Gene-specific Alterations Research Articles

Patient-reported outcomes (PROs) and biomarkers in daNIS-2, a phase III study comparing NIS793 plus nab-paclitaxel/gemcitabine (NG) vs placebo plus NG in first-line (1L) metastatic pancreatic ductal adenocarcinoma (mPDAC).

TPS767 Background: The 5-year survival rate for mPDAC is <5% with current standard-of-care (SOC) chemotherapies, and this period is often associated with a high symptom burden. Currently, targeted treatment options are only available to a minority of patients (pts) with mPDAC. Here, we present the PRO and biomarker objectives of daNIS-2, a randomized, double-blind, Phase III study (NCT04935359) of the anti–TGF-β monoclonal antibody NIS793 in combination with SOC chemotherapy in pts with 1L mPDAC. Methods: Eligible pts are adults (≥18 years) with previously untreated mPDAC who are eligible for treatment in the 1L setting and not amenable to potentially curative surgery. The daNIS-2 study includes safety run-in and randomized parts. In the safety run-in part, pts will receive a combination of NIS793 (2100 mg intravenous [IV] every 2 or 4 weeks) and NG (gemcitabine 1000 mg/m2 IV; nab-paclitaxel 125 mg/m2 IV; each on Days 1, 8, and 15 of a 28-day cycle). Following dose confirmation, ~480 pts will be randomized to one of two treatment arms (~240 pts per arm): an investigational arm (NIS793 + NG) or a control arm (placebo + NG). The primary objective of the randomized part is to compare overall survival between arms. Secondary objectives (randomized part only) include the evaluation of health-related quality of life (using PROMIS-29 v2.1 and EQ-5D-5L). Additional PROs will be assessed as exploratory endpoints (using PRO-CTCAE, PGIC, PGIS, and FACT-GP5). Safety endpoints include the incidence and severity of adverse events, changes in laboratory parameters, vital signs, body weight and cardiac assessments, dose adjustments, and dose intensity. Biomarker assessments will be carried out as exploratory objectives; biomarker assessments in baseline or archival tumor biopsies will explore the relationships of programmed death-ligand 1 expression, CD8, and tumor burden with clinical efficacy endpoints. Recommended, on-treatment biopsies (Cycle 3 and at the end of treatment) will investigate the effect of NIS793 on the tumor microenvironment, immune cell population changes, gene expression, and potential mechanisms of NIS793 resistance. Circulating tumor DNA will be analyzed in serial blood samples (Day 1 of Cycles 1–3, every two cycles for 52 weeks, then every three cycles) to monitor disease and identify/correlate gene-specific oncogenic alterations with clinical efficacy. Additional peripheral assessments will include measurements of cytokine levels relating to clinical/immune responses and nucleic acids to evaluate the effects of TGF-β blockade. This study is ongoing and plans to enroll pts from 145 sites across 28 countries. The first pt was treated on October 20, 2021. Clinical trial information: NCT04935359 .

Alterations in Calcium Handling Are a Common Feature in an Arrhythmogenic Cardiomyopathy Cell Model Triggered by Desmosome Genes Loss.

Arrhythmogenic cardiomyopathy (ACM) is an inherited cardiac disease characterized by fibrofatty replacement of the myocardium. Deleterious variants in desmosomal genes are the main cause of ACM and lead to common and gene-specific molecular alterations, which are not yet fully understood. This article presents the first systematic in vitro study describing gene and protein expression alterations in desmosomes, electrical conduction-related genes, and genes involved in fibrosis and adipogenesis. Moreover, molecular and functional alterations in calcium handling were also characterized. This study was performed d with HL1 cells with homozygous knockouts of three of the most frequently mutated desmosomal genes in ACM: PKP2, DSG2, and DSC2 (generated by CRISPR/Cas9). Moreover, knockout and N-truncated clones of DSP were also included. Our results showed functional alterations in calcium handling, a slower calcium re-uptake was observed in the absence of PKP2, DSG2, and DSC2, and the DSP knockout clone showed a more rapid re-uptake. We propose that the described functional alterations of the calcium handling genes may be explained by mRNA expression levels of ANK2, CASQ2, ATP2A2, RYR2, and PLN. In conclusion, the loss of desmosomal genes provokes alterations in calcium handling, potentially contributing to the development of arrhythmogenic events in ACM.

Single-cell Transcriptomics Reveals Dynamic Role of Smooth Muscle Cells and Enrichment of Immune Cell Subsets in Human Abdominal Aortic Aneurysms.

To determine cell-specific gene expression profiles that contribute to development of abdominal aortic aneurysms (AAAs). AAAs represent the most common pathological aortic dilation leading to the fatal consequence of aortic rupture. Both immune and structural cells contribute to aortic degeneration, however, gene specific alterations in these cellular subsets are poorly understood. We performed single-cell RNA sequencing (scRNA-seq) analysis of AAAs and control tissues. AAA-related changes were examined by comparing gene expression profiles as well as detailed receptor-ligand interactions. An integrative analysis of scRNA-seq data with large genome-wide association study data was conducted to identify genes critical for AAA development. Using scRNA-seq we provide the first comprehensive characterization of the cellular landscape in human AAA tissues. Unbiased clustering analysis of transcriptional profiles identified seventeen clusters representing 8 cell lineages. For immune cells, clustering analysis identified 4 T-cell and 5 monocyte/macrophage subpopulations, with distinct transcriptional profiles in AAAs compared to controls. Gene enrichment analysis on immune subsets identified multiple pathways only expressed in AAA tissue, including those involved in mitochondrial dysfunction, proliferation, and cytokine secretion. Moreover, receptor-ligand analysis defined robust interactions between vascular smooth muscle cells and myeloid populations in AAA tissues. Lastly, integrated analysis of scRNA-seq data with genome-wide association study studies determined that vascular smooth muscle cell expression of SORT1 is critical for maintaining normal aortic wall function. Here we provide the first comprehensive evaluation of single-cell composition of the abdominal aortic wall and reveal how the gene expression landscape is altered in human AAAs.

MEDB-62. Disease-associated KBTBD4 mutations in medulloblastoma elicit neomorphic ubiquitylation activity to promote CoREST degradation

Genomic studies in medulloblastoma have identified distinct disease subgroups: wnt/wingless (WNT), sonic hedgehog (SHH), and non-WNT/non-SHH, comprising group 3 and group 4. Alterations in WNT and SHH signalling form the pathogenetic basis for their subgroups, whereas those for non-WNT/non-SHH tumours remain largely elusive. Recent analyses have revealed recurrent in-frame insertions in the E3 ubiquitin ligase adaptor Kelch Repeat and BTB Domain Containing 4 (KBTBD4) in cases of group 3 and group 4 medulloblastoma. Critically, group 3 and 4 tumours with KBTBD4 mutations typically lack other gene-specific alterations, such as MYC amplification, indicating KBTBD4 insertion mutations as the primary genetic driver of these malignancies. Delineating the role of KBTBD4 mutations in medulloblastoma thus offers significant opportunities to understand its pathogenesis and exploit underpinning mechanisms therapeutically, however their function is currently unknown. Here, we show a novel mechanism in cancer pathogenesis whereby indel mutations in KBTBD4 drive its recognition of neo-substrates for degradation. We observe that KBTBD4 mutants promote the recruitment and ubiquitylation of the REST Corepressor (CoREST), which forms a complex to modulate chromatin accessibility and transcriptional programmes. The degradation of CoREST promoted by KBTBD4 mutations diverts epigenetic programmes inducing significant alterations in transcription to promote increased stemness of cancer cells. Transcriptional analysis of >200 human group 3 and 4 medulloblastomas by RNA-seq, highlights the presence of CoREST and stem-like signatures in tumours with KBTBD4 mutations, which extend to a further sub-set of non-mutant tumours, suggesting CoREST alterations as a novel pathogenetic mechanism of wide relevance in group 3 and 4. Our findings uncover KBTBD4 mutation as a novel driver of epigenetic reprogramming in non-WNT/non-SHH medulloblastoma, establishes a novel mode of tumorigenesis through gain-of-function mutations in ubiquitin ligases (neo-substrate recruitment) and identifies both mutant KBTBD4 and CoREST complexes as new druggable targets for improved tumour-specific therapies.

Evidence for TET-mediated DNA demethylation as an epigenetic alteration in cumulus granulosa cells of women with polycystic ovary syndrome

Peripheral and tissue-specific alterations in global DNA methylation (5-methylcytosine (5mC)) and DNA hydroxymethylation (5-hydroxymethylcytosine (5hmC)) profiles have been identified as both biomarkers for disease prediction and as hallmarks of dysregulated localized gene networks. Global and gene-specific epigenetic alterations in the 5mC profiles have shown widespread implications in the etiology of polycystic ovary syndrome (PCOS). However, there has been no study in PCOS that integrates the quantification of 5mC and 5hmC signatures alongside the expression levels of DNA methylating and demethylating enzymes as respective indicators of methylation and demethylation pathways. Having previously shown that the 5mC signatures are not substantially altered in PCOS, we assessed the global 5hmC levels in peripheral blood leukocytes and cumulus granulosa cells (CGCs) of 40 controls and 40 women with PCOS. This analysis revealed higher 5hmC levels in CGCs of PCOS women, indicating a more dominant demethylation pathway. Furthermore, we assessed the transcript and protein expression levels of DNA demethylating and methylating enzymes, i.e. ten-eleven translocation methylcytosine dioxygenases (TET1, TET2, TET3) and DNA methyltransferases (DNMT1, DNMT3A and DNMT3B), respectively, in CGCs. The relative transcript and protein expression levels of all three TETs were found to be higher in women with PCOS, and the TET mRNA expression profiles were positively correlated with 5hmC levels in CGCs. Also, all three DNMT genes showed altered transcript expression in PCOS, although only the downregulated DNMT3A transcript was correlated with decreasing 5mC levels. At the protein level, the expression of DNMT1 (maintenance methylation enzyme) was higher, while that of DNMT3A (de novo methylation enzyme) was found to be lower in PCOS compared to controls. Overall, these results indicate that DNA methylation changes in CGCs of PCOS women may arise partly due to intrinsic alterations in the transcriptional regulation of TETs and DNMT3A.

Disease-associated KBTBD4 mutations in medulloblastoma elicit neomorphic ubiquitylation activity to promote CoREST degradation

Medulloblastoma is the most common malignant brain tumour in children. Genomic studies have identified distinct disease subgroups: wnt/wingless (WNT), sonic hedgehog (SHH), and non-WNT/non-SHH, comprising group 3 and group 4. Alterations in WNT and SHH signalling form the pathogenetic basis for their subgroups, whereas those for non-WNT/non-SHH tumours remain largely elusive. Recent analyses have revealed recurrent in-frame insertions in the E3 ubiquitin ligase adaptor Kelch Repeat and BTB Domain Containing 4 (KBTBD4) in cases of group 3/4 medulloblastoma. Critically, group 3/4 tumours with KBTBD4 mutations typically lack other gene-specific alterations, such as MYC amplification, indicating KBTBD4 insertion mutations as the primary genetic driver. Delineating the role of KBTBD4 mutations thus offers significant opportunities to understand tumour pathogenesis and to exploit the underpinning mechanisms therapeutically. Here, we show a novel mechanism in cancer pathogenesis whereby indel mutations in KBTBD4 drive its recognition of neo-substrates for degradation. We observe that KBTBD4 mutants promote the recruitment and ubiquitylation of the REST Corepressor (CoREST), which forms a complex to modulate chromatin accessibility and transcriptional programmes. The degradation of CoREST promoted by KBTBD4 mutation diverts epigenetic programmes inducing significant alterations in transcription to promote increased stemness of cancer cells. Transcriptional analysis of >200 human group 3 and 4 medulloblastomas by RNA-seq, highlights the presence of CoREST and stem-like signatures in tumours with KBTBD4 mutations, which extend to a further sub-set of non-mutant tumours, suggesting CoREST alterations as a novel pathogenetic mechanism of wide relevance in groups 3 and 4. Our findings uncover KBTBD4 mutation as a novel driver of epigenetic reprogramming in non-WNT/non-SHH medulloblastoma, establish a novel mode of tumorigenesis through gain-of-function mutations in ubiquitin ligases (neo-substrate recruitment) and identify both mutant KBTBD4 and CoREST complexes as new druggable targets for improved tumour-specific therapies.

The tyrosine kinase inhibitor LPM4870108 impairs learning and memory and induces transcriptomic and gene‑specific DNA methylation changes in rats.

Tyrosine kinase inhibitors (TKIs), which have been developed and approved for cancer treatment in the last few years, are involved in synaptic plasticity of learning and memory. Epigenetic modifications also play crucial roles in the process of learning and memory, but its relationship with TKI-induced learning and memory impairment has not been investigated. We hypothesized that LPM4870108, an effective anti-cancer Trk inhibitor, might affect the learning and memory via epigenetic modifications. In this study, rats were orally administered with LPM4870108 (0, 1.25, 2.5, or 5.0mg/kg) twice daily for 28days, after which animals were subjected to a Morris water maze test. LPM4870108 exposure caused learning and memory impairments in this test in a dose-dependent manner and reduced the spine densities. Whole-genome transcriptomic analysis revealed significant differences in the patterns of hippocampal gene expression in LPM4870108-treated rats. These transcriptomic data were combined with next-generation bisulfite sequencing analysis, after which RT-PCR and pyrosequencing were conducted, revealing epigenetic alterations associated with genes (Snx8, Fgfr1, Dusp4, Vav2, and Satb2) known to regulate learning and memory. Increased mRNA and protein expression levels of hippocampal Dnmt1 and Dnmt3a were also observed in these rats. Overall, these data suggest that gene-specific alterations in patterns of DNA methylation can potentially contribute to the incidence of learning and memory deficits associated with exposure to LPM4870108.

Dysregulation of Npas4 and Inhba expression and an altered excitation-inhibition balance are associated with cognitive deficits in DBA/2 mice.

Differences in the learning associated transcriptional profiles between mouse strains with distinct learning abilities could provide insight into the molecular basis of learning and memory. The inbred mouse strain DBA/2 shows deficits in hippocampus-dependent memory, yet the transcriptional responses to learning and the underlying mechanisms of the impairments are unknown. Comparing DBA/2J mice with the reference standard C57BL/6N mouse strain we verify an enhanced susceptibility to kainic acid induced seizures, confirm impairments in hippocampus-dependent spatial memory tasks and uncover additional behavioral abnormalities including deficits in hippocampus-independent learning. Surprisingly, we found no broad dysfunction of the DBA/2J strain in immediate early gene (IEG) activation but instead report brain region-specific and gene-specific alterations. The learning-associated IEGs Arc, c-Fos, and Nr4a1 showed no DBA/2J deficits in basal or synaptic activity induced gene expression in hippocampal or cortical primary neuronal cultures or in the CA1, CA3, or retrosplenial cortex following spatial object recognition (SOR) training in vivo. However, the parietal cortex showed reduced and the dentate gyrus showed enhanced SOR-evoked induction of most IEGs. All DBA/2J hippocampal regions exhibited elevated basal expression of inhibin β A (Inhba) and a learning-associated superinduction of the transcription factor neuronal Per-Arnt-Sim domain protein 4 (Npas4) known to regulate the synaptic excitation-inhibition balance. In line with this, CA1 pyramidal neurons of DBA/2J mice showed fewer inhibitory and more excitatory miniature postsynaptic currents but no alteration in most other electrophysiological properties or gross dendritic morphology. The dysregulation of Npas4 and Inhba expression and synaptic connectivity may underlie the cognitive deficits and increased susceptibility to seizures of DBA/2J mice.

Precision oncology in metastatic colorectal cancer - from biology to medicine.

Remarkable progress has been made in the development of biomarker-driven targeted therapies for patients with multiple cancer types, including melanoma, breast and lung tumours, although precision oncology for patients with colorectal cancer (CRC) continues to lag behind. Nonetheless, the availability of patient-derived CRC models coupled with in vitro and in vivo pharmacological and functional analyses over the past decade has finally led to advances in the field. Gene-specific alterations are not the only determinants that can successfully direct the use of targeted therapy. Indeed, successful inhibition of BRAF or KRAS in metastatic CRCs driven by activating mutations in these genes requires combinations of drugs that inhibit the mutant protein while at the same time restraining adaptive resistance via CRC-specific EGFR-mediated feedback loops. The emerging paradigm is, therefore, that the intrinsic biology of CRC cells must be considered alongside the molecular profiles of individual tumours in order to successfully personalize treatment. In this Review, we outline how preclinical studies based on patient-derived models have informed the design of practice-changing clinical trials. The integration of these experiences into a common framework will reshape the future design of biology-informed clinical trials in this field.

Role of DNA methylation-related chromatin remodeling in aryl hydrocarbon receptor-dependent regulation of T-2 toxin highly inducible Cytochrome P450 1A4 gene.

Mycotoxins are toxic secondary metabolites produced by food-contaminating fungi, which lead to global epigenetic changes and cause toxicity to both farm animals and humans. However, whether mycotoxins induce gene-specific epigenetic alterations associated with inducible downstream gene expression is unclear as are the underlying regulatory mechanisms. Here, we found that T-2 toxin and its deacetylated metabolites but not deoxynivalenol (DON) or other representative mycotoxins highly induced the expression of cytochrome P450 1A4 (CYP1A4) in both Leghorn male hepatoma (LMH) cells and chicken primary hepatocytes, and this effect was related to the regulation of both aryl hydrocarbon receptor (AhR) and DNA methylation. We used methylation-sensitive restriction enzyme digestion-qPCR (MSRE-qPCR) and chromatin immunoprecipitation (ChIP) assays and found that the binding of DNA methyltransferase 1 (DNMT1) and histone deacetylase 2 (HDAC2) to highly methylated CpG island 3-2 at the enhancer of CYP1A4 was accompanied by the recruitment of the repressive histone modification marker H3K27me3, inducing a silent state. In turn, T-2 toxin stimulation enriched the binding of AhR to demethylated CpG island 3-2, which facilitated p300 and H3K9ac recruitment and ultimately generated an activated chromatin structure at the enhancer by increasing the active histone modification markers, including H3K4me3, H3K27ac, and H3K14ac. Interestingly, T-2 toxin-induced AhR activation also facilitated RNA polymerase II binding to CpG island 2, which may form a transcriptionally active chromatin structure at the promoter and ultimately transactivate CYP1A4. Our findings provide novel insights into the epigenetic regulation of T-2 toxin-induced gene expression.

Immunotherapy Sensitivity of Mismatch Repair-Deficient Cancer: Mutation Load Is Not Enough

Abundant neoantigens are considered responsible for the immunotherapy sensitivity of mismatch repair-deficient (MMRd) cancers. In this issue of Cancer Cell, two papers show that MLH1 mismatch repair gene loss promotes cGAS-STING activation, interferon secretion, and Tcell priming. This may be essential for the high immunotherapy sensitivity in MMRd cancer.

S182. HISTONE H3 AND H4 POST-TRANSLATIONAL REGULATION IN SCHIZOPHRENIA POSTMORTEM BRAIN: EFFECT OF ANTIPSYCHOTIC TREATMENT

BackgroundEpigenetic modifications recording obstetrical adverse events are a fundamental component of the neurodevelopmental hypothesis of schizophrenia (SZ). Epigenome-wide association studies performed in peripheral tissues samples of first-episode cases or young population at high risk of SZ lack from brain tissue specificity. Unfortunately, with the current technology, brain epigenetic mechanisms can only be assessed postmortem, difficulting the separation of illness-specific features from confounding factors, such as medication intake. Besides, most postmortem brain studies focused in gene-specific epigenetic alterations, with few studies reporting findings on the overall load of epigenetic modifications. Here, we mapped the most common post-translational modifications (PTM) occurring at histone level (H3 and H4) in a well-characterized case-control cohort, large enough to address the effects of most typical confounders in postmortem brain studies.MethodsDorsolateral prefrontal cortex (DLPFC) samples from SZ subjects (n=22) and sex-, age- and postmortem interval- (PMI) matched controls (n=22) were obtained at autopsies in the Basque Institute of Legal Medicine. Medical and toxicological reports were obtained as part of the forensic investigations. Cases with DSM-IV-based SZ diagnoses were selected, excluding those with neurological or psychiatric conditions, or those presenting drugs of abuse in blood samples. Blood toxicology also allowed the separation between antipsychotic drug (APD) treated (n=10) from APD-free (n=12) cases. Cortical levels of repressing (trimethylated H3 at Lys27 [H3K27me3] and H4 at Lys20 [H4K20me3]) and activating (trimethylated H3 at Lys4 [H3K4me3], acetylated H3 at Lys9 [AcH3K9] and Lys27 [AcH3K27], and acetylated H4 at Lys16 [AcH4K16]) histone H3 and H4 protein species were quantified by Western blotting using selective antibodies.ResultsDLPFC expression levels of total forms of histone H3 and H4 proteins did not differ between SZ subjects and controls. However, SZ was associated with a significant upregulation of the histone H3 activating mark AcH3K9 (+32%, p<0.05). Both APD-free and APD-treated cases showed similar alterations on this H3 PTM. AcH3K9 upregulation was not driven by any of the confounders evaluated, including sex, age, PMI, suicide, or the presence of alcohol or other psychoactive drugs in blood samples. All other gene activating and repressing epigenetic marks studied at histones H3 and H4 remained unchanged in SZ brains, compared to controls.DiscussionUpregulated cortical AcH3K9 levels may be associated with overall, unspecific increase of gene expression in SZ cortical cells. Notably, AcH3K9 modulation seems an illness specific epigenetic signature, as medication or other confounders had no impact on AcH3K9 amounts. Future research will focus on the cell specificity of this finding, which might provide new clues toward future interventions at the molecular level in SZ.

Recapitulating the human segmentation clock with pluripotent stem cells.

Pluripotent stem cells are increasingly used to model different aspects of embryogenesis and organ formation1. Despite recent advances in in vitro induction of major mesodermal lineages and cell types2,3, experimental model systems that can recapitulate more complex features of human mesoderm development and patterning are largely missing. Here we used induced pluripotent stem cells for the stepwise in vitro induction of presomitic mesoderm and its derivatives to model distinct aspects of human somitogenesis. We focused initially on modelling the human segmentation clock, a major biological concept believed to underlie the rhythmic and controlled emergence of somites, which give rise to the segmental pattern of the vertebrate axial skeleton. We observed oscillatory expression of core segmentation clock genes, including HES7 and DKK1, determined the period of the human segmentation clock to be around five hours, and demonstrated the presence of dynamic travelling-wave-like gene expression in in vitro-induced human presomitic mesoderm. Furthermore, we identified and compared oscillatory genes in human and mouse presomitic mesoderm derived from pluripotent stem cells, which revealed species-specific and shared molecular components and pathways associated with the putative mouse and human segmentation clocks. Using CRISPR-Cas9-based genome editing technology, we then targeted genes for which mutations in patients with segmentation defects of the vertebrae, such as spondylocostal dysostosis, have been reported (HES7, LFNG, DLL3 and MESP2). Subsequent analysis of patient-like and patient-derived induced pluripotent stem cells revealed gene-specific alterations in oscillation, synchronization or differentiation properties. Our findings provide insights into the human segmentation clock as well as diseases associated with human axial skeletogenesis.

DNA methylation in thyroid cancer.

In recent years, cancer genomics has provided new insights into genetic alterations and signaling pathways involved in thyroid cancer. However, the picture of the molecular landscape is not yet complete. DNA methylation, the most widely studied epigenetic mechanism, is altered in thyroid cancer. Recent technological advances have allowed the identification of novel differentially methylated regions, methylation signatures and potential biomarkers. However, despite recent progress in cataloging methylation alterations in thyroid cancer, many questions remain unanswered. The aim of this review is to comprehensively examine the current knowledge on DNA methylation in thyroid cancer and discuss its potential clinical applications. After providing a general overview of DNA methylation and its dysregulation in cancer, we carefully describe the aberrant methylation changes in thyroid cancer and relate them to methylation patterns, global hypomethylation and gene-specific alterations. We hope this review helps to accelerate the use of the diagnostic, prognostic and therapeutic potential of DNA methylation for the benefit of thyroid cancer patients.

PO-101 P53 core domain activity at low PH

IntroductionThe wild-type p53 is a nuclear tumour suppressor whose DNA binding function is critical for protection against cancer. The major role of p53 in normal cells is to induce cell cycle arrest or apoptosis in response cellular stress, particularly DNA damage. The region responsible for DNA interaction is located in its core domain (p53C). The specific DNA binding activity of p53 is crucial for its tumour suppression function. Missense mutations in the p53 gene are the most frequent type of gene-specific alterations in human cancer. These oncogenic mutant forms of p53 are deficient for specific DNA binding.Material and methodsDNA binding affinities of the p53C with either poly(GC) DNA or consensus DNA (5’ TTTCCTAGACATGCCTAATTA 3’) at low pH were monitored by anisotropy and intrinsic fluorescence, circular dichroism (CD), EMSA (Electrophoretic mobility shift assay) and isothermal titration calorimetry (ITC). HSQC and 1D- NMR (Nuclear magnetic resonance) measurements were carried out to observe the effect of pH on p53 structure.Results and discussionsOur results provided evidence that the specificity and stability of p53 protein:DNA complexes are influenced by pH. We describe the interaction of DNA and p53 at several pH (5.0, 5.5, 6.0, 6.5, 7.2) using fluorescence anisotropy. We confirm the formation of p53C:DNA complex under the same conditions by EMSA and ITC. Comparison of 1D and HSQC spectrum indicates structural changes in the presence of DNA when subjected at 7.2 or 6.0 pH. Far-UV CD shows that the secondary structure of p53 is maintained in the presence of specific (consensus) or unspecific (poliGC) DNA sequences in most studied pH, except at 5.0 pH. To verify the stability of p53:DNA complex at 5.0 pH, we use high pressure. This tool promote a greater effect on the p53 in the absence of DNA when compared with effect caused in the protein:DNA complex.ConclusionAltogether, these data support the hypothesis that the activity of p53 is maintained even after the acidification suggesting the pH change may have implications on cancer patology.

Differences in MWCNT- and SWCNT-induced DNA methylation alterations in association with the nuclear deposition

BackgroundSubtle DNA methylation alterations mediated by carbon nanotubes (CNTs) exposure might contribute to pathogenesis and disease susceptibility. It is known that both multi-walled carbon nanotubes (MWCNTs) and single-walled carbon nanotubes (SWCNTs) interact with nucleus. Such, nuclear-CNT interaction may affect the DNA methylation effects.In order to understand the epigenetic toxicity, in particular DNA methylation alterations, of SWCNTs and short MWCNTs, we performed global/genome-wide, gene-specific DNA methylation and RNA-expression analyses after exposing human bronchial epithelial cells (16HBE14o- cell line). In addition, the presence of CNTs on/in the cell nucleus was evaluated in a label-free way using femtosecond pulsed laser microscopy.ResultsGenerally, a higher number of SWCNTs, compared to MWCNTs, was deposited at both the cellular and nuclear level after exposure. Nonetheless, both CNT types were in physical contact with the nuclei. While particle type dependency was noticed for the identified genome-wide and gene-specific alterations, no global DNA methylation alteration on 5-methylcytosine (5-mC) sites was observed for both CNTs. After exposure to MWCNTs, 2398 genes were hypomethylated (at gene promoters), and after exposure to SWCNTs, 589 CpG sites (located on 501 genes) were either hypo- (N = 493 CpG sites) or hypermethylated (N = 96 CpG sites).Cells exposed to MWCNTs exhibited a better correlation between gene promoter methylation and gene expression alterations. Differentially methylated and expressed genes induced changes (MWCNTs > SWCNTs) at different cellular pathways, such as p53 signalling, DNA damage repair and cell cycle. On the other hand, SWCNT exposure showed hypermethylation on functionally important genes, such as SKI proto-oncogene (SKI), glutathione S-transferase pi 1 (GTSP1) and shroom family member 2 (SHROOM2) and neurofibromatosis type I (NF1), which the latter is both hypermethylated and downregulated.ConclusionAfter exposure to both types of CNTs, epigenetic alterations may contribute to toxic or repair response. Moreover, our results suggest that the observed differences in the epigenetic response depend on particle type and differential CNT-nucleus interactions.

Wogonoside induces depalmitoylation and translocation of PLSCR1 and N-RAS in primary acute myeloid leukaemia cells.

Acute myeloid leukaemia (AML) comprises a range of disparate genetic subtypes, involving complex gene mutations and specific molecular alterations. Post‐translational modifications of specific proteins influence their translocation, stability, aggregation and even leading disease progression. Therapies that target to post‐translational modification of specific proteins in cancer cells represent a novel treatment strategy. Non‐homogenous subcellular distribution of PLSCR1 is involved in the primary AML cell differentiation. However, the nuclear translocation mechanism of PLSCR1 remains poorly understood. Here, we leveraged the observation that nuclear translocation of PLSCR1 could be induced during wogonoside treatment in some primary AML cells, despite their genetic heterogeneity that contributed to the depalmitoylation of PLSCR1 via acyl protein thioesterase 1 (APT‐1), an enzyme catalysing protein depalmitoylation. Besides, we found a similar phenomenon on another AML‐related protein, N‐RAS. Wogonoside inhibited the palmitoylation of small GTPase N‐RAS and enhanced its trafficking into Golgi complex, leading to the inactivation of N‐RAS/RAF1 pathway in some primary AML cells. Taken together, our findings provide new insight into the mechanism of wogonoside‐induced nuclear translocation of PLSCR1 and illuminate the influence of N‐RAS depalmitoylation on its Golgi trafficking and RAF1 signalling inactivation in AML.

Learning and Age-Related Changes in Genome-wide H2A.Z Binding in the Mouse Hippocampus

Histone variants were recently discovered to regulate neural plasticity, with H2A.Z emerging as a memory suppressor. Using whole-genome sequencing of the mouse hippocampus, we show that basal H2A.Z occupancy is positively associated with steady-statetranscription, whereas learning-induced H2A.Z removal is associated with learning-induced gene expression. AAV-mediated H2A.Z depletion enhanced fear memory and resulted in gene-specific alterations of learning-induced transcription, reinforcing the role of H2A.Z as a memory suppressor. H2A.Z accumulated with age, although it remained sensitive to learning-induced eviction. Learning-related H2A.Z removal occurred at largely distinct genes in young versus aged mice, suggesting that H2A.Z is subject to regulatory shifts in the aged brain despite similar memory performance. When combined with prior evidence of H3.3 accumulation in neurons, our data suggest that nucleosome composition in the brain is reorganized with age.

Progression inference for somatic mutations in cancer.

Computational methods were employed to determine progression inference of genomic alterations in commonly occurring cancers. Using cross-sectional TCGA data, we computed evolutionary trajectories involving selectivity relationships among pairs of gene-specific genomic alterations such as somatic mutations, deletions, amplifications, downregulation, and upregulation among the top 20 driver genes associated with each cancer. Results indicate that the majority of hierarchies involved TP53, PIK3CA, ERBB2, APC, KRAS, EGFR, IDH1, VHL, etc. Research into the order and accumulation of genomic alterations among cancer driver genes will ever-increase as the costs of nextgen sequencing subside, and personalized/precision medicine incorporates whole-genome scans into the diagnosis and treatment of cancer.

Virus Innexins induce alterations in insect cell and tissue function

Polydnaviruses are dsDNA viruses that induce immune and developmental alterations in their caterpillar hosts. Characterization of polydnavirus gene families and family members is necessary to understand mechanisms of pathology and evolution of these viruses, and may aid to elucidate the role of host homologues if present. For example, the polydnavirus vinnexin gene family encodes homologues of insect gap junction genes (innexins) that are expressed in host immune cells (hemocytes). While the roles of Innexin proteins and gap junctions in insect immunity are largely unclear, we previously demonstrated that Vinnexins form functional gap junctions and alter the junctional characteristics of a host Innexin when co-expressed in paired Xenopus oocytes. Here, we test the effect of ectopic vinnexin expression on host cell physiology using both a lepidopteran cell culture model and a dipteran whole organism model. Vinnexin expression in the cell culture system resulted in gene-specific alterations in cell morphology and a slight, but non-statistically significant, reduction in gap junction activity as measured by dye transfer, while ectopic expression of a lepidopteran innexin2 gene led to morphological alterations and increase in gap junction activity. Global ectopic expression in the model dipteran, Drosophila melanogaster, of one vinnexin (vinnexinG) or D. melanogaster innexin2 (Dm-inx2) resulted in embryonic lethality, while expression of the other vinnexin genes had no effect. Furthermore, ectopic expression of vinnexinG, but not other vinnexin genes or Dm-inx2, in D. melanogaster larval gut resulted in developmental arrest in the pupal stage. These data indicate the vinnexins likely have gene-specific roles in host manipulation. They also support the use of Drosophila in further analysis of the role of Vinnexins and other polydnavirus genes in modifying host physiological processes. Finally, our findings suggest the vinnexin genes may be useful to perturb and characterize the physiological functions of insect Innexins.