Full-length Open Reading Frame Research Articles

Characterisation and Expression Analysis of LdSERK1, a Somatic Embryogenesis Gene in Lilium davidii var. unicolor.

The Lanzhou lily (Lilium davidii var. unicolor) is a variant of the Sichuan lily of the lily family and is a unique Chinese 'medicinal and food' sweet lily. Somatic cell embryogenesis of Lilium has played an important role in providing technical support for germplasm conservation, bulb propagation and improvement of genetic traits. Somatic embryogenesis receptor-like kinases (SERKs) are widely distributed in plants and have been shown to play multiple roles in plant life, including growth and development, somatic embryogenesis and hormone induction. Integrating the results of KEGG enrichment, GO annotation and gene expression analysis, a lily LdSERK1 gene was cloned. The full-length open reading frame of LdSERK1 was 1875 bp, encoding 624 amino acids. The results of the phylogenetic tree analysis showed that LdSERK1 was highly similar to rice, maize and other plant SERKs. The results of the subcellular localisation in the onion epidermis suggested that the LdSERK1 protein was localised at the cell membrane. Secondly, we established the virus-induced gene-silencing (VIGS) system in lily scales, and the results of LdSERK1 silencing by Tobacco rattle virus (TRV) showed that, with the down-regulation of LdSERK1 expression, the occurrence of somatic embryogenesis and callus tissue induction in scales was significantly reduced. Finally, molecular assays from overexpression of the LdSERK1 gene in Arabidopsis showed that LdSERK1 expression was significantly enhanced in the three transgenic lines compared to the wild type, and that the probability of inducing callus tissue in seed was significantly higher than that of the wild type at a concentration of 2 mg/L 2,4-D, which was manifested by an increase in the granularity of the callus tissue.

ZNF469 is a profibrotic regulator of extracellular matrix in hepatic stellate cells.

Activation of quiescent hepatic stellate cells (HSCs) into proliferative myofibroblasts drives extracellular cellular matrix (ECM) accumulation and liver fibrosis; nevertheless, the transcriptional network that promotes such a process is not completely understood. ZNF469 is a putative C2H2 zinc finger protein that may bind to specific genome sequences. It is found to be upregulated upon HSC activation; however, the molecular function of ZNF469 is completely unknown. Here, we show that knockdown of ZNF469 in primary human HSCs impaired proliferation, migration, and collagen production. Conversely, overexpression of ZNF469 in HSCs yielded the opposite results. Transforming growth factor-β 1promoted expression of ZNF469 in a Smad3-dependent manner, where the binding of Smad3 was confirmed at the ZNF469 promoter.RNA sequencingdata of ZNF469-knockdown HSCs revealed the ECM-receptor interaction, which provides structural and signaling support to cells, was the most affected pathway, and significant downregulation of various collagen and proteoglycan genes was observed. To investigate the function of ZNF469, we cloned a full-length open reading frame of ZNF469 with an epitope tag and identified a nuclear localization of the protein. Luciferase reporter and chromatin immunoprecipitationassays revealed the presence of ZNF469 at the promoter of ECM genes, supporting its function as a transcription factor. Analysis of human fibrotic and cirrhotic tissues showed increased expression of ZNF469 and a positive correlation between expression levels of ZNF469 and ECM genes. Moreover, this observation was similar in other fibrotic organs, including the heart, lung, and skin, suggesting that myofibroblasts from various origins generally require ZNF469 to promote ECM production. Together, this study is the first to reveal the role of ZNF469 as a profibrotic factor in HSCs and suggests ZNF469 as a novel target for antifibrotic therapy.

Identification and function analysis of steroid hormone synthesis pathway-related gene—Hsd3b in Scylla paramamosain

Mud crab (Scylla paramamosain) has become an important mariculture crab along the southeast coast of China due to its strong adaptability, delicious taste, and rich nutrition. Several vertebrate steroid hormones and their synthesis-related genes and receptors have been found in crustaceans, but there are few reports on their synthesis process and mechanism. 3-beta-hydroxysteroid dehydrogenase (HSD3B) is a member of the Short-chain Dehydrogenase/Reductase (SDR) family, and an indispensable protein in vertebrates' steroid hormone synthesis pathway. In this study, the SpHsd3b gene sequence was obtained from the transcriptome data of S. paramamosain, and its full-length open reading frame (ORF) was cloned. The spatial and temporal expression pattern of SpHsd3b was performed by quantitative real-time PCR (qRT-PCR). SpHsd3b dsRNA interference (RNAi) and HSD3B inhibitor (trilostane) were used to analyze the function of SpHSD3B. The results showed that the SpHsd3b gene has an 1113 bp ORF encoding 370 amino acids with a 3β-HSD domain. SpHSD3B has lower homology with HSD3B of vertebrates and higher homology with HSD3B of crustaceans. SpHsd3b was expressed in all examined tissues in mature crabs, and its expression was significantly higher in the testes than in the ovaries. SpHsd3b expression level was highest in the middle stage of testicular development, while its expression was higher in the early and middle stages of ovarian development. RNAi experiment and trilostane injection results showed that SpHSD3B had regulatory effects on several genes related to gonadal development and steroid hormone synthesis. 15-day trilostane suppression could also inhibit ovarian development and progesterone level of hemolymph. According to the above results, crustaceans may have steroid hormone synthesis pathways like vertebrates, and the Hsd3b gene may be involved in the gonadal development of crabs. This study provides further insight into the function of genes involved in steroid hormone synthesis in crustaceans.

Functional characteristics of Dicer genes in Plutella xylostella.

Dicer is an endonuclease that belongs to the RNase III family and can specifically recognize and cleave double-stranded RNA (dsRNA). In most insects, there are two Dicer genes, Dicer-1 (Dcr-1) and Dicer-2 (Dcr-2), which are involved in the micro-RNA and small-interfering RNA pathways in many species, respectively. The function of Dicer in Plutella xylostella remains unknown. The full-length open reading frames of P. xylostella Dicer-1 (PxDcr-1) and Dicer-2 (PxDcr-2) were cloned and sequenced. Dcr-1andDcr-2 proteins shared similar structural domains with the Dicer-Partner Binding Domain (Dicer-PBD) and the double-strand RNA binding domain (dsRBD) present only in Dcr-1. The phylogenetic trees showed that lepidopteran Dcr-1s or Dcr-2s clustered in one branch, with PxDcr-1 in the basal position and PxDcr-2 closest to Plodia interpunctella Dicer. Two homozygous knockout lines, ΔPxDcr-1 and ΔPxDcr-2, were obtained by using the CRISPR-Cas9 technique. The ΔPxDcr-1 strain exhibited a high mortality rate, a low eclosion rate, a low egg-laying rate, a low hatching rate, and a shriveled ovariole without mature eggs. The ΔPxDcr-2 strain showed no significant difference from the wild-type in terms of survival, development and reproduction, but the RNA interference (RNAi) efficiency caused by dsRNA was significantly reduced. These findings demonstrate the involvement of PxDcr-1 in the development and reproduction of P. xylostella, specifically in the formation of ovarioles and eggs, and PxDcr-2 is indispensable for RNAi. These findings shed light on the function of Dcr-1 and Dcr-2 in Lepidoptera. © 2023 Society of Chemical Industry.

Cross-species immunoprotective antigens (subolesin, ferritin 2 and P0) provide protection against Rhipicephalus sanguineus sensu lato

BackgroundTick control is mostly hampered by the rise of acaricide-resistant tick populations. Significant efforts have focused on developing alternative control methods, including cross-species protective and/or cocktail-based anti-tick vaccines, to achieve protection against various tick species.MethodsIn this study, full-length open reading frames encoding subolesin (SUB) from Rhipicephalus microplus and ferritin 2 (FER2) from Hyalomma anatolicum as well as the partial 60S acidic ribosomal protein (P0) from R. microplus were cloned, expressed in Escherichia coli and used as vaccine antigens against Rhipicephalus sanguineus sensu lato (R. sanguineus s.l.) infestation in rabbits.ResultsIn silico analyses revealed that the SUB, P0 and FER2 proteins were antigenic and displayed limited similarity to the host's homologous proteins. The proteins shared identities of 97.5%, 100% and 89.5% with their SUB, P0 and FER2 R. sanguineus s.l. orthologous sequences, respectively. Antibodies against each recombinant protein cross-recognized the native proteins in the different tissues and developmental stages of R. sanguineus s.l. Overall efficacy of the SUB, FER2 and cocktail (SUB+FER2+P0) vaccines against R. sanguineus s.l. infestation was 86.3%, 95.9% and 90.9%, respectively.ConclusionsBoth mono-antigen and the cocktail anti-tick vaccines affected the biological parameters of R. sanguineus s.l. infestation in the rabbit model, which could be extrapolated to its infested host under natural conditions. These findings support the possibility of using mono-antigenic and cocktail-based vaccines for large-scale anti-tick vaccine development against multiple tick species.Graphical

TBK1 upregulates the interferon response against virus by the TBK1-IRF3/7 axis in yellow catfish (Pelteobagrus fulvidraco)

Yellow catfish (Pelteobagrus fulvidraco) is an important economic species of freshwater fish, widely distributed in China. Recently, viral diseases of yellow catfish have been identified in Chian (Hubei province), arising more attention to the viral immunity in P. fulvidraco. Tumor necrosis factor (TNF) receptor-associated factor NF-κB activator (TANK)-binding kinase 1 (TBK1) plays an essential role in IFN production and innate antiviral immunity. In the present study, we characterized the P. fulvidraco TBK1 (PfTBK1) and reported its function in interferon response. The full-length open reading frame (ORF) is 2184 bp encoding a protein with 727 amino acids, which is composed of four conserved domains, including KD, ULD, CCD1, and CCD2, similar to TBK1 in other species. Pftbk1 was widely expressed in all detected tissues by qPCR and was not inducible by the spring viremia of carp virus (SVCV), a single-strand RNA virus. In addition, the cellular distribution indicated that PfTBK1 was only located in the cytoplasm. Moreover, PfTBK1 induced strong IFN promoter activities through the Jak-stat pathway, and PfTBK1 interacted with and significantly phosphorylated IFN regulatory factor 3/7 (IRF3/7) in P. fulvidraco, promoting the nuclear translocation of pfIRF3 and PfIRF7, and PfTBK1 upregulated IFN response by PfTBK1-PfIRF3/7 axis. Above all, PfTBK1 triggered IFN response and strongly inhibited the replication of SVCV in EPC cells through induction of IFN downstream IFN-stimulated genes (ISGs). Summarily, this work reveals that PfTBK1 plays a positive regulatory role in IFN induction through the TBK1-IRF3/7 axis, laying a foundation for further exploring the molecular mechanism of the antiviral process in P. fulvidraco.

Molecular and functional characterization of golden pompano (Trachinotus blochii) TBK1 on IFN regulation

The golden pompano (Trachinotus blochii), a pivotal commercial marine species in China, has gained significant popularity worldwide. However, accompanied with rapid growth and high density aquaculture, golden pompano has been seriously threatened by Nervous necrosis virus (NNV), while its molecular biology research regarding the innate immune system remains unexplored, which is crucial for understanding the activation of interferon (IFN) production and antiviral responses. In this study, we aimed to identify the characterization and function of golden pompano TANK-binding kinase 1 (gpTBK1), thereby providing evidence of the conservation of this classical factor in the RLR pathway among marine fish. Initially, we found the expression of gpTBK1 upregulation in diseased golden pompano with NNV infection and we successfully cloned the full-length open reading frame (ORF) of gpTBK1, consisting of 2172 nucleotides encoding 723 amino acids, from the head kidney. Subsequent analysis of the amino acid sequence revealed homology between gpTBK1 and other fish TBK1 proteins, with conserved N-terminal Serine/Threonine protein kinases catalytic domain (S_TKc) and C-terminal coiled coil domain (CCD). Moreover, the expression pattern showed that gpTBK1 exhibited ubiquitous expression across all evaluated tissues. Furthermore, functional identification experiments indicated that gpTBK1 activated interferon promoters’ activity in golden pompano and induced the expression of downstream IFN-stimulated genes (ISGs). Notably, gpTBK1 was found to co-localize and interact with gpIRF3 in the cytoplasm. Collectively, these data provide a comprehensive analysis of the characterization and functional role of gpTBK1 in promoting interferon production. This research may facilitate the further study of the innate antiviral response, particularly the anti-NNV mechanisms, in golden pompano.

CsTT8 regulates anthocyanin accumulation in blood orange through alternative splicing transcription.

A homologous gene of basic-helix-loop-helix AtTT8 in Arabidopsis thaliana was identified in juice sac cells of pulp tissues from blood orange (Citrus sinensis cv 'Tarocco'), which was designated as CsTT8 in this study. Additionally, the mRNA levels of TT8 with the full-length open reading frame were significantly higher in 'Tarocco' than in mutant fruit lacking pigment in pulp or peel tissues. However, an alternative splicing transcript, Δ15-TT8, with the fourth exon skipped, was also identified from transcripts different in length from that in 'Tarocco'. The mRNA levels of Δ15-TT8 were higher in mutant fruit lacking pigment in pulp or peel tissues than in the wild type. Therefore, the TT8/Δ15-TT8 mRNA level ratio was found to be crucial for sufficient pigment in either pulp or peel tissues. TT8 from blood orange fruit demonstrated the capacity for nucleus localization and binding to other proteins. In contrast, Δ15-TT8, lacking the fourth exon, lost its ability to interact with RUBY1 and to localize at the nucleus. Using a dual luciferase reporter assay and transient overexpression in tobacco, we proved that two regulatory complexes formed by a functional TT8 with different MYB(v-myb avian myeloblastosis viral oncogene homolog)-type partners significantly promoted expression of an anthocyanin biosynthetic gene and a proton pumping gene, leading to anthocyanin and citrate production. Our findings suggest that TT8, rather than dysfunctional Δ15-TT8, is possibly involved in modulating anthocyanin biosynthesis and its transport into vacuoles by proton gradients. However, increased mRNA levels of the dysfunctional alternative splicing transcript may act as a negative feedback to downregulate TT8 expression and limit anthocyanin accumulation in blood oranges.

Using Isoform Sequencing for De Novo Transcriptome Sequencing and the Identification of Genes Related to Drought Tolerance and Agronomic Traits in Tall Fescue (Festuca arundinacea Schreb.)

Plant height and tillering are the key traits of tall fescue (Festuca arundinacea Schreb.), a perennial turf grass widely used for forage and turf worldwide. It exhibits excellent abiotic stress tolerance. However, the investigation of these traits at the genetic level is limited by the lack of a completely sequenced genome of tall fescue. Here, we generated genome-wide transcriptome data using PacBio isoform sequencing (Iso-Seq) technology. We obtained 73,628 transcripts with an average length of 2410 bp. Among these transcripts, 42,265 (60.09%) were predicted as complete full-length open reading frames. The dataset contained 11,520 simple sequence repeats; 737 bp long non-coding RNAs; and 1599 alternative splicing sites in unigenes. Sixty-three unigenes involved in abscisic acid biosynthesis, catabolism, and signaling pathways were identified. The Illumina-sequencing analysis results, further verified using qRT-PCR, revealed the significant upregulation of nine unigenes under drought stress. Ninety-three unigenes involved in controlling plant height and tillering were also identified, of which FaMAX1 was functionally verified to regulate plant tillering. Our results provide a valuable genetic resource about the complete transcriptome of tall fescue; the identified candidate genes can aid in improving the drought tolerance and agronomic traits in tall fescue and other related plants.

Uncovering the Underlying Mechanisms Blocking Replication of Bluetongue Virus Serotype 26 (BTV-26) in Culicoides Cells.

At least 12 serotypes of 'atypical' bluetongue virus (BTV-25 to BTV-36) have been identified to date. These atypical serotypes fail to infect/replicate in Culicoides-derived cell lines and/or adult Culicoides vectors and hence can no longer be transmitted by these vectors. They appear to be horizontally transmitted from infected to in-contact ruminants, although the route(s) of infection remain to be identified. Viral genome segments 1, 2 and 3 (Seg-1, Seg2 and Seg-3) of BTV-26 were identified as involved in blocking virus replication in KC cells. We have developed Culicoides-specific expression plasmids, which we used in transfected insect cells to assess the stability of viral mRNAs and protein expression from full-length open reading frames of Seg-1, -2 and -3 of BTV-1 (a Culicoides-vectored BTV) or BTV-26. Our results indicate that the blocked replication of BTV-26 in KC cells is not due to an RNAi response, which would lead to rapid degradation of viral mRNAs. A combination of degradation/poor expression and/or modification of the proteins encoded by these segments appears to drive the failure of BTV-26 core/whole virus-particles to assemble and replicate effectively in Culicoides cells.

The Expression Pattern of Insulin-Like Growth Factor Subtype 3 (igf3) in the Orange-Spotted Grouper Epinephelus coioides and Its Function on Ovary Maturation.

A new insulin-like growth factor (Igf) subtype 3 (igf3) has recently been found in the bony fish orange-spotted grouper (Epinephelus coioides). However, the role of igf3 in the maturation of the ovary and sex differentiation in E. coioides is currently unknown. We examined the ovarian localization and receptor binding of the novel ortholog Igf3 using qRT-PCR, and Western blotting, combined with in situ hybridization and immunohistochemistry methods. Results demonstrated the presence of igf3 mRNA and protein in mature oocytes. Furthermore, Igf3 protein expression was not detected in testis, brain, kidney and liver homogenates. The calculated molecular weight of Igf3 was 22 kDa, which was consistent with the deduced amino acid sequence from the full-length open reading frame. The immunoreactivity showed that Igf3 was strongly present in the follicle staining fully-grown stage. The igf3 mRNA expression level was significantly positively correlated with ovarian follicular maturation. Meanwhile, Igf3 increased germinal-vesicle breakdown in a time- and dose-dependent manner. In vitro, treatment of primary ovarian cells with Igf3 up-regulated significantly the mRNA expression level of genes related to sex determination and reproduction such as forkhead boxl2 (foxl2), dosage-sensitive sex reversal adrenal hypoplasia critical region on chromosome x gene 1 (dax1), cytochrome P450 family 19 subfamily member 1 a (cyp19a1a), cytochrome P450 family 11 subfamily a member 1 a (cyp11a1a) and luteinizing hormone receptor 1 (lhr1). Overall, our results demonstrated that igf3 promotes the maturation of the ovary and plays an important role in sex differentiation in E. coioides.

Identification of a fatty acid synthase gene (FAS1) from Laodelphax striatellus planthoppers contributing to fecundity.

Fatty acid synthase (FAS) is a multifunctional enzyme that plays an important role in the formation of fatty acids. The fatty acids take part in many processes, such as cell signaling and energy metabolism, and in insects they are important in both cuticular hydrocarbon (CHC) formation and reproduction. Here we characterized the sequence structure and function of an FAS from the small brown planthopper (SBPH), Laodelphax striatellus. The full-length open reading frame (ORF) sequence of LsFAS1 was 7122bp, encoding a predicted protein of 2373 amino acid residues. There were 7 functional domains in the LsFAS1 protein sequence. Gene expression screening by real-time quantitative polymerase chain reaction (RT-qPCR) showed that LsFAS1 was expressed in all developmental stages. Relative expression was highest at the 4th-instar and female adult stages. Among different tissues, the expression level of LsFAS1 in the ovary was the highest. Phylogenetic analysis showed that LsFAS1 clustered in a clade with 2 FASs from Nilaparvata lugens. Furthermore, these 3 FASs are related to cockroach BgFAS and locust LmFAS. After RNA interference-mediated knock-down, most treated insects died at eclosion. In addition, the lifespan of dsFAS1-treated female adults was shorter than that of the dsGFP-injected control, and offspring production decreased. Also, the expression of vitellogenin (Vg) and vitellogenin receptor (VgR) genes decreased. Virgin females dissected at days2 and 4 post-eclosion showed many matured oocytes in planthoppers treated with dsGFP but not with dsFAS1. These data highlight the importance of LsFAS1 in SBPH, including a role in reproduction.

Molecular features and functional studies of transcription factor, Cap ‘n’ collar C, in the brown planthopper, Nilaparvata lugens Stål (Hemiptera Delphacidae)

• Molecular features of Cap ‘n’ Collar C of Nilaparvata lugens was firstly described. • Knockdown of NlCncC cause lethality in N. lugens. • NlCncC mediate resistance of N. lugens to imidacloprid by affecting transcript level of P450 genes. Cap ‘n’ collar C ( CncC ), a transcription factor, plays a vital role in the development of insect resistance by regulating the expression of multiple detoxifying genes. Clarifying the molecular characteristics of CncC and its pathway regulating insecticide resistance will aid the development of integrated pest control strategies. Here we cloned and identified the molecular feature of CncC genes from the brown planthopper (BPH), Nilaparvata lugens (Stål), (Hemiptera: Delphacidae). The full-length open reading frame of NlCncC was 3015 nucleotides with 1005 amino acids. The deduced amino acid sequence has a high similarity with other insect homologs and contains the characteristic Cnc/bZip domain architecture. Functional studies showed that silencing NlCncC by RNA interference (RNAi) could downregulate the transcript expression of NlCYP6ER1 , NlCYP6CW1, and NlCYP6AY1, which increase the susceptibility to imidacloprid in N. lugens . The identification of molecular characteristics of NlCncC and functional studies in this paper will contribute to designing effective control strategies for N. lugens .

Genome-Wide Identification of the Highly Conserved INDETERMINATE DOMAIN (IDD) Zinc Finger Gene Family in Moso Bamboo (Phyllostachys edulis).

INDETERMINATE DOMAIN (IDD) proteins, a family of transcription factors unique to plants, function in multiple developmental processes. Although the IDD gene family has been identified in many plants, little is known about it in moso bamboo. In this present study, we identified 32 PheIDD family genes in moso bamboo and randomly sequenced the full-length open reading frames (ORFs) of ten PheIDDs. All PheIDDs shared a highly conserved IDD domain that contained two canonical C2H2-ZFs, two C2HC-ZFs, and a nuclear localization signal. Collinearity analysis showed that segmental duplication events played an important role in expansion of the PheIDD gene family. Synteny analysis indicated that 30 PheIDD genes were orthologous to those of rice (Oryza sativa). Thirty PheIDDs were expressed at low levels, and most PheIDDs exhibited characteristic organ-specific expression patterns. Despite their diverse expression patterns in response to exogenous plant hormones, 8 and 22 PheIDDs responded rapidly to IAA and 6-BA treatments, respectively. The expression levels of 23 PheIDDs were closely related to the outgrowth of aboveground branches and 20 PheIDDs were closely related to the awakening of underground dormant buds. In addition, we found that the PheIDD21 gene generated two products by alternative splicing. Both isoforms interacted with PheDELLA and PheSCL3. Furthermore, both isoforms could bind to the cis-elements of three genes (PH02Gene17121, PH02Gene35441, PH02Gene11386). Taken together, our work provides valuable information for studying the molecular breeding mechanism of lateral organ development in moso bamboo.

Carotenoid analysis and functional characterization of lycopene cyclases in Zinnia elegans L.

Carotenoids, a group of essential pigments for petal coloration in many species, could be generally categorized into linear and cyclic groups. The cyclization of the linear substrate lycopene at both end groups by β- and ε-cyclases (LCYBs and LCYEs, respectively) is a key branching point of the biosynthesis of cyclic carotenoids in flowers. Common zinnia (Zinnia elegans L.), an Asteraceae family plant that has been widely used in landscape greening, is best known for its brilliant flower colors. However, the mechanism of its petal coloration is not well studied, especially with respect to carotenoid pigmentation. In this study, total carotenoid content and carotenoid compositions of petals were analyzed in two common zinnia cultivars, 'Dreamland Red’ (DRE) and 'Dreamland Yellow’ (DY). Despite the lighter color of DY petals, the total carotenoid content in DY flowers was significantly higher than that in DRE. Metabolomic analysis revealed that the major carotenoids of both cultivars are cyclic carotenoids, with β-carotene being the most abundant. In addition, one LCYB, LCYE, and capsanthin/capsorubin synthase (CCS) gene were identified from Z. elegans by homology-based search in transcriptome. After cloning and sequencing, full-length open reading frame of each gene is exactly the same between two cultivars. Bacterial pigment complementation experiments revealed that ZeLCYB and ZeCCS can cyclize lycopene at both ends to produce β-carotene. Unlike most LCYEs characterized from higher plants, ZeLCYE produced predominantly ε-carotene in E. coli system. However, ZeLCYE is likely to have a lower affinity for lycopene or lower activity compared with ZeLCYB. Gene expression analysis showed that DY has higher expression levels of ZeLCYB and ZeCCS than DRE at specific developmental stages, consistent with its higher total carotenoid content. This work would lay a solid foundation for future studies on carotenoid accumulation in Z. elegans.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Evolutionary History of DMSP Lyase-Like Genes in Animals and Their Possible Involvement in Evolution of the Scleractinian Coral Genus, Acropora

Dimethlysulfoniopropionate (DMSP) lyase is an enzyme that mediates cleavage of DMSP into dimethyl sulfide (DMS) and acrylate. DMS is an aerosol substance that may affect cloud formation, solar radiation and ocean temperatures. DMSP lyases in marine organisms, such as marine bacteria, release DMS, which might contribute to atmosphere-ocean feedback. Although DMSP lyases were first identified in marine bacteria, eukaryotic DMSP lyases or genes similar to DMSP lyase, DMSP lyase-like (DL-L) genes have been found not only in coccolithophores (Emiliania huxleyi) and symbiotic algae of the Family Symbiodiniaceae, but also in animals, including scleractinian corals (Cnidaria: Anthozoa: Hexacorallia). Comparative genomic analysis showed that gene expansion events of DL-L genes have occurred specifically in the scleractinian genus, Acropora. In the present study, we performed molecular identification of DL-L genes in Acropora digitifera. Thirteen full-length Open Reading Frames were isolated, confirming that these duplicated DL-L genes are likely expressed. A comprehensive survey of available transcriptomic databases revealed that DL-L genes have been identified not only in scleractinians (Hexacorallia), but also Octocorallia (Anthozoa) and even in a jellyfish (Cnidaria: Hydrozoa). Molecular phylogenetic analyses showed that although some sequences from cnidarian transcriptomic databases apparently originated with their symbiotic algae, cnidarian sequences from Anthozoa and Hydrozoa clustered together, indicating that these evolved from a gene in the last common ancestor of Cnidaria, dating to the Precambrian. Interestingly, cnidarian species possessing DL-L genes apparently occur only in coral reefs or shallow, warmer environments, suggesting that these genes may be essential for animals to survive in such environments. Acropora-specific duplicated DL-L genes, which originated during the past warm geological periods, may enable them to adapt to environmental changes.

Self-compatibility of ‘Zaohuang’ loquat is attributed to the lack of a 52 bp fragment in the S10-RNase promoter

Loquat (Eriobotrya japonica Lindl.) is a typical gametophytic self-incompatible (GSI) subtropical evergreen fruit tree, but there are also some self-compatible varieties. In this study, the fruit set rate of ‘Zaohuang (S2S10)’ and ‘Baiyu (S2S10)’ loquats were investigated after self-pollination and cross-pollination, respectively. The analysis demonstrated that ‘Zaohuang’ (‘ZH’) was self-compatible (SC) and ‘Baiyu’ (‘BY’) was self-incompatible (SI), while they were cross-compatible. The expression levels of S-RNase in the pistils of ‘ZH’ and ‘BY’ were analyzed by qPCR, indicating that the expression of S2-RNase was similar in the two cultivars, but the expression of S10-RNase in the pistils of ‘ZH’ was significantly lower than that in ‘BY’. In addition, cloning of the full-length open reading frame (ORF) sequence and promoter of S10-RNase in ‘ZH’ and ‘BY’ by TAIL-PCR showed that the full-length ORF sequence of S10-RNase was completely consistent in two loquat cultivars. However, the promoter of S10-RNase in ‘ZH’ (ZH-S10-RNase-P) lacks 52 bp fragment comparing with that in ‘BY’ (BY-S10-RNase-P). The deletion fragment was located at 1755 bp upstream to the start code ATG of S10-RNase, containing a TGACG-motif and a CGTCA-motif. To detect the activities of ZH-S10-RNase-P and BY-S10-RNase-P, we constructed ZH-S10-RNase-P::GFP and BY-S10-RNase-P::GFP plasmids and introduced them into tobacco pistils by transient expression method. The fluorescence of GFP was much lower in ZH-S10-RNase-P::GFP transformed tobacco pistils than that in BY-S10-RNase-P::GFP transformed pistils. These results indicated that the 52 bp deletion in the promoter of S10-RNase results in reducing the expression of S10-RNase and eventually leads to self-compatibility of ‘ZH’ loquat. Our research provided a new direction for screening loquat SC varieties with S10-RNase promoter.

A novel Ush transcription factor involving in hematopoiesis of Eriocheir sinensis.

The FOG transcriptional factor is a co-regulator that recognizes and binds to the GATA N-terminal zinc-finger domain and participates in hemocyte production and differentiation. In this study, an FOG-like gene, Ush, was characterized from Eriocheir sinensis, which consists of an 897bp full-length open reading frame, encoding a polypeptide of 298 amino acids with four ZnF_C2H2 domains. The EsUsh mRNA transcripts were mainly expressed in the hematopoietic tissue (HPT) and hemocytes, and were significantly higher in hyalinocytes than semi-granulocytes and granulocytes, which were separated by Percoll gradient centrifugation. The transcription levels of EsUsh were found to be significantly upregulated in HPT, but downregulated in hemocytes after exsanguination. By using flow cytometry to determine the percentage of hemocyte sub-population after exsanguination, the percentage of hyalinocytes was found to significantly downregulated, while the percentage of granulocytes was significantly upregulated. Silencing EsUsh by dsRNA interference significantly decreased the percentage of hyalinocytes and small granulocytes, and increased the percentage of medium granulocytes and large granulocytes. Such findings suggest that EsUsh might be involved in hemocyte production and differentiation, especially in promoting hyalinocyte formation and limiting granulocyte generation and differentiation.

Genetic Characteristics of Porcine Hemagglutinating Encephalomyelitis Coronavirus: Identification of Naturally Occurring Mutations Between 1970 and 2015.

Porcine hemagglutinating encephalomyelitis virus (PHEV) is a Betacoronavirus characterized by neurological symptoms and a worldwide prevalence. Although PHEV is one of the earliest discovered porcine coronaviruses, it remains poorly studied. The full-length genome of the earliest PHEV strain collected in 1970 in the United States (PHEV/67 N/US/1970) was determined in October 2020. Using this virus as a prototype, we comparatively analyzed all available PHEV full-length sequences during 1970–2015. In phylogenetic trees based on PHEV full-length or spike glycoprotein open reading frame genomic sequences, PHEV/67 N/US/1970 was sorted into a clade different from that of viruses isolated in the United States in 2015. Intriguingly, United States and Belgium viruses isolated in 2015 and 2005, respectively, revealed multiple deletion mutation patterns compared to the strain PHEV/67 N/US/1970, leading to a truncated or a non-functional NS2A coding region. In addition, the genomic similarity analysis showed a hypervariability of the spike glycoprotein coding region, which can affect at least eight potential linear B cell epitopes located in the spike glycoprotein. This report indicates that PHEVs in the United States underwent a significant genetic drift, which might influence PHEV surveillance in other countries.