GDF9 Research Articles

Human Chondrocytes Respond Discordantly to the Protein Encoded by the Osteoarthritis Susceptibility Gene GDF5

A genetic deficit mediated by SNP rs143383 that leads to reduced expression of GDF5 is strongly associated with large-joint osteoarthritis. We speculated that this deficit could be attenuated by the application of exogenous GDF5 protein and as a first step we have assessed what effect such application has on primary osteoarthritis chondrocyte gene expression. Chondrocytes harvested from cartilage of osteoarthritic patients who had undergone joint replacement were cultured with wildtype recombinant mouse and human GDF5 protein. We also studied variants of GDF5, one that has a higher affinity for the receptor BMPR-IA and one that is insensitive to the GDF5 antagonist noggin. As a positive control, chondrocytes were treated with TGF-β1. Chondrocytes were cultured in monolayer and micromass and the expression of genes coding for catabolic and anabolic proteins of cartilage were measured by quantitative PCR. The expression of the GDF5 receptor genes and the presence of their protein products was confirmed and the ability of GDF5 signal to translocate to the nucleus was demonstrated by the activation of a luciferase reporter construct. The capacity of GDF5 to elicit an intracellular signal in chondrocytes was demonstrated by the phosphorylation of intracellular Smads. Chondrocytes cultured with TGF-β1 demonstrated a consistent down regulation of MMP1, MMP13 and a consistent upregulation of TIMP1 and COL2A1 with both culture techniques. In contrast, chondrocytes cultured with wildtype GDF5, or its variants, did not show any consistent response, irrespective of the culture technique used. Our results show that osteoarthritis chondrocytes do not respond in a predictable manner to culture with exogenous GDF5. This may be a cause or a consequence of the osteoarthritis disease process and will need to be surmounted if treatment with exogenous GDF5 is to be advanced as a potential means to overcome the genetic deficit conferring osteoarthritis susceptibility at this gene.

Identificación de los polimorfismos G1 y G8 del gen GDF9 en ovinos criollos Araucanos

SUMMARY Polymorphisms in major gene effect related to reproductive activity have been described in sheep. Mutations located in the GDF9 gene have been associated with increased ovulation rate and litter size. GDF9 factor is secreted by the oocyte and is a member of the family of transforming growth factors (TGF-β) located on chromosome 5. The aim of this study was to identify the presence of polymorphic regions (G1 and G8) in the GDF9 gene in Araucano creole sheep. DNA was extracted from 100 blood samples and the presence of mutations was determinated using PCR-RFLP. Two regions were amplified, one corresponding to exon 1 of 462 bp digested with restriction enzyme HhaI and a 139bp fragment corresponding to exon 2 digested with enzyme DdeI. The presence of polymorphisms in G1 of GDF9 gene were detected with a genotype frequency of 0.56 (genotype GG), 0.44 (genotype GA) and an allele frequency of 0.78 for the allele (G) and 0.22 for the allele (A). No polymorphisms were detected in G8. This is the first report of this polymorphism in sheep in Chile that could serve as a genetic marker for marker for prolificacy selection in the the Araucano creole sheep.

Wplyw wybranych gen�w na cechy uzytkowe owiec

In order to enhance breeding progress, genes that affect the performance of sheep are being identified. In Poland, sheep breeding programs focus mainly on meat performance, therefore, it is important to identify genes that affect it. Moreover, studies on reproductive performance of sheep have been made. Myostatin (GDF8), calpastatin (CAST) and calpain have been identified as the candidate genes affecting meat quality. Whereas, BMP15 and GDF9, also called "fertility genes" (Fec), have been reported to affect reproduction traits. The knowledge of the association between the polymorphic forms of these genes and sheep performance traits may contribute to the determination of genetic markers that could be used in sheep breeding programs. The aim of this study is to gather the latest information about the use of genomic selection in breeding programs and the association between polymorphisms in BMP15, GDF8, GDF9 and CAST genes and sheep performance.

Effect of ovarian tissue vitrification method on mice preantral follicular development and gene expression

Vitrification is considered a viable method for cryopreservation of ovarian tissue and selection of methods that minimize follicular damage is important. The objective of the present study was to evaluate the effects of two vitrification methods on ovarian tissue morphology, preantral follicles survival rate during in vitro culture, and relative expression of genes associated with oocyte maturation and cumulus expansion. Ovaries from 12-day-old mice were vitrified in media containing ethylene glycol, dimethyl sulphoxide, and sucrose. Before plunging in liquid nitrogen, ovaries were first loaded into an acupuncture needle (needle immersion vitrification [NIV]) or placed on a cold steel surface for 10 to 20 seconds (solid surface vitrification [SSV]). The integrity of the ovarian tissue was well-preserved after vitrification and was similar controls. Follicle viability in the SSV group was lower (P < 0.05) than in the control group after 6 days of culture and the NIV group after 10 day of culture. Follicle viability after 12 day of culture was 92.8%, 82.1%, and 58.4% in control, NIV, and SSV groups, respectively. Bmp15, Gdf9, BmprII, Alk6, Alk5, Has2, and Ptgs2 gene expression patterns were similar among groups. However, the level of gene expression in the vitrification groups during Days 6 to 10 were higher compared with the control group. In conclusion, ovarian tissue morphologic integrity was well-preserved, regardless of the vitrification method. Vitrification using the needle immersion method resulted in greater follicular survival after 12 day of culture than the SSV method. Gene expression patterns during culture did not seem to explain the reduced survival rate observed in the solid surface group.

Génétique des lombalgies

Genetics of low back pain have been extensively studied during the past 15years. In twin studies, heritabilities of degenerative disc disease and of low back pain have been estimated between 29% and 80% and between 21% and 67%, respectively. The familial aggregation of degenerative disc disease may vary between 34% and 61%. A meta-analysis of a genome-wide association study has identified a genetic association with a variant of PARK2 gene. A systematic review of genetic association studies in degenerative disc disease has confirmed a moderate level of evidence for variants of ASPN, COL11A1, GDF5, SKT, THBS2 and MMP9 genes. Several variants of candidate genes coding for structural proteins of the intervertebral disc have been associated with low back pain, in particular ACAN, COL9A2, COL9A3, and ASPN, as well as functional polymorphisms of COL11A1, SPARC, and CILP genes. A genetic association has been reported for alleles coding for catabolic proteins, in particular MMP1 and MMP3. Genes coding for interleukins (IL), in particular the IL1 cluster, for growth factors and for proteins involved in pain, such as COMT, OPRM1 and GCH1, have also been reported. Genome-wide gene expression studies in the annulus have shown an upregulation of pain genes, such as Bradykinin receptor B1 and COMT. Genes of pro-inflammatory cytokines, of chemokines and of extracellular matrix components, have also been differentially expressed. In the nucleus pulposus, moderately affected discs overexpressed ACAN, COL2, SOX9, COL1 genes whereas severely affected discs overexpressed IL-1b and TNFα.

The Identification of Trans-acting Factors That Regulate the Expression of GDF5 via the Osteoarthritis Susceptibility SNP rs143383

rs143383 is a C to T transition SNP located in the 5′untranslated region (5′UTR) of the growth differentiation factor 5 gene GDF5. The T allele of the SNP is associated with increased risk of osteoarthritis (OA) in Europeans and in Asians. This susceptibility is mediated by the T allele producing less GDF5 transcript relative to the C allele, a phenomenon known as differential allelic expression (DAE). The aim of this study was to identify trans-acting factors that bind to rs143383 and which regulate this GDF5 DAE. Protein binding to the gene was investigated by two experimental approaches: 1) competition and supershift electrophoretic mobility shift assays (EMSAs) and 2) an oligonucleotide pull down assay followed by quantitative mass spectrometry. Binding was then confirmed in vivo by chromatin immunoprecipitation (ChIP), and the functional effects of candidate proteins investigated by RNA interference (RNAi) and over expression. Using these approaches the trans-acting factors Sp1, Sp3, P15, and DEAF-1 were identified as interacting with the GDF5 5′UTR. Knockdown and over expression of the factors demonstrated that Sp1, Sp3, and DEAF-1 are repressors of GDF5 expression. Depletion of DEAF-1 modulated the DAE of GDF5 and this differential allelic effect was confirmed following over expression, with the rs143383 T allele being repressed to a significantly greater extent than the rs143383 C allele. In combination, Sp1 and DEAF-1 had the greatest repressive activity. In conclusion, we have identified four trans-acting factors that are binding to GDF5, three of which are modulating GDF5 expression via the OA susceptibility locus rs143383.

Association of BMPR-1B and GDF9 genes polymorphisms and secondary protein structure changes with reproduction traits in Mehraban ewes

BMPR-1B and GDF9 genes are well known due to their important effects on litter size and mechanisms controlling ovulation rate in sheep. In the present study, polymorphisms of BMPR-1B gene exon 8 and GDF9 gene exon 1 were detected by single strand conformational polymorphism (SSCP) analysis and DNA sequencing methods in 100 Mehraban ewes. The PCR reaction forced to amplify 140 and 380-bp fragments of BMPR-1B and GDF9 genes, respectively. Two single nucleotide polymorphisms (SNPS) were identified in two different SSCP patterns of BMPR-1B gene (CC and CA genotypes) that deduced one amino acid exchange. Also, two SNPS were identified in three different SSCP patterns of GDF9 gene (AA, AG and GG genotypes) that deduced one amino acid exchanges. Two different secondary structures of protein were predicted for BMPR-1B exon 8, but the secondary protein structures predicted for GDF9 exon 1 were similar together. The evaluation of the associations between the SSCP patterns and the protein structure changes with reproduction traits showed that BMPR-1B exon 8 genotypes have significant effects on some of reproduction traits but the GDF9 genotypes did not have any significant effect. The CA genotype of BMPR-1B exon 8 had a significant positive effect on reproduction performance and could be considered as an important and new mutation, affecting the ewes reproduction performance. Marker assisted selection using BMPR-IB gene could be noticed to improve the reproduction traits in Mehraban sheep.

Screening of indigenous goats for prolificacy associated DNA markers of sheep

The present study was undertaken to explore the genetic basis of caprine prolificacy and to screen indigenous goats for prolificacy associated markers of sheep in BMPR1B, GDF9 and BMP15 genes. To detect the associated mutations and identify novel allelic variants in the candidate genes, representative samples were collected from the breeding tract of indigenous goat breeds varying in prolificacy and geographic distribution. DNA was extracted and PCR amplification was done using primers designed or available in literature for the coding DNA sequence of candidate genes. Direct sequencing was done to identify the genetic variations. Mutations in the candidate genes associated with fecundity in sheep were not detected in Indian goats. Three non-synonymous SNPs (C818T, A959C and G1189A) were identified in exon 2 of GDF9 gene out of which mutation A959C has been associated with prolificacy in exotic goats. Two novel SNPs (G735A and C808G) were observed in exon 2 of BMP15 gene.

A Study on BMPR-IB Genes of Bayanbulak Sheep.

The average twin lambing rate of Bayanbulak sheep is 2% to 3%. However, a flock of sheep with a close genetic relationship and an average of 2 to 3 lambs per birth has been found recently. To determine the major genes controlling the prolificacy of the flock in the present study, the flock was designated A while 100 normal Bayanbulak sheep were randomly selected to comprise the control flock B. Ligase detection reaction method was applied to detect and analyze the 10 mutational loci of the 3 candidate prolificacy genes including bone morphogenetic protein type I receptors, bone morphogenetic protein 15, and growth differentiation factor 9. The 10 mutational loci are as follows: FecB locus of the BMPR-IB gene; FecXI, FecXB, FecXL, FecXH, FecXG, and FecXR of the BMP15 gene; and G1, G8, and FecTT of the GDF9 gene. Two mutations including BMPR-IB/FecB and GDF9/G1 were found in Bayanbulak sheep. Independence test results of the two flocks demonstrate that the FecB locus has a significant effect on the lambing number of Bayanbulak sheep. However, the mutation frequency of the G1 locus in GDF9 is very low. Independence test results demonstrate that the GDF9 locus does not have a significant impact on the lambing performance of Bayanbulak sheep. Among the 10 detected loci, BMPR-IB/FecB is the major gene that influences the high lambing rate of Bayanbulak sheep.

269 RELATIVE TRANSCRIPT ABUNDANCE OF EIGHT MARKER GENES IN OOCYTES OF PREPUBERTAL AND CYCLIC GILTS

Oocytes from prepubertal (P) females usually show impaired quality when compared with those of adult animals. Recently, we have shown that although P oocytes mature in vitro at similar rates as oocytes from cyclic (C) gilts, they are more often chromosomally unbalanced. We have also reported some impaired processes in cytoplasmic maturation of the P oocytes. This was especially evident in cases of a disturbed mitochondria redistribution and more frequent apoptosis. It is therefore hypothesised that incomplete cytoplasmic maturation is responsible for the decreased developmental competence of porcine oocytes. A factor reflecting the status of cytoplasmic maturation is the relative transcript abundance (RA) of developmentally important genes. We investigated the RA of 8 genes known as markers of oocyte quality. Ovaries of unknown origin were collected from P and C gilts in a local slaughterhouse. Cumulus–oocyte complexes (COC) were aspirated from 2- to 6-mm follicles and evaluated morphologically. Pools of 25 denuded oocytes with a proper morphology were frozen in liquid nitrogen (pre- and post-IVM). Altogether, 4 groups of oocytes were analysed: P pre-in vitro maturation (IVM), P post-IVM, C pre-IVM, and C post-IVM. A two-step IVM protocol was performed in NCSU23 medium for 44 h. Transcript analysis included total RNA isolation followed by reverse transcription and real-time PCR using fluorescence resonance energy transfer probes for 8 genes (BMP15, GDF9, ZAR1, ATP5A1, EEF1A1, GSTA2, TOP2B, SMARCA4). Each of the four groups was represented by 6 independent oocyte pools (6 × 25 oocytes × 4 groups = 600 oocytes), which were analysed in duplicate. Among the pre-IVM oocytes, no significant differences in RA were observed. However, the post-IVM oocytes of C gilts were characterised by higher RA of 3 marker genes [BMP15 (P &lt; 0.05), GDF9 (P &lt; 0.01), ZAR1 (P &lt; 0.05)]. The RA of the GSTA2 and ATP5A1 genes showed a tendency to be higher in C oocytes, whereas the RA of the EEF1A1, TOP2B, and SMARCA4 genes did not differ between P and C gilts. Although the reduced quality of P oocytes has been well documented, only 10% of genes were differentially expressed in oocytes of P and C gilts (Paczkowski et al. 2011). In this study, we demonstrated that the sexual maturity of the donor gilt affected transcript abundance of 3 out of 8 developmentally important genes. Our results corroborate the previous findings and extend them to new transcripts (GDF9, BMP15, ZAR1). We did not show differences in the RA of genes regulating energy production and transcription (ATP5A1, EEF1A1). Some genes, such as TOP2B (apoptosis control) and SMARCA4 (a chromatin remodelling factor), were expressed at similar levels. We suggest that the RA of the ZAR1, BMP15, and GDF9 genes may serve as markers of the reduced quality of oocytes from P gilts and, because of their function, might alter cytoplasmic maturation. Funding was from the Polish Ministry of Science and Higher Education, COST GEMINI FA0702-DWM/N190/COST/2008.

58 MULTI-THERMAL GRADIENT FREEZING ALLOWS THE CRYOPRESERVATION OF SHEEP WHOLE OVARIES WITH THE SAME EFFICIENCY OF OVARIAN FRAGMENTS

Ovarian tissue cryobanking is proposed as an effective option for preserving female fertility in cancer patients. At present 2 options are available: cryopreservation of ovarian cortical fragments or of the whole ovary. The use of whole ovary reduces ischemic insult. However, the larger the sample volume, the more difficult it is to introduce the cryoprotective agents and to ensure an adequate cooling rate that minimizes tissue damage. For this reason, we used the multi-thermal gradient method, based on running the sample through a temperature gradient. This allows a homogeneous cooling rate through the whole sample independently from its volume. The aim of the study was to determine whether multi-thermal gradient freezing allows a substantial reduction of the damages induced by cryopreservation of large samples by comparing the viability of cortical fragments versus whole ovaries after thawing and grafting in nude mice. Sheep ovaries were collected at the local abattoir and randomly divided into 3 groups: A) ovaries frozen as cortical fragments, B) ovaries frozen as whole organs, and C) fresh ovaries immediately processed for further analysis (control). Ovarian fragments (10 × 5 × 1 mm) were sliced from the cortical region and immersed into cryoprotectant solution (Leibovitz L-15 medium, 10% FCS, and 1.5 M dimethyl sulfoxide), while whole ovaries were perfused with the same solution. Samples were placed into glass freezing tubes 16 mm in diameter filled with cryoprotectant solution. Samples were frozen with the multi-thermal gradient freezing apparatus (Core Dynamics, Ness Ziona, Israel) progressing along the thermal gradient at a rate of 0.01 mm s–1, resulting in a cooling rate of 0.3°C min–1. Two weeks later, samples were thawed by plunging the tubes into a 37°C water bath with gentle shaking. Whole ovaries were perfused with 10 mL of HEPES-Talp medium, 0.5 M sucrose, and 10 IU mL–1 of heparin and their cortical region was cut into fragments. These fragments and those derived from group A were rehydrated in L-15 medium with decreasing sucrose concentrations. Fragments (2 × 2 × 1 mm) were xenografted in the dorsal region of 6 nude mice for each group. Mice were killed after 8 weeks and grafts were collected for analysis. Cryopreserved samples were compared with each other and fresh controls (group C). Morphologically normal follicles at primordial, primary, and secondary stages were visible in all samples. Cell proliferation was assessed measuring Ki-67 mRNA and counting immunohistochemically positive cells. The FSH receptor and GDF9 gene expression were used to evaluate tissue viability. No significant differences for any of these parameters were measured amongst the groups. We conclude that directional freezing is an effective method for ovarian tissue cryopreservation independently from the sample volume, thus overriding the limitations usually associated with whole-organ banking. Supported by AIRC IG 10376 and by Carraresi Foundation.

Clinical characteristics and genetic analysis in women with premature ovarian insufficiency

ObjectivePremature ovarian insufficiency (POI) is defined as a primary ovarian defect characterized by absent menarche (primary amenorrhea) or premature depletion of ovarian follicles before the age of 40 (secondary amenorrhea) with hypergonadotropism and hypoestrogenism. MethodsWe studied the clinical, biological, and genetic data related to 50 POI patients with a mean age of menopause of 29years (94% with secondary amenorrhea, 6% with primary amenorrhea and 15% with a family history of POI). Seventeen patients were affected by endocrine autoimmune diseases, antral follicles were observed in 31 patients by ultrasonography. ResultsKaryotype analysis did not show any abnormality of the X chromosome. No mutation in FSH receptor and GDF-9 genes was reported, while in one patient a variant of BMP-15 gene (A180T) was found. Four patients had fragile X mental retardation 1 gene (FMR1) premutation and one an intermediate sized CGG repeats of the same gene. Two patients with FMR1 premutation were sister and developed secondary amenorrhea at the age of 34 and 37years. The other two patients presented with oligoamenorrhea at the age of 39 and 34years. The patient harboured the intermediate sized CGG repeats developed secondary amenorrhea at the age of 33years. ConclusionsThe genetic analysis performed on a cohort of patients with POI revealed that 8% had FMR1 premutation and only one patient a previously known variant of BMP-15 gene. No alteration of the karyotype and FSH receptor and GDF-9 genes was evidenced.

A reporter promoter assay confirmed the role of a distal promoter NOBOX binding element in enhancing expression of GDF9 gene in buffalo oocytes

Growth differentiation factor 9 is primarily expressed in oocytes and plays a vital role in oocyte cumulus crosstalk. Earlier studies with buffalo oocytes revealed differential expression of this gene under different media stimulation conditions which, in turn, are correlated with the blastocyst yield. In this study, different germ cell specific cis elements including a NOBOX binding elements (NBE) and several E-boxes were identified at the 5′ upstream region of buffalo GDF9 gene and their potential role in GDF9 expression was investigated. Transfecting oocytes with GDF9 promoter deletion constructs harbouring the NBE reporter gene revealed a 33% increase in GFP as well as the luciferase signal signifying its role in stimulating the minimal promoter activity of GDF9 in buffalo oocytes. Site directed mutation of core binding nucleotides at NBE at 1.8kb upstream to TSS further confirmed its role for enhancing the basal transcriptional activity of GDF9 promoter in buffalo oocytes. Current work will provide important leads for understanding the role of GDF9 in oocytes competence and designing a more physiological IVF protocol in case of buffalo.

Feed restriction as a biostimulant of the production of oocyte, their quality and GDF-9 gene expression in rabbit oocytes

The use of short-term feed restriction (R) without or with subsequent refeeding (F) as biostimulant of rabbit fertility was examined in this study. A total of 40 mature, non-pregnant, non-lactating New Zealand white female rabbits were allocated to five treatments. The rabbits were individually caged and fed a complete pelleted diet (16.7% CP; 13.1 CF; 2490kcalDE/kg). Rabbits on the control (C) treatment received 150g/d of the diet. Two groups of 8 rabbits received 70% of the control daily feed intake (105g/d; moderate restriction; M) and the other two groups received 50% of the control feed intake (75g/d; severe restriction; S) for 21d. At the end of this period, one group each of M and S fed rabbits were slaughtered for oocyte recovery. Rabbits in the remaining three groups (C, MF and SF) were retained for a further 8d before slaughter and fed the control level of the diet during this period. The effects on body weight, oocyte number and quality, GDF-9 gene expression in oocytes, and changes in serum levels of leptin and IGF-1 were recorded. Initial mean body weights were not significantly different ranging from 2.50±0.33kg (S) to 2.58±0.24kg (C). After 3wk on treatment the C rabbits were significantly heavier (2.65±0.32kg; P<0.05) than rabbits on the M (2.26±0.33kg) or S (2.10±0.33kg) treatments. Following 8d of refeeding, the remaining group of S treated rabbits (SF) were still significantly lighter (2.40±0.21kg; P<0.05) than C (2.71±0.31kg) with MF rabbits having an intermediate weight (2.50±0.20kg). The number of mature grade A oocytes recovered per ovary was significantly lower for control (3.3±0.35) than the refed treatments (MF 4.0±0.30; SF 4.5±0.39; P<0.05). Semi-quantitative PCR analysis of GDF-9 expression showed that control mature grade A oocytes had significantly lower levels of expression (1.27±0.20; P<0.05) than those of refed rabbits (MF 1.60±0.10; SF 1.39±0.01). Leptin and IGF-1 values for refed rabbits were significantly higher (P<0.05) than at the end of feed restriction and the start point. It was concluded that this biostimulant method has the potential to improve the fertility of rabbits.

Relations Between GDF9, Zar1, Mater and DNMT1 Gene Relative mRNA Abundance and Oocytes Quality of Ovine Oocytes

Relations Between GDF9, Zar1, Mater and DNMT1 Gene Relative mRNA Abundance and Oocytes Quality of Ovine Oocytes

Polymorphism identification in goat GNRH1 and GDF9 genes and their association analysis with litter size

This study investigated the polymorphisms of GNRH1 and GDF9 genes in 641 goats of three breeds: Xinong Saanen, Guanzhong and Boer. Two allelic variants were identified in the GNRH1 gene (JN645280:g.3548A>G and JN645281:g.3699G>A) and one allelic variant was found in the GDF9 gene (JN655693:g.4093G>A). Furthermore, g.4093G>A was a missense mutation (p.Val397Ile of GDF9). Results of an association analysis indicated that SNPs g.3548A>G and g.4093G>A had significant effects on litter size (P<0.05). The combination genotypes of SNPs g.3548A>G, g.3699G>A and g.4093G>A also affected litter size with the C5 genotype having the highest litter size in the first, third, fourth and average parity. Hence, the biochemical and physiological functions, together with the results obtained in our investigation, suggest that the GNRH1 and GDF9 genes could serve as genetic markers for litter size in goat breeding.

Genetic Polymorphism in GDF9 and FecB Genes in Dalagh Sheep Breed of Iran

Genetic Polymorphism in GDF9 and FecB Genes in Dalagh Sheep Breed of Iran

Genetic contribution to radiographic severity in osteoarthritis of the knee

ObjectiveKnee osteoarthritis (OA) has a significant genetic component. The authors have assessed the role of three variants reported to influence risk of knee OA with p<5×10–8 in determining patellofemoral and...

Pola Hasil Amplifikasi Partial Gen BMP-15 dan GDF-9 pada Sapi Bali

The aim of this research was to determine the polymorphisms of BMP - 15 and GDF-9 gene of Bali cattle. DNA was isolated from blood samples of six female cattles with salting out method. Quantitative and qualitative analysis of DNA was measured using spectrophotometer and agarose gel electrophoresis. To get DNA fragment BMP-15 gene was amplified using Forward (5’- AGTTTGTACTGAGCCGGTCT -3'), Reverse (5’- CTGACACACGAA GCGGAGT -3’), while to get DNA fragmen GDF-9 gene was amplified using Forward primer (5’-CAAGGAGGGGACCCCTAAAT-3’), reverse primer (5’- ACCAGAGGCTCAAGAGGAGC- -3’) for GDF-9 . The results of amplification showed 4 haplotypes for BMP-15 and GDF-9 gene. It was concluded that there is polymorphism of BMP- 15 and GDF- 9 gene of Bali cattle.

The osteoarthritis susceptibility gene GDF5 is under epigenetic regulation by DNA methylation - the molecular interplay between genetics and epigenetics in disease risk

The osteoarthritis susceptibility gene GDF5 is under epigenetic regulation by DNA methylation - the molecular interplay between genetics and epigenetics in disease risk