and not with other Lactobacillus species, whereas Bifidobacterium genus-specific primers gave positive PCR results with most of the Bifidobacterium strains. Conclusion: The three species-specific L. acidophilus primer pairs and three genus-specific primer pairs of Bifidobacterium used in this study could easily identify and differentiate Lactobacillus acidophilus and Bifidobacterium with high specificity.

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

Molecular epidemiology of avian influenza viruses and avian coronaviruses in environmental samples from migratory bird inhabitants in Bangladesh.

Migratory birds are a natural reservoir for major respiratory viruses such as the avian influenza virus (AIV) and the avian coronavirus (AvCoV). Transmission of these viruses from migratory birds to domestic birds increases the prevalence of those diseases that cause severe economic and public health concerns in Bangladesh. The study focused on active surveillance of major respiratory viral pathogens in migratory birds, molecular identification of the viruses, and their phylogenetic origin. To conduct this study, 850 environmental samples (830 fecal samples, 10 soil samples, and 10 water samples) were collected during three consecutive winter seasons from three divisions (Dhaka, Sylhet, and Mymensingh) and pooled according to the year of collection and locations, resulting in a total of 184 tested samples. Using gene-specific primers and probes in TaqMan-and SYBR Green-based RT-qPCR assays, the samples were screened for AIV and AvCoV, respectively. Out of the 184 pooled samples, 37 were found to be positive for these respiratory pathogens. Furthermore, out of the 37 (20.11%) positive respiratory pathogens, 11.96% were AIV (n = 22) and 8.15% were AvCoV (n = 15). For the first time in Bangladesh, AIV H4N2, H4N6, and AvCoVs have been found in fecal samples from migratory birds through surveillance. Phylogenetic analyses of the HA and NA genes of AIV and the polymerase gene (Orf 1) of AvCoV revealed that these strains share a close phylogenetic relationship with the isolates from wild birds in Europe and Asia. The Bangladeshi strains with Eurasian ancestry might pose a significant threat to migratory birds flying through the Asian flyways. They might also be a potential source of virus introduction and spread to poultry raised on land. These findings emphasize the significance of ongoing AIV and AvCoV surveillance in migratory birds in Bangladesh.

Designing a multi-epitope construct using immuno-informatic tools to prepare a messenger RNA vaccine against Rhipicephalus microplus ticks

Background and Aim: Ticks are blood-feeding ectoparasites that transmit pathogens to animals and humans. One of the most important hard ticks in animals is Rhipicephalus microplus, which transmits Babesia and Anaplasma spp. Although many potential tick vaccine candidates have been identified, no effective vaccine that can provide sterile immunity against R. microplus tick infestations has been developed. This study aimed to design a construct using different computational tools to identify and predict immunogenic epitopes within protein sequences and to prepare a messenger RNA (mRNA) vaccine against R. microplus based on lipid nanoparticles (LNPs). Materials and Methods: The R. microplus proteins (Bm86, Subolesin, and ATAQ) were selected and their consensus sequence was obtained from the National Center for Biotechnology Information in FASTA format. The Immune Epitope Database and Analysis Resource (IEBD) server was used for the prediction of helper T-cell epitopes, the NetCTL 1.2 server was used to predict cytotoxic T-cell epitopes, and the ABCpred server was used for B-cell epitope prediction. Antigenicity testing, allergenicity assessment, and toxicity screening were immuno-informatic techniques used to identify potent epitopes within protein sequences. The multi-epitope construct was prepared and cloned into the pVAX1 plasmid. Plasmids were transformed in compatible competent cells, and restriction analysis was performed. After restriction analysis of the transformed plasmid, in vitro transcription was performed to prepare mRNA. The mRNA was purified, quantified, and converted into complementary DNA, and gene-specific primers were used to confirm the in vitro transcription of mRNA. A mixture of four lipids containing 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), Distearoylphosphatidylcholine (DSPC, cholesterol, and 1,2-Dimyristoyl-sn-glycero-3-methoxypolyethylene glycol-2000 (DMG PEG-2000 was used to prepare LNPs. LNPs were characterized using a scanning electron microscope, Zeta potential, and Zeta Sizer tests. Results: More than 1000 epitopes were predicted, from which only nine helper T-lymphocytes, 18 cytotoxic T-lymphocytes, and nine B-cell epitopes of all three proteins were selected with high antigenic scores of 0.958 for Bm86, 0.752 for Subolesin, and 0.964 for ATAQ, respectively. An adjuvant was used to enhance immune responses, all of which were linked to one another using GPGPG, AAY, and KK linkers, respectively. The physiochemical properties predicted that the instability index of the construct would be <40%, indicating that the construct is stable. Plasmids were transformed in compatible competent cells, and white-transformed colonies were observed. Restriction analysis was performed, DNA was transcribed into mRNA, and LNPs were prepared and characterized. Conclusion: More than 1000 epitopes were predicted using immune informatic tools, and only high-scoring epitopes were selected. A multi-epitope construct was designed using bio-informatic tools, and its physicochemical properties were predicted. The design construct was inserted into the pVAX1 plasmid, and in vitro transcription was performed to prepare the mRNA. LNPs of mRNA were prepared and characterized to be used as vaccines. It was found that LNPs were stable and nanometer-sized. Keywords: immuno-informatic tools, lipid nanoparticles, multiepitope construct, Rhipicephalus microplus.

First Report of 'Candidatus Phytoplasma ziziphi'-Related Strains Infecting Peony (Paeonia suffruticosa Andr.) Showing Leaf Yellows Symptoms in China.

Peony (Paeonia suffruticosa Andr.), belonging to family Paeoniaceae, is an important medicinal and ornamental plant. During August of each year from 2016 to 2023, peony plants at Heze city were found to exhibit leaf yellows symptoms. The incidence rate of the symptomatic plant was recorded from 10% to 30% in four peony gardens with about 200 acres. Total DNA was extracted from 0.10 g fresh plant leaf tissues from 24 symptomatic and 8 asymptomatic samples using rapid plant genomic DNA isolation kit (Aidlab Biotechnology, Beijing, China). The extracted DNA was amplified by nested polymerase chain reaction using universal primers R16mF2/R16mR1 followed by R16F2/R16R2 (Lee et al., 1993; Gundersen and Lee, 1996) specific for the 16S rRNA gene and new designed tuf gene specific primers JWB-tuforfF1 (5'-ATGGCTGAAATATTTTCAAGAG-3') and JWB-tuforfR1 (5'-TTATTCTATGATTTTAATAACAG-3') followed by JWB-tuforfF2 (5'-ATGTAAACGTAGGAACTATTGG-3') and JWB-tuforfR2 (5'- TCCGATAGTTCTTCCACCTTCAC-3'). Amplicons of about 1.25 kb and 1.02 kb (16S rRNA gene and tuf gene, respectively) were obtained in 8 symptomatic samples from four peony gardens. However, no amplification was obtained in any of the asymptomatic samples. The representative amplicons of 16S rRNA and tuf genes of three positive samples (Heze-9, -18 and -27) were cloned into a zero background pLB-simple vector (Tiangen Biotechnology, Beijing, China) and sequenced by Taihe Biotechnology, Beijing, China. Sequences obtained in the study were deposited in NCBI GenBank with accession numbers PP504882, PP504883 and PP504884 for the 16S rRNA gene as well as PP530237, PP530238 and PP530239 for the tuf gene. The phytoplasma strain under the study was described as peony yellows (PeY) phytoplasma, PeY-Heze strain. Alignment analysis by DNAMAN software showed that three 16S rRNA gene sequences obtained in the study shared 99.36% to 99.60% sequence identity and three tuf gene sequences obtained in the study were identical. BLAST analysis of the 16S rRNA gene sequences of the PeY-Heze phytoplasma strains showed 99.60%-99.84% sequence identity with 'Candidatus Phytoplasma ziziphi' (GenBank accession: CP025121). And tuf sequences of the strains showed 100% similarity with 'Ca. P. ziziphi' (CP025121). Interestingly, the virtual RFLP patterns derived from three 16Sr RNA gene sequences obtained in the study by iPhyClassifier (Zhao et al., 2009) were different from the reference patterns of all previously established 16Sr groups/subgroups. The most similar are the reference pattern of the 16Sr group VII, subgroup E (AY741531), with a similarity coefficient of 0.72, which is less than 0.85. These phytoplasma strains may represent a new 16Sr group. Phylogenetic analysis based on 16S rRNA genes using MEGA 7.0 by neighbor-joining (NJ) method with 1000 bootstrap value indicated that PeY-Heze strains clustered into one clade with the phytoplasma strains of 'Ca. P. ziziphi' with 68% bootstrap value. Although there are several reports available on 'Ca. P. solani' infecting peony in Shandong Province, China (Gao et al., 2013). To our knowledge, this is the first report of 'Ca. P. ziziphi'-related strains infecting peony in China. The findings in this study will be beneficial to the detection, quarantine, and prevention of peony yellows phytoplasmas in China.

Exploration of the Molecular and Phylogenetic Aspects of Brucella intermedia (Ochrobactrum intermedia)

Brucella bacteria are among the oldest known zoonotic pathogens and they have become iconic case studies in infectious diseases. Genome comparisons have led to the reclassification of the genus Ochrobactrum, with its individual species now being categorized as Brucella. This study aims to isolate and molecularly identify Ochrobactrum intermedia from Iraqi patients. One hundred seventy urine samples were collected from patients with various conditions suspected of brucellosis. Based on identification by the VITEK compact system, two of the bacterial isolates were identified as Brucella intermedia (Ochrobactrum intermedia) species. This was confirmed by polymerase chain reaction using genus-specific primers for the 16S rRNA and recA genes which are specific for B.intermedia. The 16S rRNA gene sequences were aligned using BLAST and the BioEdit program. It was observed that there was a remarkable 99% similarity among the Brucella intermedia sequences. The affiliation of the two novel strains of B. intermedia, identified as Brucella intermedia strain BC-TCC 16S ribosomal RNA gene (OP415407) and Brucella intermedia strain Baghdadies 16S ribosomal RNA gene (OP415409), was confirmed through the analysis of both 16S rRNA and recA genes. These findings suggest that the use of 16S RC-PCR and sequencing in clinical settings can improve patient care by increasing the sensitivity of detection and identification of bacterial pathogens, resulting in more diagnoses of bacterial infections. By studying novel strains in a phylogenetic tree, researchers can learn more about the diversity of a species and can identify potential new threats to human and animal health.

Haemosporidian Infection Is Associated with the Oxidative Status in a Neotropical Bird

Haemosporidians are common blood parasites in wild bird populations, yet their effects on oxidative status remain understudied. Here, we measured the levels of thiobarbituric acid-reactive substances (TBARS) as an indicator of reactive oxygen species (ROS), total antioxidant capacity (TAC) as an indicator of non-enzymatic molecular antioxidants, and TBARS/TAC ratio as an indicator of oxidative status. We also used parasite genus-specific primers and PCR techniques to detect haemosporidians in 117 adults of Rufous-collared Sparrow (Zonotrichia capensis) from four locations in south–central Chile. Mixed-effect models were employed to compare oxidative indicators between infected and uninfected birds. Infected birds showed significantly higher TBARS levels, but no significant differences in TAC, leading to a higher TBARS/TAC ratio, especially in reproductive individuals. This suggests increased oxidative damage in infected birds, irrespective of sex or body condition. A positive relationship between TBARS and TAC was observed in both groups, but the antioxidant response was weaker in infected birds, indicating differential oxidative stress responses based on infection status. Body condition did not differ significantly between infected and uninfected individuals. These results demonstrate that haemosporidian infections impose oxidative costs on birds, potentially compounding the oxidative costs associated with reproduction.

Characterization of Flower’s Color based on CHS Gene Structure in <i>Phalaenopsis</i> ‘OX Queen’ and <i>Dendrobium</i> ‘Cheddi Jagan’ Orchids

Orchids (Orchidaceae) are ornamental plants known for their high aesthetic value attributed to the shapes, colours, and fragrances of their flowers. Two types of hybrid orchids with attractive flowers, namely the Phalaenopsis 'OX Queen' orchid and the Dendrobium 'Cheddi Jagan' boast attractive flowers were used in this research, because of the beauty of its flower colour. The objective of this research is to characterise the morphology of flower colour and CHS (Chalcone Synthase) gene content that induces flower colour. The method used in this research analyzing the flower’s colour by using the RHS (Royal Horticultural Society) colour chart and molecular analysis by DNA genomic isolation and PCR amplification of gDNA for CHS gene specific primers. The results showed that purple colour is observed through the RHS, with P. 'OX Queen' coded as Deep Purple Pink (N73A) and D. 'Cheddi Jagan' coded as Strong Reddish Purple (N72C). The CHS gene can be amplified in P. ’OX Queen’ 1,287 bp and D. ’Cheddi jagan’ 3,731 bp. In both orchids, the results of amplification showed CHS motifs with conserved domains PLN03172 and PLN03170. The research results show that there is a significant difference in the morphology of the flowers of orchids. Purple colour is observed through the RHS, with P. 'OX Queen' coded as N73A and D. 'Cheddi Jagan' coded as N73C. The results showed that gDNA can be isolated by using CTAB method according to Murray and Thomson, and the CHS gene can be amplified by using CHS primers, resulting 1200 bp of P. 'OX Queen' and 2500 bp for D. 'Cheddi Jagan'. Through this study, preliminary data is expected to be obtained for future research, which is the formation of variegated flowers through editing the CRISPR/Cas9 genome in the CHS gene. This research is intended to support further studies on the formation of variegated flower patterns in P. 'OX Queen' and D. 'Cheddi Jagan’, focusing on the CHS gene using CRISPR/Cas9 technique.

Abstract P138: Diet Influences the Expression of Renal Sodium-Glucose Cotransporters in Juvenile Male Rats

Poor nutrition and metabolic dysfunction are becoming more prevalent among children, as evident by increasing childhood obesity in recent years. The kidney sodium-glucose cotransporter 2 (SGLT2) is a contributor to overall metabolic homeostasis, with inhibition of SGLT2 significantly reducing circulating glucose and lipids. The study objective was to determine if diet influences the expression of renal glucose transporters in young rats. Weanling male Wistar Kyoto rats received 1) standard laboratory chow, 2) AIN-93G diet, or 3) a high-fat diet (60% kcal, HFD). Each dietary group was then further subdivided to receive either filtered water or 5% (w/v) sucrose solution ad libitum . Four weeks later, animals were euthanized and kidneys were collected and processed. mRNA expression of Sglt1 , Sglt2 , Sqstm1 , and Nlrp3 was determined using gene specific primers and RT-PCR. Renal SGLT2 protein expression was visualized using immunohistochemistry and quantified using Imagej software. Diet significantly influenced the renal expression of both Sglt1 ( P =0.005) and Sglt2 (P=0.046), while beverage did not have a significant effect on either ( P =0.7 and P =0.4, respectively). Rats fed the HFD had more than 30% reduction in Sglt1 mRNA expression as compared to rats fed chow, and ~20% reduction in Sglt2 as compared to rats fed AIN. Preliminary data suggest that diet and beverage significantly altered renal protein expression of SGLT2, with rats fed chow having the lowest renal expression that was slightly increased with sugar consumption (1.5% versus 2.7%, respectively). Rats fed AIN had the greatest expression, but was drastically reduced in rats consuming sugar (4% versus 1.2%, respectively). To determine if autophagy and inflammasome activation is involved, the expression of Sqstm1 and Nlrp3 was measured by RT-PCR. Similarly, rats fed HFD had the lowest expression of both Sqstm1 ( P<0.001) and Nlrp3 ( P=0.03). Sqstm1 and Nlrp3 mRNA expression was decreased with sugar consumption in rats fed chow and AIN, whereas Sqstm1 ( P =0.01) and Nlrp3 ( P <0.001) mRNA expression was increased in rats fed HFD with sugar beverage. Our data suggest that diet significantly influences renal glucose transporter expression in juvenile rats in a way that may be mediated by autophagic impairment. The modulatory effect of sugar consumption on SGLT2 protein, Sqstm1, and Nlrp3 was diet-dependent, highlighting the importance of nutrition to renal physiology within weeks after weaning.

First Molecular Evidence of Leishmania Infantum in Domestic Cats and Associated Risk Factors from the Black Sea Region of Türkiye.

The objectives of the present study are to determine the molecular prevalence of Leishmania spp. in the owned domestic cats in the Black Sea Region of Türkiye and analyze the associated risk factors in FeL. Conjunctival swabs (CS), blood, demographic, and clinical data were collected from 150 owned cats brought to the Veterinary Teaching Hospital during 2020-2022. Leishmania kinetoplast DNA (kDNA) from CS was screened by TaqMan Real-Time PCR (qPCR) with the genus-specific primers and a probe. All qPCR positive products were also amplified and sequenced to identify Leishmania species by ITS1 primers. Molecular prevalence of L. infantum found as 12.6% (19/150) in the observed cats in the Black Sea Region of Türkiye. There was a significant difference (p < 0.05) between neutered and intact cats with regarding to L. infantum positivity. Intact cats found to be 0.368 times more prone to be L. infantum-positive (L+). Dermatological lesions were found the most common (26.3%) problems in the L + cats. The median leucocyte count was the only parameter that was found statistically (p < 0.05) lower in the L + group (6.60) than the negative group (L-) (8.96), when comparing the WBC, NEU/LYM, MONO/LYM, EOS/LYM and PLT/LYM values. This study presented the molecular occurrence of FeL in the Black Sea Region of Türkiye for the first time indicating that the carrier status of the cats makes them alternative reservoirs for possible zoonotic transmission of L. infantum in this zone.

Utilization of 16Sr RNA and secA genes for molecular discernment of 'Candidatus Phytoplasma australasiaticum' strain associated with linseed germplasm in India.

The growing prevalence of phytoplasma associated symptoms on linseed or flax (Linum usitatissimum L.) germplasm at Indian Council of Agricultural Research- National Bureau of Plant Genetic Resources (ICAR-NBPGR) fields was noticed during the 2019-22 growing seasons. The characteristic phytoplasma symptoms of phyllody, stem fasciation, stunting, along with floral and capsule malformations were observed in 41 linseed accessions grown at experimental fields of ICAR-NBPGR, Delhi. During 3years, the presence of phytoplasma in symptomatic linseed accessions was confirmed by nested-PCR assays utilizing 16S rRNA and secA gene-specific primers. The 16S rRNA and secA gene sequences of linseed phytoplasma strains from the representative symptomatic 41 linseed accessions exhibited 100% sequence identity among themselves and 99.93% and 99.82% sequence homology with reference strain, 'Candidatus Phytoplasma australasiaticum' (GenBank Accession: Y10097). Phylogenetic analysis of 16S rRNA and secA gene sequences clustered the linseed isolates with the peanut witches' broom group belonging to 'Ca. P. australasiaticum' strains. The virtual RFLP analysis of 16S rRNA F2nR2 fragment (~1.2kb) of linseed phytoplasma strains further classified it into 16Sr group II, subgroup D. Our results suggested confirmation of the association of 'Ca. P. australasiaticum' strain (16SrII-D) in the linseed germplasm accessions from North India, which is the first report from India. The phytoplasma infection also reduced the growth and yield parameters of two linseed accessions (IC0498748 and EC0718851).

Single-cell RNA sequencing of nc886, a non-coding RNA transcribed by RNA polymerase III, with a primer spike-in strategy.

Single-cell RNA sequencing (scRNA-seq) has emerged as a versatile tool in biology, enabling comprehensive genomic-level characterization of individual cells. Currently, most scRNA-seq methods generate barcoded cDNAs by capturing the polyA tails of mRNAs, which exclude many non-coding RNAs (ncRNAs), especially those transcribed by RNA polymerase III (Pol III). Although previously thought to be expressed constitutively, Pol III-transcribed ncRNAs are expressed variably in healthy and disease states and play important roles therein, necessitating their profiling at the single-cell level. In this study, we developed a measurement protocol for nc886 as a model case and initial step for scRNA-seq for Pol III-transcribed ncRNAs. Specifically, we spiked in an oligo-tagged nc886-specific primer during the polyA tail capture process for the 5'scRNA-seq. We then produced sequencing libraries for standard 5' gene expression and oligo-tagged nc886 separately, to accommodate different cDNA sizes and ensure undisturbed transcriptome analysis. We applied this protocol in three cell lines that express high, low, and zero levels of nc886. Our results show that the identification of oligo tags exhibited limited target specificity, and sequencing reads of nc886 enabled the correction of non-specific priming. These findings suggest that gene-specific primers (GSPs) can be employed to capture RNAs lacking a polyA tail, with subsequent sequence verification ensuring accurate gene expression counting. Moreover, we embarked on an analysis of differentially expressed genes in cell line sub-clusters with differential nc886 expression, demonstrating variations in gene expression phenotypes. Collectively, the primer spike-in strategy allows combined analysis of ncRNAs and gene expression phenotype.

Molecular Characterization and Pathogenicity of Groundnut Bud Necrosis Virus (Orthotospovirus arachinecrosis) Inducing Necrosis in Black Gram

Orthotospovirus arachinecrosis commonly known as Groundnut bud necrosis virus (GBNV), is the causal agent for necrosis disease in black gram. GBNV is the second most important challenge to black gram production in major growing areas following yellow mosaic disease. Symptoms of necrosis disease of black gram include severe downward curling and twisting of leaf lamina, veinal necrosis, petiole necrosis, bud necrosis, and necrotic streaks on the stem. Infection at early growth stages of black gram leads to plant death, while surviving plants exhibited stunted growth with a significant reduction in pod yield. The GBNV-BG isolate was maintained in pure form on cowpea cv. C-152, resulted in chlorotic and necrotic local lesions on primary leaves at seven days post-inoculation. The pathogenicity of GBNV on black gram (LBG-645) was further confirmed by artificial sap inoculation. Amplification of the coat protein gene of GBNV was confirmed through RT-PCR using gene-specific primers, producing an amplicon of 800 bp. Sequence analysis of the coat protein gene revealed that the present study isolates OQ683310 and OR295403 shared sequence identity of 98.0 % and 99.3 % respectively at the nucleotide level, with other isolates in the NCBI database. The phylogenetic analysis of the coat protein gene revealed that the isolates under this study were closely linked with the GBNV tomato isolate from Tamil Nadu (MN718651 and MZ505083).

Traditional to technological advancements in Ganoderma detection methods in oil palm.

Ganoderma sp., the fungal agent causing basal stem rot (BSR), poses a severe threat to global oil palm production. Alarming increases in BSR occurrences within oil palm growing zones are attributed to varying effectiveness in its current management strategies. Asymptomatic progression of the disease and the continuous monoculture of oil palm pose challenges for prompt and effective management. Therefore, the development of precise, early, and timely detection techniques is crucial for successful BSR management. Conventional methods such as visual assessments, culture-based assays, and biochemical and physiological approaches prove time-consuming and lack specificity. Serological-based diagnostic methods, unsuitable for fungal diagnostics due to low sensitivity, assay affinity, cross-contamination which further underscores the need for improved techniques. Molecular PCR-based assays, utilizing universal, genus-specific, and species-specific primers, along with functional primers, can overcome the limitations of conventional and serological methods in fungal diagnostics. Recent advancements, including real-time PCR, biosensors, and isothermal amplification methods, facilitate accurate, specific, and sensitive Ganoderma detection. Comparative whole genomic analysis enables high-resolution discrimination of Ganoderma at the strain level. Additionally, omics tools such as transcriptomics, proteomics, and metabolomics can identify potential biomarkers for early detection of Ganoderma infection. Innovative on-field diagnostic techniques, including remote methods like volatile organic compounds profiling, tomography, hyperspectral and multispectral imaging, terrestrial laser scanning, and Red-Green-Blue cameras, contribute to a comprehensive diagnostic approach. Ultimately, the development of point-of-care, early, and cost-effective diagnostic techniques accessible to farmers is vital for the timely management of BSR in oil palm plantations.

Molecular based identification and phylogenetic relationship of the leech Hirudinaria manillensis from India by using mitochondrial cytochrome c oxidase subunit I gene.

A molecular approach for the identification of unknown species by the using mitochondrial cox1 gene is an effective and reliable as compared with morphological-based identification. Hirudinaria manillensis referred to as Asian Buffalo Leech, is found in South Asia and traditionally used as medicine owing to its medicinal properties. The study aimed to isolate and identify the leech species using cox1 gene sequencing and their phylogenetic relationships. The nucleotide sequences of cytochrome c oxidase subunit I (cox1) mitochondrial genes were analyzed for species identification and the phylogenetic relationship of crucial therapeutic leech Hirudinaria manillensis. The isolated DNA from the leech sample was amplified with cox1 gene-specific primers. BLAST results with the H. manillensis sequence showed 89.24% homology with H. manillensis and phylogenetic tree analysis revealed the genetic relationship with other GenBank submitted sequences. The present study concluded that the cox1 gene could be an effective way to identify the leech H. manillensis and provided sufficient phylogenetic information to distinguish H. manillensis indicating a significant mtDNA-based approach to species identification.