Gene Expression In Archaea Research Articles

DNA-bridging by an archaeal histone variant via a unique tetramerisation interface

In eukaryotes, histone paralogues form obligate heterodimers such as H3/H4 and H2A/H2B that assemble into octameric nucleosome particles. Archaeal histones are dimeric and assemble on DNA into ‘hypernucleosome’ particles of varying sizes with each dimer wrapping 30 bp of DNA. These are composed of canonical and variant histone paralogues, but the function of these variants is poorly understood. Here, we characterise the structure and function of the histone paralogue MJ1647 from Methanocaldococcus jannaschii that has a unique C-terminal extension enabling homotetramerisation. The 1.9 Å X-ray structure of a dimeric MJ1647 species, structural modelling of the tetramer, and site-directed mutagenesis reveal that the C-terminal tetramerization module consists of two alpha helices in a handshake arrangement. Unlike canonical histones, MJ1647 tetramers can bridge two DNA molecules in vitro. Using single-molecule tethered particle motion and DNA binding assays, we show that MJ1647 tetramers bind ~60 bp DNA and compact DNA in a highly cooperative manner. We furthermore show that MJ1647 effectively competes with the transcription machinery to block access to the promoter in vitro. To the best of our knowledge, MJ1647 is the first histone shown to have DNA bridging properties, which has important implications for genome structure and gene expression in archaea.

Evolution of Regulated Transcription.

The genomes of all organisms abound with various cis-regulatory elements, which control gene activity. Transcriptional enhancers are a key group of such elements in eukaryotes and are DNA regions that form physical contacts with gene promoters and precisely orchestrate gene expression programs. Here, we follow gradual evolution of this regulatory system and discuss its features in different organisms. In eubacteria, an enhancer-like element is often a single regulatory element, is usually proximal to the core promoter, and is occupied by one or a few activators. Activation of gene expression in archaea is accompanied by the recruitment of an activator to several enhancer-like sites in the upstream promoter region. In eukaryotes, activation of expression is accompanied by the recruitment of activators to multiple enhancers, which may be distant from the core promoter, and the activators act through coactivators. The role of the general DNA architecture in transcription control increases in evolution. As a whole, it can be seen that enhancers of multicellular eukaryotes evolved from the corresponding prototypic enhancer-like regulatory elements with the gradually increasing genome size of organisms.

Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System

The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon.

Development ofβ-Lactamase as a Tool for Monitoring Conditional Gene Expression by a Tetracycline-Riboswitch inMethanosarcina acetivorans

The use of reporter gene fusions to assess cellular processes such as protein targeting and regulation of transcription or translation is established technology in archaeal, bacterial, and eukaryal genetics. Fluorescent proteins or enzymes resulting in chromogenic substrate turnover, like β-galactosidase, have been particularly useful for microscopic and screening purposes. However, application of such methodology is of limited use for strictly anaerobic organisms due to the requirement of molecular oxygen for chromophore formation or color development. We have developed β-lactamase from Escherichia coli (encoded by bla) in conjunction with the chromogenic substrate nitrocefin into a reporter system usable under anaerobic conditions for the methanogenic archaeon Methanosarcina acetivorans. By using a signal peptide of a putative flagellin from M. acetivorans and different catabolic promoters, we could demonstrate growth substrate-dependent secretion of β-lactamase, facilitating its use in colony screening on agar plates. Furthermore, a series of fusions comprised of a constitutive promoter and sequences encoding variants of the synthetic tetracycline-responsive riboswitch (tc-RS) was created to characterize its influence on translation initiation in M. acetivorans. One tc-RS variant resulted in more than 11-fold tetracycline-dependent regulation of bla expression, which is in the range of regulation by naturally occurring riboswitches. Thus, tc-RS fusions represent the first solely cis-active, that is, factor-independent system for controlled gene expression in Archaea.

Archaeal chromatin proteins

Archaea, along with Bacteria and Eukarya, are the three domains of life. In all living cells, chromatin proteins serve a crucial role in maintaining the integrity of the structure and function of the genome. An array of small, abundant and basic DNA-binding proteins, considered candidates for chromatin proteins, has been isolated from the Euryarchaeota and the Crenarchaeota, the two major phyla in Archaea. While most euryarchaea encode proteins resembling eukaryotic histones, crenarchaea appear to synthesize a number of unique DNA-binding proteins likely involved in chromosomal organization. Several of these proteins (e.g., archaeal histones, Sac10b homologs, Sul7d, Cren7, CC1, etc.) have been extensively studied. However, whether they are chromatin proteins and how they function in vivo remain to be fully understood. Future investigation of archaeal chromatin proteins will lead to a better understanding of chromosomal organization and gene expression in Archaea and provide valuable information on the evolution of DNA packaging in cellular life.

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Individual gvp transcript segments in Haloferax mediterranei exhibit varying half-lives, which are differentially affected by salt concentration and growth phase.

The mc-gvp genes for gas vesicle formation in Haloferax mediterranei are transcribed from two promoters located in front of the mc-gvpA and mc-gvpD genes. The different transcripts originating from both promoters show different abundances dependent on salt concentration in the medium and growth phase. Here we show that the half-lives of these transcripts differ significantly and that the small gvp transcripts exhibit higher stabilities than the larger gvp transcripts. While the stability of most gvp transcripts is independent of the salt concentration in the medium, the gvpA mRNA decays about twice as fast in cultures grown at 18% salt compared to cultures grown at 25% salt. The stability of the 0.45 kb transcript population derived from the 5' part of the gvpD gene depends on the growth phase of the culture. Thus, differences in mRNA stability contribute to the salt-dependent and growth phase-dependent abundance of gvp transcripts. This implies that, like in bacteria and eukarya, mRNA processing contributes to regulated gene expression in archaea.

An Lrp-like Transcriptional Regulator from the ArchaeonPyrococcus furiosus Is Negatively Autoregulated

The archaeal transcriptional initiation machinery closely resembles core elements of the eukaryal polymerase II system. However, apart from the established basal archaeal transcription system, little is known about the modulation of gene expression in archaea. At present, no obvious eukaryal-like transcriptional regulators have been identified in archaea. Instead, we have previously isolated an archaeal gene, the Pyrococcus furiosus lrpA, that potentially encodes a bacterial-like transcriptional regulator. In the present study, we have for the first time addressed the actual involvement of an archaeal Lrp homologue in transcription modulation. For that purpose, we have produced LrpA in Escherichia coli. In a cell-free P. furiosus transcription system we used wild-type and mutated lrpA promoter fragments to demonstrate that the purified LrpA negatively regulates its own transcription. In addition, gel retardation analyses revealed a single protein-DNA complex, in which LrpA appeared to be present in (at least) a tetrameric conformation. The location of the LrpA binding site was further identified by DNaseI and hydroxyl radical footprinting, indicating that LrpA binds to a 46-base pair sequence that overlaps the transcriptional start site of its own promoter. The molecular basis of the transcription inhibition by LrpA is discussed.

An Lrp-like protein of the hyperthermophilic archaeon Sulfolobus solfataricus which binds to its own promoter.

Regulation of gene expression in the domain Archaea, and specifically hyperthermophiles, has been poorly investigated so far. Biochemical experiments and genome sequencing have shown that, despite the prokaryotic cell and genome organization, basal transcriptional elements of members of the domain Archaea (i.e., TATA box-like sequences, RNA polymerase, and transcription factors TBP, TFIIB, and TFIIS) are of the eukaryotic type. However, open reading frames potentially coding for bacterium-type transcription regulation factors have been recognized in different archaeal strains. This finding raises the question of how bacterial and eukaryotic elements interact in regulating gene expression in Archaea. We have identified a gene coding for a bacterium-type transcription factor in the hyperthermophilic archaeon Sulfolobus solfataricus. The protein, named Lrs14, contains a potential helix-turn-helix motif and is related to the Lrp-AsnC family of regulators of gene expression in the class Bacteria. We show that Lrs14, expressed in Escherichia coli, is a highly thermostable DNA-binding protein. Bandshift and DNase I footprint analyses show that Lrs14 specifically binds to multiple sequences in its own promoter and that the region of binding overlaps the TATA box, suggesting that, like the E. coli Lrp, Lrs14 is autoregulated. We also show that the lrs14 transcript is accumulated in the late growth stages of S. solfataricus.