Garlic Virus A Research Articles

Characterization of garlic virus A, garlic virus D, and onion yellow dwarf virus infecting onion

Background: Allium cepa is one of the major vegetable crops cultivated in Saudi Arabia. This economically important crop faces several biotic stresses which adversely affect the quality and quantity of its production. Several virus groups (potyviruses, carlaviruses, tospoviruses, and allexiviruses) have been reported infecting Allium crops.Methods: During the growing season of 2021-2022, a total of 81 onion samples exhibiting virus-like symptoms were collected from two different geographical regions in Saudi Arabia. The serological technique (ELISA) was used to detect the important allexiviruses and potyviruses. RT-PCR amplification of partial genome sequence was done using degenerate primers for allexiviruses and potyviruses and the phylogenetic trees were constructed using different bioinformatic tools.Results: The results obtained from ELISA tests showed that 26% and 32% of onion samples were positive with both Garlic Virus A (GarV-A) and Onion yellow dwarf virus (OYDV) respectively. RT-PCR amplification and sequencing results showed that two allexiviruses, GarV-A, garlic virus D (GarV-D), and one Potyvirus (OYDV) were detected in both regions. Sequence data were deposited in the GenBank database with accession numbers, OQ397545, OQ397546 for GarV-A, OQ397547 for GarV-D, and OQ397548, OQ397549 for OYDV, sequentially. Phylogenetic tree analysis of these virus isolates showed making clades with closely related isolates of their respective viruses. Pairwise nucleotide sequence identity showed their similarity with GarV-A, GarV-D, and OYDV isolates reported earlier in the GenBank.Conclusion: To the best of our knowledge, these two distinct allexiviruses (GarV-A, GarV-D) and one Potyvirus (OYDV) were isolated for the first time from an onion crop in Saudi Arabia.Keywords: Allexiviruses; Potyviruses; Serological Detection; Allium cepa; RT-PCR; Sequence

First Report of Garlic virus A, Garlic virus B, and Garlic virus C on Garlic (Allium sativum) in Tunisia.

Mite-borne viruses belonging to the genus Allexivirus (family Alphaflexiviridae) commonly occur on garlic in many parts of the world. There are usually asymptomatic and cause small damage to the plants, but often occur in mixed infection with potyviruses and carlaviruses, with synergistic effects reducing crop quality and leading to higher losses (Taglienti et al. 2017). Their occurrence on Tunisian garlic crops was studied here in the same garlic germplasm collection mentioned in a previous first report (Ayed et al. 2019). Leaf samples from a total of 66 garlic accessions were tested by DAS-ELISA using specific antibodies (DSMZ, Germany) against garlic virus A (GarV-A), garlic virus B (GarV-B) and garlic virus C (GarV-C). These serological tests showed individual virus incidence of respectively 56.4%, 67.7% and 10%. Our findings corroborate with the results of Chodorska et al (2012). In order to confirm the presence of these viruses, RT-PCR assays were performed using total RNAs extracted using two silica-capture extraction procedures according to Foissac et al (2005) and specific primers targeting the coat protein genes of the various viruses. These primers, designed for the present study are (GarV-A-F: 5' YCTYTTCTCHYTDGCHTGGACYTG 3' and GarV-A-R: 5' RCCYTTCCTAGACCARTTRGCRGG 3' for GarV-A; GarV-B-F: 5' TGGGCYTGYTACCACAAYGGATC 3' and GarV-B-R 5' TCTGCGCGVGTGGADACCATRTT 3' for GarV-B; GarV-C-F: 5' ARGAYCTYTTYTCMCTYGCRTGGGC 3' and GarV-C-R: 5' GGAGGYTCRTGAATYTGTTGTTG 3' for GarV-C). The viruses were detected by a two-step RT-PCR as described by Marais et al (2015). PCRs consisted of one cycle at 95 °C for 5 min; followed by 40 cycles of denaturation at 95 °C for 45 s, annealing at 45 °C for 45 s, and elongation at 72 °C for 45s; and a final extension step at 72 °C for 10 min. Products of the expected size (214 bp for GarV-A, 363 bp for GarV-B and 439 bp for GarV-C) were amplified from 58 (88%), 47 (71%) and 56 (85%) accessions, respectively. Forty three samples (65%) were co-infected by the three viruses. Higher numbers of positives revealed by RT-PCR especially in the case of GarV-C may reflect the higher sensitivity and efficiency of this technique compared to ELISA. Direct sequencing of selected amplicons of the expected size obtained for GarV-A, -B, and -C Tunisian isolates was performed and the sequences submitted to GenBank, validating the specificity of the three RT-PCR assays. The two sequenced GarV-A isolates (MK599147 and MN995836) shared 98% nucleotide (nt) sequence identity with each other, and 93-94% identity with the closest isolate in GenBank, the "G118" isolate from China (MN059320). The three sequenced GarV-B isolates (MN995829 to MN995831) shared 88-98% nt identity with each other. For "GarV-B 18.1" (MN995830) and "GarV-B 36.2" (MN995831) the closest isolate was "1109.1" (JX682828) from Spain (92-93% nt identity). For "GarVB 17.2" (MN995829), the closest isolate was "B-Sp-3" (LC97167) from Spain (90% nt identity). The sequenced GarV-C isolate (MN995834) showed the highest sequence nt identity (93%) with the "GarV-9" isolate (HQ724848) from Spain. To our knowledge this is the first report of the presence of GarV-A, -B and -C in Tunisia. The presence of these allexiviruses may pose a threat to the preservation of the Tunisian garlic germplasm and, more broadly, to garlic production in Tunisia. For this reason, the scrupulous identification of viruses occurring in garlic plants will help to use the appropriate strategy to decrease viral incidence in garlic growing area.

Allexivirus: review and perspectives

Allexivirus (Alphaflexiviridae) was first described in 1970 by Razvjazkina. Since then, Allexivirus species have been detected in many countries. Although this genus primarily infects plants in the Amaryllidaceae, other hosts include plants in the Fabaceae, Rosaceae and Orchidaceae. Thirteen Allexivirus species have been assigned. Eight of these infect Allium hosts, and these include: shallot virus X (ShVX), garlic virus A (GarV-A), garlic virus B (GarV-B), garlic virus C (GarV-C), garlic virus D (GarV-D), garlic virus E (GarV-E), garlic virus X (GarV-X), and garlic-mite filamentous virus (GarMbFV). Five have been described from non-Allium hosts, including blackberry virus E (BVE), vanilla latent virus (VLV), alfalfa virus S (AVS), Arachis pintoi virus (ApV), and Senna severe yellow mosaic virus (SSYMV). This review analyzes the taxonomic positions of the thirteen recognized species and four unassigned species (Allexivirus DS-2013/CZE isolate, shallot mite-borne latent virus (SMbLV), cassia mild mosaic virus (CaMMV), and papaya virus A (PaVA)). Based on the inspection of data, we have concluded that PaVA is an Allexivirus, DS-2013/CZE is an isolate of GarV-D, and SMbLV is an isolate of ShVX. Current knowledge of the host ranges, symptoms, genome structure and modes of transmission of these viruses is also summarized, and control measures employed against them are outlined.

Identification of Garlic virus A infecting Allium sativum L. through next generation sequencing technology

ABSTRACT Garlic virus A (GarV-A) severely damages and reduces the yield of economically important garlic crop worldwide. Here, we present the first comprehensive view of GarV-A infecting Yamuna Safed-3 (G282) of garlic (Allium sativumL.) variety from India at the complete genome sequence level. RNA-seq was performed on an Illumina HiSeq 2000 platform to obtain the full length GarV-A genome and analysed by different software and reverse transcription-polymerase chain reaction (RT-PCR) confirmed the presence of the GarV-A. The virus complete genome consists of 8,793 nucleotides (nt), excluding the poly (A) tail at the 3ʹ terminus, with 5ʹ and 3ʹ untranslated regions (UTRs) of 193 and 123 nt, respectively. Genome analysis of GarV-A Indian isolate shared higher nucleic acid and amino acid sequence identity to Chinese isolates than to Australian and Spanish isolates. Further RDP analysis showed that the Indian GarV-A (MT731489) isolate was found to be recombinant with most part of the RNA segment is derived from China GarV-E isolate (MN059326) as the minor parent and the Russia ShV-X (JX310755) isolate as the major parent. More research is needed to determine the outspread of this particular recombinant virus. This is the first report of the complete genome sequence and evidence of homologous recombination in of GarV-A from India.

Newly identified host range of viruses infecting species of the genus Allium and their distribution in six habitats in the Czech Republic

AbstractStudies on plant viruses are concentrated mainly towards crop diseases and little is known about viruses in wild and ornamental species. We surveyed viruses infecting 65 vegetable, wild, and ornamental Allium species cultivated or naturally occurring in the Czech Republic. Allium plants were collected from six habitat categories (botanical gardens, private gardens, cultivated fields, ornamentals from markets, cultivated plants of wild origin, wild origin). Samples were tested by ELISA and/or reverse transcription‐PCR for the presence of 15 viruses belonging to the genera Allexivirus, Carlavirus, Potyvirus, and Orthotospovirus. Of the 883 sampled plants, 63.4% were infected by at least one or more viruses. The infection rate of Allium samples differed depending on the habitat origin and phylogenetic relatedness of the hosts. Viruses were most frequently detected in cultivated species, with a high incidence of leek yellow stripe virus (LYSV), garlic common latent virus (GCLV), shallot virus X (ShVX), garlic virus A (GarV‐A), and garlic virus B (GarV‐B). Low infection rates and virus‐free samples were detected in species of wild origin. Composition of viruses belonging to the genus Allexivirus significantly differentiated the subgenus Melanocrommyum from other Allium subgenera. Mixed infections (51.1% of analysed plants) were widespread in most species. New host associations were observed for some viruses previously recorded in the Czech Republic. In addition, three viruses, shallot yellow stripe virus (SYSV), Impatiens necrotic spot virus (INSV), and iris yellow spot virus (IYSV), were detected for the first time on Allium species in the Czech Republic.

First Report of Garlic virus B infecting Garlic in India.

Garlic (Allium sativum L.) is an economically important spice and vegetable crop grown throughout the world. Garlic viral disease complex caused by multiple virus infections is an important constraint in exploiting the potential yield of garlic. Among these viral pathogens, allexivirus (family Alphaflexiviridae) is the genus of viruses known for their degenerative effect on garlic yield. Their coexistence with other viruses, particularly potyviruses, has an adverse effect on garlic yield and quality (Perotto et al. 2010). During Sept 2018, while screening garlic germplasm accessions for the presence of allexiviruses, symptoms like foliar mosaic and curling were observed on accession G-204, planted at an experimental plot of ICAR-DOGR, Pune, India. A total of five samples comprised of five randomly selected G-204 garlic plants were collected from the experimental plot. Each sample contained leaves from the top, middle, and bottom portion of the individual garlic plants. These samples were subjected to RNA extraction using the RNeasy Plant Mini Kit (Qiagen, Germany) followed by reverse transcription (RT) using the Transcriptor cDNA synthesis kit (Roche Diagnostics, GmbH, Germany). The extracted RNA was then tested for allexiviruses such as garlic virus A (GarV-A), garlic virus B (GarV-B), garlic virus C (GarV-C), garlic virus D (GarV-D), and garlic virus X (GarV-X) by polymerase chain reaction (PCR) (Gawande et al. 2015; Roylawar et al. 2019; Baranwal et al. 2011; Gieck et al. 2009). Leaf samples tested through RT-PCR were found positive for garlic viruses GarV-A, GarV-B, GarV-C, GarV-D, and GarV-X. Allexiviruses other than GarV-B had been previously reported in India and hence further tests were conducted to confirm GarV-B infection. RT-PCR using primers, CF 5'- ATGGGAGACAGGTCGCAA-3' and CR5'- CTAAAATGTAAGCATGAGCGGT-3' designed specific to the coat protein yielded a 735-bp amplicon from all five G-204 plants. The amplified product was purified using QIAquick PCR Purification Kit (Qiagen, Germany) and cloned in pJET1.2 vector (Thermo Scientific, Lithuania). Two clones containing the CP gene were bidirectionally sequenced, and a consensus sequence was submitted to GenBank (MN650206). BLASTn results indicated that this consensus sequence showed 97.96% nucleotide (KP657919.1) and 100% amino acid sequence (AKN19940.1) identity with the CP sequence of GarV-B isolate from Poland. The presence of GarV-B was confirmed by enzyme-linked immunosorbent assay (ELISA) using a double-antibody sandwich ELISA kit (Arsh Biotech, Delhi, India) as per the manufacturer's protocol. An absorbance of reaction was read using a microplate reader at 405 nm. The mean OD values of negative and positive controls were 0.034 and 0.373, respectively. The OD values of five samples tested ranged from 0.210 to 0.296 indicating a positive reaction for GarV-B. To assess the presence of GarV-B in the available genetic stock, we tested 30 garlic germplasm accessions for GarV-B using RT-PCR. Out of these, 17 accessions were found positive for GarV-B. GarV-B has been reported from many countries (Gieck et al. 2009). This is the first report of GarV-B from India. Globally, allexiviruses are known for their adverse impact on garlic production (Oliveira et al. 2014). GarV-B together with other viruses can be a potential threat to garlic production in India. Further, detailed evaluations are needed to study the impact of GarV-B on garlic production in India.

POPULATION GENETICS ANALYSIS OF Garlic virus A, Garlic virus B, Garlic virus C AND Garlic virus X

Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C) and Garlic virus X (GarV-X) are members of the genus Allexivirus in the family Alphaflexiviridae. In this study, we collected 10, 30, 10 and 14 isolates of GarV-A, GarV-B, GarV-C and GarV-X, respectively, from different parts of Poland. All sequences of coat protein (CP) and nucleic-acid binding protein (NABP) regions of Allexivirus isolates available in GenBank were also included in this study. The nucleotide and amino acid sequences identities within each population differed substantially depending on the region of the genome and virus species. The results of selection pressure analysis showed that populations of each Allexivirus underwent negative selection, but the extent of the negative selection varied. It was also concluded that the GarV-A and GarV-C populations underwent a decrease in population size or balancing selection, while the GarV-B and GarV-X populations underwent an increase in population size. It was concluded that both populations of GarV-X evolved independently in each respective area, in contrast to populations of GarV-A, GarV-B and GarV-C.

Identification and sequence analysis of five allexiviruses species infecting garlic crops in Brazil

Garlic plants are naturally infected by a mixture of viruses, including allexiviruses. Symptomatic garlic plants with mosaic and distorted leaves from garlic producing regions in Brazil were analyzed for the presence of Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D) and Garlic mite-borne filamentous virus (GarMbFV), five allexivirus species previously reported in the country. Fifty-nine virus isolates from five distinct allexivirus species were identified and the complete coat protein region of each genome was sequenced. Mixed infections were very frequent and corresponded to 43% of the positive samples. The nucleotide identity of the coat protein ranged between 75% and 98% for GarV-A isolates, 83% and 90% for GarV-B, 69% and 98% for GarV-C, 87% and 97% for GarV-D, and 72% and 91% for GarMbFV.

First Report of Garlic virus X in Garlic Plants in Brazil.

Garlic is the fifth most economically important vegetable in Brazil and is frequently infected by a complex of different viruses that cause significant degeneration of the crop under field conditions. The species of the genus Allexivirus that infect garlic are: Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X), Garlic mite-borne filamentous viru s (GarMbFV), and Shallot virus X (ShVX). So far, only GarV-A, GarV-B, GarV-C, GarV-D, and GarMbFV have been reported in Brazil (3). During the 2010 through 2013 seasons, between April and October, 302 garlic plants with yellow mosaic strips and distorted leaves from the cultivars Caçador, Quitéria, Tropical Bergamota, and Tropical Shangai were collected in the states of Paraná, Minas Gerais, São Paulo, and Goiás and analyzed for the presence of allexiviruses. Total plant RNA was extracted with the Total RNA Purification kit (Norgen Biotek Corp., Canada) according to manufacturer's instructions. RT-PCR reactions were performed initially with the primer pair named Cpallexi-senso2 (5' CTACCACAAYGGNTCVTC 3') and Cpallexi-anti1 (5' CACNGCGTTRAAGAARTC 3') specifically designed to amplify a ~230-bp fragment from all currently known allexiviruses. Positive samples were then analyzed with specific primers for GarV-A, GarV-C, and GarV-D (2), GarMbFV (1) and GarV-B named CPBS2 (5' GCAGAATAARCCCCCYTC 3') and CPBA1 (5' RAAGGGTTTATTCTGTTG 3') obtained in this work. Among the plants analyzed, 50 were positive for the Cpallexi-senso2/Cpallexi-anti1 primers but negative for all the specific primers tested, indicating the presence of a different allexivirus. These samples were then analyzed by RT-PCR for the presence of GarV-X, GarV-E, and ShVX and an amplicon of ~550 bp was obtained only with primers CPXS2 (5' GCCTTCTGAAAATGACTTAG 3') and CPXA1 (5' CTAGGATTTGCTGTTGGG 3') designed in this work to amplify a fragment of the capsid protein gene for GarV-X. Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (2), another set of primers, namely PIXS1 (GACGACGGYGCACTACTC) / PIXA1 (YGTGAATCGTGATGATCC) and PFXS2 (CRCTGAGACAATTYYGTGG) / PFXA2 (CAAAGCATCGGCCRTAGCG) derived from conserved regions of ORF4, ORF5 (CP), and ORF 6 sequences of allexiviruses available in the NCBI database, were used in RT-PCR to obtain the complete CP gene nucleotide sequence. A 1,071-nt sequence comprising 108 bp of ORF4 (partial), 732 bp of the CP, and 177 bp of ORF 6 was successfully amplified (GenBank Accession No. KF530328). The complete CP gene showed 98% nucleotide sequence identity with GarV-X from Australia (JQ807994.1). In summary, GarV-X was detected in the 50 samples collected from Minas Gerais, São Paulo, and Paraná, indicating widespread distribution in Brazil. To our knowledge, this is the first report of GarV-X in garlic in Brazil.

Występowanie wirusów z rodzaju Allexivirus na roślinach czosnku w Polsce

Garlic (Allium sativum L.) can be infected by numerous viruses that are spread by the seed bulbs during the vegetative propagation of the plants. Eight garlic viruses that belong to the Allexivirus genus are transmitted by mites. The aim of this study was to detect and identify Allexiviruses infecting garlic in Poland. Identification of Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C) and Shallot virus X (ShVX) was based on ELISA (Enzyme-Linked Immunosorbent Assay) and confirmed by RT-PCR (Reverse Transcription Polymerase Chain Reaction). Garlic virus D (GarV-D), Garlic virus E (GarV-E) and Garlic virus X (GarV-X) were detected using RT-PCR. The samples of garlic plants were collected in September 2011 and July 2012 from garlic production field located in different part of Poland. Garlic virus D, Garlic virus X and Garlic virus B were the most abundant garlic viruses in all examined regions and were identified in 84, 67 and 54% of all samples, respectively. Garlic virus A and Garlic virus C were detected in all studied regions with low frequency. None of the tested garlic samples were infected with Shallot virus X. Allexiviruses that were present in garlic plants occurred always in mixed infections. Rośliny czosnku mogą być porażane przez wiele gatunków wirusów. Wirusy infekujące czosnek rozprzestrzeniają się wraz z materiałem rozmnożeniowym. Ponadto osiem gatunków należących do rodzaju Allexivirus jest przenoszonych przez szpeciele. Celem przeprowadzonych badań było wykrywanie i identyfikacja allexiwirusów infekujących rośliny czosnku w Polsce. Obecność wirusa A czosnku, wirusa B czosnku, wirusa C czosnku i wirusa X szalotki stwierdzano przy pomocy testu serologicznego ELISA (Enzyme-Linked Immunosorbent Assay) i potwierdzano techniką RT-PCR (Reverse Transcription Polymerase Chain Reaction). Wirus D czosnku, wirus E czosnku i wirus X czosnku były wykrywane przy użyciu techniki RT-PCR. Próbki materiału roślinnego pobierano w dwóch terminach, we wrześniu 2011 roku oraz w lipcu 2012 roku, z pól produkcyjnych, zlokalizowanych w różnych rejonach Polski. Najczęściej występującymi wirusami w polskich uprawach czosnku był wirus D czosnku, wirus X czosnku i wirus B czosnku (84, 67 i 54%). Wirus A czosnku i wirus C czosnku były wykrywane we wszystkich badanych regionach, jednak ze znacznie niższą częstotliwością występowania. Żadna z badanych prób nie była porażona przez wirus X szalotki. Allexiwirusy w roślinach czosnku występowały zawsze w mieszanych infekcjach.

Occurrence and Phylogenetic Analysis of Potyviruses, Carlaviruses and Allexiviruses in Garlic in Sudan

AbstractAllium sativum L. samples of three cultivars grown in Sudan were shown to contain several of the common garlic viruses of the genera Potyvirus, Carlavirus and Allexivirus. In particular, Onion yellow dwarf virus (OYDV), Leek yellow stripe virus (LYSV), Garlic common latent virus (GarCLV), Garlic virus A (GVA), Garlic virus B (GVB), Garlic virus C (GVC) and Garlic virus X (GVX) were detected by reverse transcription polymerase chain reaction (RT‐PCR) assay using degenerate genus‐specific and virus‐specific primer sets. Multiple viral infections with members of all three genera were found in all but one sample. Further, molecular and phylogenetic analysis of nucleotide and deduced amino acid sequences revealed that Sudanese isolates of LYSV, GarCLV and of Allexivirus genus were significantly divergent in partial coat protein genomic region from isolates of the same species retrieved from GenBank. This is the first report and study on viruses infecting garlic in Sudan.

First Report of Garlic virus X Infecting Garlic in India.

Garlic (Allium sativum) is an important crop in several states of India. Filamentous viruses such as Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), and Garlic common latent virus (GarCLV) have been reported previously in different garlic cultivars from India (4). These viruses are transmitted from generation to generation through cloves and cause severe reduction in yield and quality. During December 2010, garlic plants were observed with mosaic leaf symptoms and stunting in an experimental field at the Indian Agricultural Research Institute, Delhi. Cloves and leaves from 3-month-old symptomatic plants of five different cultivars (G-282, IC-375416, Ruag, Yamuna Safed, and ACC-40), originally from different regions of India, were collected from the field in Delhi and total RNA was extracted using an RNeasy Plant Mini Kit (Qiagen, Valencia, CA). The presence of OYDV and GarCLV was confirmed by reverse transcription (RT)-PCR in all cultivars, while the presence of SLV was only confirmed in cv. G-282 by RT-PCR. Since Allexiviruses are common in garlic, their detection in cloves was confirmed by RT-PCR using primers ALLEX 1 and ALLEX 2 (2). An ~200-bp amplification product was observed in all five cultivars. To further characterize the Allexivirus in these cultivars, an amplicon of ~900 bp was amplified with Allex-CP (1) and ALLEX 2 (2) primers and cloned and sequenced. BLAST analysis of the nucleotide sequences from five garlic cultivars showed identity with different allexiviruses, Garlic virus A (GarV-A) (74 to 83%), Garlic virus E (GarV-E) (74 to 80%), Garlic virus D (GarV-D) (76 to 79%), and Garlic virus X (GarV-X) (75 to 78%). Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (3), another set of primers, 5'-MYT KGA GTG GCT VAC ACA YAT-3' and 5'-ATT RAA GTC GTG RGG ATG CAT-3' was designed. These primers were derived from conserved regions of ORF4 and ORF5 (CP) sequences of allexiviruses available in the NCBI database and used in RT-PCR to obtain the complete CP. An ~1.5-kb amplicon was obtained only in cv. G-282 that originated from the southern part of India. A similar amplicon was obtained from Chenopodium amaranticolor mechanically inoculated with leaf sap from cv. G-282. Sequences (1,422 bp) obtained from three clones each from garlic cv. G-282 and C. amaranticolor were identical and BLAST analysis of the consensus nucleotide sequence showed maximum identity of 75 to 81% with isolates of GarV-X. The 1,422 nucleotide sequence was comprised of 690 bp of ORF4 (partial) and 732 bp of the CP. The coat protein sequence (GenBank Accession No. HQ822272) shared a 79.6 to 81.1% identity in nucleotide and 89.3 to 90.9% in amino acid sequence with different isolates of GarV-X (GenBank Accession Nos. AJ292229, U89243, and GQ475426). To our knowledge, this is the first report of GarV-X in a garlic cultivar from India. The characterization and identification of allexiviruses is important for production of virus-free garlic plants through tissue culture in India.

Partial genome sequence of a Potyvirus and of a virus in the order Tymovirales found in Senna macranthera in Brazil

Senna macranthera is a common tropical tree native to South- and Northeastern Brazil. In July 2006, symptoms of chlorotic spots in the young leaves and mild mosaic in the old leaves were observed in S. macranthera trees at Vicosa, State of Minas Gerais, Brazil. Electron microscopy examination of leaf dip preparations from the young leaves revealed the presence of flexuous rods. Viral RNA was extracted from purified virion preparations and used as a template for the RT-PCR-based cloning of viral genomic fragments. Two fragments (0.9 kb and 2.0 kb in length) were cloned. Sequence analysis of the 0.9 kb fragment indicated that it corresponded to the NIb coding region of a potyvirus, with nucleotide (nt) identity level of 72% for Pepper mottle virus (PepMoV) and Peru tomato mosaic virus (PTV), while analysis of the 2.0 kb fragment indicated that it corresponded to the putative replicase ORF, which displayed 74% nt identity with the ORF1 (replicase) of Garlic virus A (GarV-A). Based on molecular analysis and the isolates' host range, it is concluded that the viral fragments represent new viruses, for which we propose the names Senna virus Y (genus Potyvirus, family Potyviridae) and Senna virus X (unassigned genus, order Tymovirales).

The effect of additional viral infections on garlic plants initially infected with Allexiviruses

Yield losses caused by a second viral infection of garlic plants previously infected with either of the isolated Allexiviruses, Garlic virus-A (GarV-A) or Garlic virus-C (GarV-C), were evaluated in a field assay carried out over four consecutive growing seasons. The treatment groups included virus-free plants (VF), plants infected only with GarV-A isolates (A), plants infected only with GarV-C isolates (C), and plants infected with a mixture of viruses that naturally infect garlic, referred to as viral-complex plants (VC). From the first crop cycle the different treatments were infected by other viruses that naturally infect garlic. At the end of the first growth cycle, significant differences in yield were observed among the four treatments. The bulb weight for VF, C, and A treatments was respectively 137%, 116%, and 96% higher than the bulb weight for the VC treatment. After the fourth growth cycle, however, non-significant differences in garlic yield between the VC, C, and A treatments were observed, whereas the yield for the VF treatment was higher than the VC treatment by 22%. Garlic yield decreased more rapidly in plants infected previously with at least one Allexivirus and then infected with other naturally occurring viruses than the plants that were virus-free at the beginning (VF plants).

Changes in the Concentration of an Allexivirus During the Crop Cycle of Two Garlic Cultivars.

Garlic can be infected by a number of viruses, including allexiviruses. The coat protein sequence of an Allexivirus was detected in Argentina and deposited in the EMBL database as Garlic mite-borne filamentous virus (accession number X98991); it has high homology with Garlic virus A (GarV-A). For reliable virus detection, plants should be sampled when virus titer is high to reduce the risk of identifying infected plants as healthy. The objective of this study was to describe fluctuations in the concentration of this Argentine isolate of GarV-A in two garlic cultivars, Morado-INTA and Nieve-INTA, throughout the crop cycle using the double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Over a 2-year period, for both cultivars, virus concentration was assessed in samples from the tips section of the youngest leaves of GarV-A-infected plants, and from basal sections of both dormant and devernalized cloves of stored bulbs of Morado-INTA. The concentration of GarV-A varied during the crop cycle, but peaked at the beginning and again at the end of the crop cycle. Virus concentration was slightly higher in devernalized cloves compared with dormant cloves of Morado-INTA. No correlation between virus concentration and mean air temperature was observed. The results of this study recommend sampling times at the beginning of the crop cycle at 64 to 81 days after planting, and towards the end of the crop cycle to evaluate for the presence of GarV-A by DAS-ELISA.

Effect of Two Allexivirus Isolates on Garlic Yield.

Garlic (Allium sativum) is infected by numerous viruses forming a viral-complex, which is widely distributed in the garlic production regions of Argentina. This work is the first report of the effect of two Allexivirus isolates, Garlic virus A (GarV-A) and Garlic virus C (GarV-C), on garlic yield. Garlic cvs. Morado-INTA and Blanco-IFFIVE were used in the experiments, and four treatments were evaluated: plants inoculated with GarV-A only, GarV-C only, virus-free plants (negative control), and plants infected with the virus-complex. Assays were performed in anti-aphid cages and in the field during 2002 and 2003. GarV-A caused significant reductions in bulb weight (14 to 32%) and diameter (6 to 11%) compared with the negative control in the two cultivars under both assay conditions. GarV-C caused less damage than GarV-A (15% in weight and 5% in diameter) with respect to the negative control in cv. Blanco-IFFIVE, and did not produce significant yield losses in cv. Morado-INTA in either year or under either assay condition.

Genome characterization of a flexuous rod-shaped mycovirus, Botrytis virus X, reveals high amino acid identity to genes from plant ‘potex-like’ viruses

This study reports the molecular characterization of a flexuous rod-shaped mycovirus, Botrytis virus X (BVX), infecting the plant-pathogenic fungus, Botrytis cinerea. BVX contains a ssRNA genome of 6966 nucleotides, and a poly(A) tract at or very near the 3' terminus. Computer analysis of the genomic cDNA sequence of BVX revealed five potential open reading frames (ORFs). ORF1 showed significant amino acid sequence identity to the replicase proteins of plant 'potex-like' viruses, including 73% identity to the RNA-dependent RNA polymerase (RdRp) region of the allexivirus, garlic virus A (GarV-A). The C-terminal region of ORF3 shared amino acid homology with plant 'potex-like' coat proteins. The remaining ORFs did not reveal significant homology with known protein sequences. BVX differs substantially from Botrytis virus F (BVF), another flexuous rod-shaped mycovirus characterized from the same B. Cinerea isolate. It is proposed that the mycovirus BVX belongs to a new, as yet unassigned genus in the plant 'potex-like' virus group, distinct from BVF.

Detection of three Allexivirus species infecting garlic in Brazil

Garlic viruses often occur in mixed infections under field conditions. In this study, garlic samples collected in three geographical areas of Brazil were tested by Dot-ELISA for the detection of allexiviruses using monoclonal specific antibodies to detect Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C) and a polyclonal antiserum able to detect the three virus species mentioned plus Garlic virus D (GarV-D). The detected viruses were biologically isolated by successive passages through Chenopodium quinoa. Reverse Transcriptase Polimerase Chain Reaction (RT-PCR) was performed using primers designed from specific regions of the coat protein genes of Japanese allexiviruses available in the Genetic Bank of National Center of Biotechnology Information (NCBI). By these procedures, individual garlic virus genomes were isolated and sequenced. The nucleotide and amino acid sequence analysis and the one with serological data revealed the presence of three distinct allexiviruses GarV-C, GarV-D and a recently described allexivirus, named Garlic mite-borne filamentous virus (GarMbFV), in Brazil.

DISTRIBUTION OF GARLIC VIRUS A IN DIFFERENT GARLIC PRODUCTION REGIONS OF ARGENTINA

Comparative tests using inmunosorbent electron microscopy plus decoration and ELISA with antibodies against Garlic virus A (GarV-A) and Garlic virus C (GarV-C) coat proteins showed that they specifically recognize the respective viruses. On this basis, the GarV-A antiserum was used in DAS-ELISA tests to study the distribution of GarV-A in different regions of Argentina. A total of 2655 samples, representing 115 garlic fields were analyzed. GarV-A was detected in 64%, 51%, 43% and 35% of samples collected in San Juan, Mendoza, Cordoba and Buenos Aires Provinces, respectively. Positive samples were not found in plants from Santa Cruz Province. Distribution among different garlic cultivars showed that this virus was present in 33%, 46%, 53%, 70% and 43% of plants belonging to cvs ‘Colorado’, ‘Chino’, ‘Violeta Frances’, ‘Blanco’ and ‘Rosado Paraguayo’, respectively. Negative results were obtained in samples of cvs ‘Castano-INTA’ and ‘Violeta Santacruceno’.

Immunological Detection of a GarV-Type Virus in Argentine Garlic Cultivars.

A cDNA library representing the genomes of several garlic viruses was generated using a viral RNA mixture as template. Analysis of randomly selected clones allowed the identification of different viral genomic sequences. On the basis of amino acid and nucleotide sequence comparisons, one of them was assigned to garlic virus A (GarV-A), a novel flexuous, rod-shaped virus recently reported in Japan. The coat protein (CP) of this virus was expressed in Escherichia coli cells and used as immunogen to produce polyclonal antibodies. The expression protein was recognized by an antiserum detecting garlic mite-borne filamentous virus, but did not react with antibodies specific for other garlic viruses. Antibodies raised against the viral CP reacted with extracts infected with garlic mite-borne viruses and fail to recognize preparations of onion yellow dwarf potyvirus, leek yellow stripe potyvirus, and carnation latent carlavirus. The same antibodies decorated viral particles exhibiting a modal length of 586 nm in immuno electron microscopy with decoration assays. Double-antibody enzyme-linked immunosorbent assays and tissue printing assays performed with these antibodies allowed detection of GarV-A in most garlic cultivars used in Argentina.