G5p Binding Research Articles

Interaction of a Dimeric Single-Stranded DNA-Binding Protein (G5P) with DNA Hairpins. A Molecular Beacon Study.

Gene-V protein (G5P/GVP) is a single-stranded (ss)DNA-binding protein (SBP) of bacteriophage f1 that is required for DNA synthesis and repair. In solution, it exists as a dimer that binds two antiparallel ssDNA strands with high affinity in a cooperative manner, forming a left-handed helical protein-DNA filament. Here, we report on fluorescence studies of the interaction of G5P with different DNA oligonucleotides having a hairpin structure (molecular beacon, MB) with a seven base-pair stem (dT24-stem7, dT18-stem7), as well as with DNA oligonucleotides (dT38, dT24) without a defined secondary structure. All oligonucleotides were end-labeled with a Cy3-fluorophore and a BHQ2-quencher. In the case of DNA oligonucleotides without a secondary structure, an almost complete quenching of their strong fluorescence (with about 5% residual intensity) was observed upon the binding of G5P. This implies an exact alignment of the ends of the DNA strand(s) in the saturated complex. The interaction of the DNA hairpins with G5P led to the unzipping of the base-paired stem, as revealed by fluorescence measurements, fluorescence microfluidic mixing experiments, and electrophoretic mobility shift assay data. Importantly, the disruption of ssDNA's secondary structure agrees with the behavior of other single-stranded DNA-binding proteins (SBPs). In addition, substantial protein-induced fluorescence enhancement (PIFE) of the Cy3-fluorescence was observed.

Nucleotides sequestered at different subsite loci within DNA-binding pockets of two OB-fold single-stranded DNA-binding proteins are unstacked to different extents

The gene 5 protein (g5p) encoded by the Ff strains of Escherichia coli bacteriophages is a dimeric single-stranded DNA-binding protein (SSB) that consists of two identical OB-fold (oligonucleotide/oligosaccharide-binding) motifs. Ultrafast time-resolved fluorescence measurements were carried out to investigate the effect of g5p binding on the conformation of 2-aminopurine (2AP) labels positioned between adenines or cytosines in the 16-nucleotide antiparallel tails of DNA hairpins. The measurements revealed significant changes in the conformational heterogeneity of the 2AP labels caused by g5p binding. The extent of the changes was dependent on sub-binding-site location, but generally resulted in base unstacking. When bound by g5p, the unstacked 2AP population increased from ∼ 22% to 59-67% in C-2AP-C segments and from 39% to 77% in an A-2AP-A segment. The OB-fold RPA70A domain of the human replication protein A also caused a significant amount of base unstacking at various locations within the DNA binding site as evidenced by steady-state fluorescence titration measurements using 2AP-labeled 5-mer DNAs. These solution studies support the concept that base unstacking at most of a protein's multiple sub-binding-site loci may be a feature that allows non-sequence specific OB-fold proteins to bind to single-stranded DNAs (ssDNAs) with minimal preference for particular sequences.

Ultrafast Fluorescence Decay Profiles Reveal Differential Unstacking of 2-Aminopurine from Neighboring Bases in Single-Stranded DNA-Binding Protein Subsites

Gene 5 protein (g5p) is a dimeric single-stranded DNA-binding protein encoded by Ff strains of Escherichia coli bacteriophages. The 2-fold rotationally symmetric binding sites of a g5p dimer each bind to four nucleotides, and the dimers bind with high cooperativity to saturate antiparallel single-stranded DNA (ssDNA) strands. Ultrafast time-resolved fluorescence spectroscopies were used to investigate the conformational heterogeneity and dynamics of fluorescent 2-aminopurine (2AP) labels sequestered by bound g5p. The 2AP labels were positioned within the noncomplementary antiparallel tail sequences of d(AC)(8) or d(AC)(9) of hairpin constructs so that each fluorescent label could probe a different subsite location within the DNA-binding site of g5p. Circular dichroism and isothermal calorimetric titrations yielded binding stoichiometries of approximately six dimers per oligomer hairpin when tails were of these lengths. Mobility shift assays demonstrated the formation of a single type of g5p-saturated complex. Femtosecond time-resolved fluorescence spectroscopy showed that the 2AP in the free (non-protein-bound) DNAs had similar heterogeneous distributions of conformations. However, there were significant changes, dominated by a large increase in the population of unstacked bases from ~22 to 59-68%, depending on their subsite locations, when the oligomers were saturated with g5p. Anisotropy data indicated that 2AP in the bound state was less flexible than in the free oligomer. A control oligomer was labeled with 2AP in the loop of the hairpin and showed no significant change in its base stacking upon g5p binding. A proposed model summarizes the data.

Binding and reversible denaturation of double-stranded DNA by Ff gene 5 protein.

The gene 5 protein (g5p) from Ff filamentous virus is a model single-stranded DNA (ssDNA) binding protein that has an oligonucleotide/oligosaccharide binding (OB)-fold structure and binding properties in common with other ssDNA-binding proteins. In the present work, we use circular dichroism (CD) spectroscopy to analyze the effects of amino acid substitutions on the binding of g5p to double-stranded DNA (dsDNA) compared to its binding to ssDNA. CD titrations of poly[d(A). d(T)] with mutants of each of the five tyrosines of the g5p showed that the 229-nm CD band of Tyr34, a tyrosine at the interface of adjacent protein dimers, is reversed in sign upon binding to the dsDNA, poly[d(A). d(T)]. This effect is like that previously found for g5p binding to ssDNAs, suggesting there are similarities in the protein-protein interactions when g5p binds to dsDNA and ssDNA. However, there are differences, and the possible perturbation of a second tyrosine, Tyr41, in the complex with dsDNA. Three mutant proteins (Y26F, Y34F, and Y41H) reduced the melting temperature of poly[d(A). d(T)] by 67 degrees C, but the wild-type g5p only reduced it by 2 degrees C. This enhanced ability of the mutants to denature dsDNA suggests that their binding affinities to dsDNA are reduced more than are their binding affinities to ssDNA. Finally, we present evidence that when poly[d(A). d(T)] is melted in the presence of the wild-type, Y26F, or Y34F proteins, the poly[d(A)] and poly[d(T)] strands are separately sequestered such that renaturation of the duplex is facilitated in 2 mM Na(+).

Real-time Kinetics of the Interaction between the Two Subunits, Escherichia coli Thioredoxin and Gene 5 Protein of Phage T7 DNA Polymerase

T7 phage DNA polymerase is a tight 1:1 complex of the gene 5 protein (g5p) (80 kDa) of phage T7 and thioredoxin (12 kDa) from the Escherichia coli host. The holoenzyme is essential for the replication of the phage. We estimated the real-time kinetics and thermodynamics of the interaction of g5p with thioredoxin (wild type and mutants) using surface plasmon resonance. Thioredoxin was immobilized on a CM5 sensor chip through a six-carbon spacer (6-amino-n-hexanoic acid) using standard amine coupling. Reduced thioredoxin bound g5p but oxidized thioredoxin did not. The association and dissociation phases of the complex fit a two-exponential model with an apparent equilibrium dissociation constant (KD) of 2.2 nm for thioredoxin with 4.7 x 104.M-1.s-1 and 10.5 x 10-5.s-1 as the corresponding association (ka) and dissociation (kd) rate constants. The strong binding of g5p to thioredoxin is therefore due to fast association and very slow dissociation, a situation similar to antigen-antibody interactions. Thioredoxin mutants P34S, D26A, K57M, D26A/K57M, W31F, W31Y, K36A, K36E, and Y49F had KD values in the range of 1 to 8 nm, whereas mutant W28A had a KD of 12.5 nm. No detectable interaction was observed for mutants P40G, W31H, W31A, and C35A. The effect of temperature on KD and the changes in enthalpy (-DeltaH = 20.2 kcal.m-1) and entropy (TDeltaS =-8.4 kcal.m-1) upon formation of the complex suggested that the interaction is driven by an increase in enthalpy and opposed by a decrease in entropy.

The Ff gene 5 single-stranded DNA-binding protein binds to the transiently folded form of an intramolecular G-quadruplex.

The Ff gene 5 protein (g5p) is classified as a single-stranded DNA-binding protein. However, we previously showed that g5p binds with high affinity to a SELEX-selected G-rich 58-mer DNA oligomer, I-3, that forms an intramolecular G-quadruplex [Wen, J.-D., Gray, C. W., and Gray, D. M. (2001) Biochemistry 40, 9300-9310]. In 200 mM NaCl at 37 degrees C, g5p binds to I-3 in two stages, the first stage being the formation of a discrete intermediate complex that appears to be a precursor to a saturated g5p x I-3 complex. For the present paper, CD spectroscopy and DMS methylation techniques were used to investigate the binding of g5p to the I-3 oligomer and to the truncated 26-nucleotide core of the I-3 oligomer. The core sequence, called I-3c26, was d(GGGGTCAGGCTGGGGTTGTGCAGGTC). Results were the following: (1) The g5p binds in one stage to I-3c26 in 200 mM NaCl at 37 degrees C. (2) The intermediate complex of g5p.I-3 is formed by the binding of g5p to the core sequence. (3) G-quadruplex structures are maintained in both the g5p x I-3 and g5p x I-3c26 complexes, but the bound G-quadruplex structures are altered from their respective steady-state folded forms in 200 mM NaCl. (4) CD kinetics measurements showed that the I-3c26 quadruplex folds in two stages and that a transiently folded form is apparently the same as the altered structure to which g5p binds. (5) DMS methylation protection and interference experiments identified two guanines that are differentially involved in the steady-state folded and g5p-bound G-quadruplex structures. A model for a possible I-3c26 G-quadruplex structure is described.

CD of Single-Stranded, Double-Stranded, and G-Quartet Nucleic Acids in Complexes with a Single-Stranded DNA-Binding Protein

We review CD studies of a single-stranded DNA binding protein, g5p, of the Ff group of bacterial viruses. The CD spectrum of the g5p is dominated by a positive tyrosine La band at 229 nm, to which all five of the protein tyrosines contribute. The La band becomes much less positive upon binding of g5p to nucleic acids. CD spectra of mutant proteins identified a single tyrosine, Y34, that is largely responsible for this CD perturbation. At >250 nm, CD perturbations of nucleic acids can be monitored during g5p binding, and CD titrations have identified two distinct modes of binding of the g5p at physiological ionic strength (0.2 M NaCl). SELEX selection of sequences bound preferentially by g5p yielded a G-rich sequence that is closely related to telomere sequences and has CD properties of a G-tetraplex. CD spectroscopy showed that the presumed G-quadruplex form is maintained within saturated g5p x DNA complexes.

The high binding affinity of phosphorothioate-modified oligomers for Ff gene 5 protein is moderated by the addition of C-5 propyne or 2'-O-methyl modifications.

One of the problems that hamper the use of antisense DNAs as effective drugs is the non-specific binding of chemically-modified oligonucleotides to cellular proteins. We previously showed that the affinity of a model ssDNA-binding protein, the Ff gene 5 protein (g5p), was >300-fold higher for phosphorothioate-modified DNA (S-DNA) than for unmodified dA(36), consistent with the propensity of S-DNA to bind indiscriminately to proteins. The current work shows that g5p binding is also sensitive to sugar and pyrimidine modifications used in antisense oligomers. Binding affinities of g5p for 10 36mer oligomers were quantitated using solution circular dichroism measurements. The oligomers contained C-5-propyne (prC), 2'-O-methyl (2'-O-Me) or 2'-OH (RNA) groups, alone or combined with the phosphorothioate modification. In agreement with reported increases in antisense activity, the addition of prC or 2'-O-Me modifications substantially reduced the affinity of oligomers for g5p by approximately 2-fold compared with the same DNA oligomer sequences containing only phosphorothioate linkages. That is, such modifications moderated the propensity of the phosphorothioate group to bind tightly to the g5p. The Ff g5p could be a useful model protein for assessing non-specific binding effects of antisense oligomer modifications.

SELEX selection of high-affinity oligonucleotides for bacteriophage Ff gene 5 protein.

The Ff gene 5 protein (g5p) is a cooperative ssDNA-binding protein. SELEX was used to identify DNA sequences favorable for g5p binding at physiological ionic strength (200 mM NaCl) and 37 degrees C. Sequences were selected from a library of 58-mers that contained a central variable segment of 26 nucleotides. DNA sequences selected after eight rounds of SELEX were mostly G-rich, with multiple copies of CPuGGPy, TPuGGGPy, and/or PyPuPuGGGPy motifs. This was unexpected, since g5p has higher binding affinities for polypyrimidine than for polypurine sequences. The most recurrent G-rich sequence, named I-3, was found to have g5p-binding properties that were correlated with a structural transition. At 10 mM NaCl, I-3 existed in a single-stranded form that was saturated by g5p in an all-or-none fashion. At 200 mM NaCl, I-3 existed in a structured form that showed CD spectral features of G-quadruplexes. The g5p binding affinity for this structured form of I-3 was >100-fold higher than for the single-stranded form. Moreover, the structured I-3 was saturated by g5p in two steps, the first of which was the formation of an apparent initiation complex consisting of one I-3 strand and about three g5p dimers. Nuclease S1 footprinting and other experiments showed that g5p molecules in the initiation complex at 200 mM NaCl were bound directly to the G-rich variable segment and that the structure of I-3 was retained after saturation by g5p. Thus, G-rich motifs may form structures favorable for initiation of g5p binding and also provide the actual g5p-binding sites.

Ff gene 5 protein has a high binding affinity for single-stranded phosphorothioate DNA.

The gene 5 protein (g5p) of Ff bacteriophages is a well-studied model ssDNA-binding protein that binds cooperatively to the Ff ssDNA genome and single-stranded polynucleotides. Its affinity, K omega (the intrinsic binding constant times a cooperativity factor), can differ by several orders of magnitude for ssDNAs of different nearest-neighbor base compositions [Mou, T. C., Gray, C. W., and Gray, D. M. (1999) Biophys. J. 76, 1537-1551]. We found that the DNA backbone can also dramatically affect the binding affinity. The K omega for binding phosphorothioate-modified S-d(A)(36) was >300-fold higher than for binding unmodified P-d(A)(36) at 0.2 M NaCl. CD titrations showed that g5p bound phosphorothioate-modified oligomers with the same stoichiometry as unmodified oligomers. The CD spectrum of S-d(A)(36) underwent the same qualitative change upon protein binding as did the spectrum of unmodified DNA, and the phosphorothioate-modified DNA appeared to bind in the normal g5p binding site. Oligomers of d(A)(36) with different proportions of phosphorothioate nucleotides had binding affinities and CD perturbations intermediate to those of the fully modified and unmodified sequences. The influence of phosphorothioation on binding affinity was nearly proportional to the extent of the modification, with a small nearest-neighbor dependence. These and other results using d(ACC)(12) oligomers and mutant proteins indicated that the increased binding affinity of g5p for phosphorothioate DNA was not a polyelectrolyte effect and probably was not an effect due to the altered nucleic acid structure, but was more likely a general effect of the properties of the sulfur in the context of the phosphorothioate group.

The Binding Affinity of Ff Gene 5 Protein Depends on the Nearest-Neighbor Composition of the ssDNA Substrate

The Ff gene 5 protein (g5p) is considered to be a nonspecific single-stranded DNA binding protein, because it binds cooperatively to and saturates the Ff bacteriophage single-stranded DNA genome and other single-stranded polynucleotides. However, the binding affinity Kω (the intrinsic binding constant times a cooperativity factor) differs by over an order of magnitude for binding to single-stranded polynucleotides such as poly[d(A)] and poly[d(C)]. A polynucleotide that is more stacked, like poly[d(A)], binds more weakly than one that is less stacked, like poly[d(C)]. To test the hypothesis that DNA base stacking, a nearest-neighbor property, is involved in the binding affinity of the Ff g5p for different DNA sequences, Kω values were determined as a function of NaCl concentration for binding to six synthetic sequences 48 nucleotides in length: dA 48, dC 48, d(AAC) 16, d(ACC) 16, d(AACC) 12, and d(AAACC) 9A 3. The binding affinities of the protein for these sequences were indeed found to be related to the nearest-neighbor compositions of the sequences, rather than to simple base compositions. That is, the g5p binding site, which is spanned by four nucleotides, discriminates among these sequences on the basis of the relative numbers of nearest neighbors (AA, CC, and AC plus CA) in the sequence. The results support the hypothesis that the extent of base stacking/unstacking of the free, nonbound ssDNA plays an important role in the binding affinity of the Ff gene 5 protein.

A phage single-stranded DNA (ssDNA) binding protein complements ssDNA accumulation of a geminivirus and interferes with viral movement.

Geminiviruses are plant viruses with circular single-stranded DNA (ssDNA) genomes encapsidated in double icosahedral particles. Tomato leaf curl geminivirus (ToLCV) requires coat protein (CP) for the accumulation of ssDNA in protoplasts and in plants but not for systemic infection and symptom development in plants. In the absence of CP, infected protoplasts accumulate reduced levels of ssDNA and increased amounts of double-stranded DNA (dsDNA), compared to accumulation in the presence of wild-type virus. To determine whether the gene 5 protein (g5p), a ssDNA binding protein from Escherichia coli phage M13, could restore the accumulation of ssDNA, ToLCV that lacked the CP gene was modified to express g5p or g5p fused to the N-terminal 66 amino acids of CP (CP66:6G:g5). The modified viruses led to the accumulation of wild-type levels of ssDNA and high levels of dsDNA. The accumulation of ssDNA was apparently due to stable binding of g5p to viral ssDNA. The high levels of dsDNA accumulation during infections with the modified viruses suggested a direct role for CP in viral DNA replication. ToLCV that produced the CP66:6G:g5 protein did not spread efficiently in Nicotiana benthamiana plants, and inoculated plants developed only very mild symptoms. In infected protoplasts, the CP66:6G:g5 protein was immunolocalized to nuclei. We propose that the fusion protein interferes with the function of the BV1 movement protein and thereby prevents spread of the infection.