Full Response Element Research Articles

Hotspots for Vitamin-Steroid-Thyroid Hormone Response Elements Within Switch Regions of Immunoglobulin Heavy Chain Loci Predict a Direct Influence of Vitamins and Hormones on B Cell Class Switch Recombination.

Vitamin A deficiencies are common throughout the world and have a significant negative influence on immune protection against viral infections. Mouse models demonstrate that the production of IgA, a first line of defense against viruses at mucosal sites, is inhibited in the context of vitamin A deficiency. In vitro, the addition of vitamin A to activated B cells can enhance IgA expression, but downregulate IgE. Previous reports have demonstrated that vitamin A modifies cytokine patterns, and in so doing may influence antibody isotype expression by an indirect mechanism. However, we have now discovered hundreds of potential response elements among Sμ, Sɛ, and Sα switch sites within immunoglobulin heavy chain loci. These hotspots appear in both mouse and human loci and include targets for vitamin receptors and related proteins (e.g., estrogen receptors) in the nuclear receptor superfamily. Full response elements with direct repeats are relatively infrequent or absent in Sγ regions although half-sites are present. Based on these results, we pose a hypothesis that nuclear receptors have a direct effect on the immunoglobulin heavy chain class switch recombination event. We propose that vitamin A may alter S site accessibility to activation-induced deaminase and nonhomologous end-joining machinery, thereby influencing the isotype switch, antibody production, and protection against viral infections at mucosal sites.

Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements

Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.

Structural and dynamic differences of the estrogen receptor DNA-binding domain, binding as a dimer and as a monomer to DNA: molecular dynamics simulation studies.

Molecular dynamics (MD) simulations of the estrogen receptor DNA-binding domain (ERDBD) as a dimer in complex with its DNA response element (ERE) show a significant difference in both structure and dynamics, compared to a MD simulation of monomeric ERDBD bound to its half-site response element (EREH). The C-terminal zinc binding domain (ZnII), including a region (helix II) which is in a helical conformation in ERE-(ERDBD)2, is considerably more flexible in EREH-ERDBD than in the dimeric complex. In EREH-ERDBD, all helical hydrogen bonds in helix II are broken and the entire ZnII region is detached from a hydrogen bonding network that in ERE-(ERDBD)2 connects to other parts of the protein as well as to the DNA. The regions that become flexible in EREH-ERDBD are identical to the regions where the NMR solution structure of free ERDBD is poorly ordered. This strongly suggests that dimerisation of ERDBD is required for ordering of the ZnII region and that monomeric binding to DNA is not sufficient for the ordering. This contrasts to the glucocorticoid receptor DNA-binding domain (GRDBD) which has essentially the same mobility (uniform and limited), regardless of whether it is free as a monomer in solution, bound as a monomer to its half-site response element or in a dimeric complex with the full response element. The hydrogen bonding network that connects ZnII with other parts of the protein and to DNA is almost identical in ERDBD and GRDBD. However, in GRDBD there is also a serine (in the N-terminal zinc coordinating region) with a central role in this network, connecting to the ZnII region. This serine is replaced by a glycine in ERDBD and we suggest that this substitution is sufficient for destabilisation of the network, thus leading to a more flexible ZnII region, which becomes ordered first upon forming a complex with another ERDBD and DNA.

DNA Bending Is Essential for the Site-specific Recognition of DNA Response Elements by the DNA Binding Domain of the Tumor Suppressor Protein p53

We have used circular permutation assays to determine the extent and location of the DNA bend induced by the DNA binding domain of human wild type p53 (p53DBD) upon binding to several naturally occurring DNA response elements. We have found that p53DBD binding induces axial bending in all of the response elements investigated. In particular, response elements having a d(CATG) sequence at the junction of two consensus pentamers in each half-site favor highly bent complexes (bending angle is approximately 50 degrees ), whereas response elements having d(CTTG) bases at this position are less bent (bending angles from approximately 37 to approximately 25 degrees ). Quantitative electrophoretic mobility shift assays of different complexes show a direct correlation between the DNA bending angle and the binding affinity of the p53DBD with the response elements, i.e. the greater the stability of the complex, the more the DNA is bent by p53DBD binding. The study provides evidence that the energetics of DNA bending, as determined by the presence or absence of flexible sites in the response elements, may contribute significantly to the overall binding affinity of the p53DBD for different sequences. The results therefore suggest that both the structure and the stability of the p53-DNA complex may vary with different response elements. This variability may be correlated with variability in p53 function.

Four p53 DNA-binding domain peptides bind natural p53-response elements and bend the DNA.

Recent structural studies of the minimal core DNA-binding domain of p53 (p53DBD) complexed to a single consensus pentamer sequence and of the isolated p53 tetramerization domain have provided valuable insights into their functions, but many questions about their interacting roles and synergism remain unanswered. To better understand these relationships, we have examined the binding of the p53DBD to two biologically important full-response elements (the WAF1 and ribosomal gene cluster sites) by using DNA circularization and analytical ultracentrifugation. We show that the p53DBD binds DNA strongly and cooperatively with p53DBD to DNA binding stoichiometries of 4:1. For the WAF1 element, the mean apparent Kd is (8.3 +/- 1.4) x 10(-8) M, and no intermediate species of lower stoichiometries can be detected. We show further that complex formation induces an axial bend of at least 60 degrees in both response elements. These results, taken collectively, demonstrate that p53DBD possesses the ability to direct the formation of a tight nucleoprotein complex having the same 4:1 DNA-binding stoichiometry as wild-type p53 which is accompanied by a substantial conformational change in the response-element DNA. This suggests that the p53DBD may play a role in the tetramerization function of p53. A possible role in this regard is proposed.