Fresno County Research Articles

Latina Women’s Perinatal Experiences and Perspectives Around Discrimination, Anti-immigrant Policies, and Community Violence

ObjectiveTo describe experiences of Latina women who were currently pregnant or recently gave birth around discrimination, anti-immigrant policies, and community violence during the early COVID-19 pandemic. DesignQualitative secondary analysis. SettingOnline or phone interviews. ParticipantsLatina women who were currently pregnant or recently gave birth (N = 26). MethodsWe used reflexive thematic analysis to examine transcribed data from semistructured interviews conducted during the early COVID-19 pandemic with a subgroup of participants enrolled in a larger study related to prenatal care. Participants were English- or Spanish-speaking, Medicaid-eligible, Latina-identifying women who resided in Fresno County, California. We analyzed responses to questions about personal discrimination, the Black Lives Matter movement, and immigration policies using the theoretical frameworks of critical race theory and the political economy of health. ResultsWe identified four major themes: Avoidance of Community Engagement, Chronic Fear and Vigilance, The Role of Media, and Everyday Discrimination and Injustice. ConclusionParticipant experiences reflect the pervasiveness of fear and socioeconomic inequity and call attention to the racialized structures that affect health and health care access for Latina women. These exposures during the perinatal period may have intergenerational effects. These findings underscore the need for responsive and race-conscious perinatal nursing care for Latina women, assessment of the effect of the current sociopolitical environment on well-being, and policies that support equitable access to health and social care.

An all-out assault on a dominant resistance gene: Local emergence, establishment, and spread of strains of tomato spotted wilt orthotospovirus (TSWV) that overcome Sw-5b-mediated resistance in fresh market and processing tomatoes in California.

Tomato spotted wilt orthotospovirus (TSWV) causes substantial economic loss to tomato production, and the Sw-5b resistance gene is widely deployed for management. Here, we show (i) the emergence of resistance-breaking (RB) TSWV strains in processing and fresh market tomato production in California over the past ten years, and (ii) evolutionary relationships with RB strains from other areas. A specific RT-PCR test was used to show the C118Y RB strain that emerged in Fresno County in 2016 quickly became predominant in the central production area and remained so through this study. In 2021, the C118Y strain was detected in the Northern production area, and was predominant in 2022. However, in 2023, the C118Y strain was unexpectedly detected in fewer spotted wilt samples from resistant varieties. This was due to emergence of the T120N RB strain, previously known to occur in Spain. A specific RT-PCR test was developed and used to show that the T120N RB strain was predominant in Colusa and Sutter counties (detected in 75-80% of samples), and detected in ~50% of samples from Yolo County. Pathogenicity tests confirmed California isolates of the T120N strain infected Sw-5b tomato varieties and induced severe symptoms. Another RB strain, C118F, was associated with spotted wilt samples of Sw-5 varieties from fresh market tomato production in southern California. Phylogenetic analyses with complete NSm sequences revealed that the C118Y and T120N RB strains infecting resistant processing tomato in California emerged locally, whereas those from fresh market production were more closely related to isolates from Mexico. Thus, widespread deployment of this single dominant resistance gene in California has driven the local emergence of multiple RB strains in different tomato production areas and types. These results further emphasize the need for ongoing monitoring for RB strains, and identification of sources of resistance to these strains.

A Tale of Two Counties: A Study of Vote Centers in Fresno County and St. Louis County

A Tale of Two Counties: A Study of Vote Centers in Fresno County and St. Louis County

Season-long comparison of trap lures for integrated management of the navel orangeworm (Lepidoptera: Pyralidae) in almond and pistachio

Monitoring navel orangeworm, Amyelois transitella (Lepidoptera: Pyralidae) using pheromone lures is now complicated by the use of mating disruption. Two commercially available lures that are minimally affected by mating disruption use either natural ovipositional substrates (Bait lures) or a combination of phenyl propionate (PPO), a volatile chemical that attracts both sexes and pheromone lures (Combo lures). We compared the season-long trap capture for these two lures in a sterile insect technique (SIT) demonstration project in Fresno County, California, 2020–2023. A total of 194,233 males (96.52%) were caught using Combo lures and 7006 (3.48%) caught using Bait lures, while 95,947 females (48.83%) were caught using Combo lures and 100,532 (51.17%) caught using Bait lures. Capture of A. transitella was 2.3-fold higher in pistachio (278,492) than in almond (119, 316), and within a commodity, there was a moderate correlation in female capture between the two lures; correlation was stronger during the period leading up to July 21 (Julian date 202). For Bait lures, 48.7% of the trap catch in almond occurred by July 21 and 87.1% of the trap catch occurred in pistachio by July 21. For Combo lures, 38.9% of the trap catch in almond occurred by July 21 while 54.6% of the catch occurred in pistachio. Bait lures became less effective after July 21, likely due to diminished attractiveness as new crop nuts split in August through October. Our data indicate that Combo lures are preferable when the goal is consistent season-long capture of A. transitella in almond and pistachio.

Yovino v. Rizo: The Equal Pay Act and Salary History Defense

The U.S. Supreme Court declined to review Yovino v. Rizo in 2020, leaving in place a Ninth Circuit Court decision that the use of salary history when determining compensation levels violates the Equal Pay Act of 1963. Aileen Rizo, a math consultant for the Fresno County School District, had argued that the basing of her starting salary on her previous level of compensation perpetuated past salary discrimination. Salary history is a common tool for setting starting salaries, and was used by the school district in a gender-neutral, uniform manner. A critical analysis of the technique, however, shows that salary history does not reflect job-related knowledge, skills, and abilities and has a disparate impact on female applicants and employees. Alternatively, public employers bear the responsibility to advertise competitive pay rates that reflect internal and market-based considerations.

Implementation of a Booster Sexual Health Education Curriculum for Older Adolescents in Rural Communities.

Ongoing education on sexual health and other health promotion topics is critical as young people transition into adulthood. A "booster" round of education may be an effective strategy to reinforce information previously taught and expand to additional topics relevant later in adolescence. In partnership with a Youth Advisory Council, we co-designed READY, Set, Go!, a booster curriculum for older adolescents with modules covering adult preparation skills, sexual identity, relationships, reproductive health, and mental health. From November 2021 to January 2023, we provided the curriculum to 21 cohorts of 12th grade students (N = 433) in rural communities of Fresno County, CA, and conducted an implementation evaluation to assess its feasibility in school settings, acceptability by participants, and changes in short-term outcomes. Health educators completed implementation logs to track program adaptations. Youth completed pretest/posttest surveys to assess changes in outcomes and participant satisfaction. We used descriptive statistics to examine program adaptations and satisfaction. We used multivariable regression models to examine changes in outcomes, adjusted for sociodemographic characteristics. Health educators completed most activities as planned, with adaptations occurring in response to youth needs and scheduling limitations. Sexual health knowledge, confidence in adult preparation skills, awareness of local sexual and mental health services, and willingness to seek health services all increased significantly from pretest to posttest. Youth feedback was strongly positive. We conclude that booster sexual health education is a promising strategy to address critical knowledge gaps and support health promotion, especially in rural and other under-resourced communities.

Sustaining agricultural economies: regional economic impacts of biochar production from waste orchard biomass in California's Central Valley

AbstractThe prominent role of agriculture in greenhouse gas (GHG) emissions has increased global interest in biochar. This carbonaceous biomass product has emerging efficacy for GHG emissions reduction. While a growing body of literature indicates positive economic impacts of biomass-related products, scant evidence exists about the potential regional economic impacts of biochar production. Since biochar is a new industry and there is no North American Industry Classification System (NAICS) code for biochar, we modified the available industries in the IMPLAN database to estimate the direct, indirect, and induced economic impacts of six potential biochar pricing and production opportunities in Central Valley, California. Results suggest that depending on the biochar price and conversion rates, biochar would create between 16.56 and 17.69 new full- and part-time jobs per year that would contribute between $1.2 and $5.75 million per year to labor income. Biochar production would add to the Gross Domestic Product (GDP) about $106,295 ($5.2 million) per year with a conversion rate of 15% (35%) and a biochar price of $280 ($2,512) per metric ton. Similarly, biochar’s impacts on gross output would be positive, regardless of the biochar conversion rate and price, which suggests the need for more investment in the sector. We find that all regions would benefit in terms of employment, labor compensation, value addition, and gross output though Madera County would have the least economic returns. Meanwhile, Fresno County with the most biomass would have the most economic impacts, suggesting that policy should be directed at encouraging biomass production and marketing in areas with the most biomass.

Contraceptive access experiences and perspectives of Mexican-origin youth: a binational qualitative study

Access to comprehensive contraceptive services for youth is essential to improving sexual and reproductive health. However, youth in many countries still face substantial obstacles to contraceptive access and use. The purpose of this study is to compare the contraceptive access experiences and perspectives of pregnant and parenting Mexican-origin youth in Guanajuato, Mexico, and Fresno County, California. Focus groups and in-depth interviews were conducted in Spanish and English among female youth in Mexico (n = 49) and California (n = 25). Participants also completed a brief sociodemographic survey. Using a modified grounded theory approach, qualitative data were coded and thematically analysed based on Penchansky and Thomas's Theory of Access, and results were compared by location. Although knowledge of a service provider was high among youth in both locations, access was affected by social, cultural, and institutional dynamics and contraceptive use was mixed. Across locations, participants described obstacles to accessing their preferred method. Participants worried about parental and peer opinions about their use of contraception (acceptability), and about perceived side effects including infertility and pain (adequacy). Contextual differences included lack of contraceptive choice in Guanajuato (availability) and incomplete knowledge about options in Fresno County (awareness). The power to request and receive their method of choice (agency) emerged as an important dimension that was not part of the original theory. Latina youth living in Mexico and the United States face multiple challenges accessing needed contraceptive options and services. Recognising and reducing these barriers can strengthen the contraceptive care landscape and promote the reproductive health and agency of young people. DOI: 10.1080/26410397.2023.2216527 Plain language summary: Although sexually active youth need access to comprehensive sexual and reproductive health services, youth in many countries face substantial barriers to care. This study compares the experiences of pregnant and parenting youth in accessing contraceptive services in Mexico and the United States. We conducted interviews and focus groups with 74 Mexican-origin young women and found that contraceptive use and access was affected by their concerns about parental and peer opinions as well as by provider attitudes. In Mexico, several participants reported being denied their preferred method by their provider. Identifying and addressing barriers to services can improve the quality of care and the reproductive health of young people.

Elevated road segment (ERS) passage design may provide enhanced connectivity for amphibians, reptiles, and small mammals

IntroductionDesigns for safe and effective road crossing structures for small animals are typically under-road microtunnels and culverts which have varying levels of effectiveness reported in the scientific literature. Many species, particularly migratory amphibians, may have limited ability to find and use passages if they are too far apart, resulting in substantial barrier effects.MethodsWe designed a novel open elevated passage (elevated road segment: ERS), similar to a low terrestrial bridge, that could theoretically be built to any length based upon species needs and movement characteristics. A 30 m length prototype ERS was installed along a forest road with a history of amphibian road mortality in Sierra National Forest, Fresno County, CA, USA. From 2018 to 2021, we monitored small animal activity under the ERS in relation to surrounding roadside and forest habitats using active infrared cameras.ResultsWe documented a total of 8,815 unique use events, using species specific independence criteria, across 22 species of amphibians (3), reptiles (4), and small mammals (15). Poisson regression modeling of taxonomic group activity under the ERS, roadside and forest, showed that amphibian activity was highest in the forest habitat, no differences were observed for reptiles, and small mammal activity was highest under the ERS. However, mean activity estimates under the ERS were equal to or greater than the open roadside habitat for all 22 species, suggesting that adding cover objects, such as downed logs and vegetation may further enhance passage use.DiscussionOverall, results showed that the design of the ERS crossing has potential to provide high connectivity for a wide range of amphibian, reptile, and small mammal species while reducing road mortality. ERS systems can also be used in areas with challenging terrain and other hydrological and environmental constraints. Incorporating current road ecology science, we provide supplemental ERS concept designs for secondary roads, primary roads and highways to help increase the options available for road mitigation planning for small animals.

Herbicide screening for weed control and crop safety in California melon production

AbstractWeed management in cantaloupe and other melon crops is important to maximize fruit yield; however, there are few registered herbicides available in California. Several independent herbicide trials were conducted at University of California field stations in Davis (Yolo County), Five Points (Fresno County), and Holtville (Imperial County) from 2013 to 2019 to evaluate both registered and unregistered herbicides and incorporation methods (sprinklers, cultivation, or none) for crop safety and weed control in melons. Although specific treatments varied among locations depending on local practice and research objectives, ethalfluralin and halosulfuron were used in all experiments, and bensulide and S-metolachlor were evaluated in 4 of 6 site-years. Additional herbicides included clethodim, clomazone, DCPA, napropamide, pendimethalin, sethoxydim, and sulfentrazone. Among registered herbicides, halosulfuron, halosulfuron + ethalfluralin, and ethalfluralin + bensulide combinations provided consistently beneficial weed control across all site-years compared to the nontreated control. S-metolachlor performed as well as the best of the registered herbicides tested at each site-year; although moderate injury was noted at the Davis location, this did not reduce melon yield. The method used to incorporate preplant herbicides had a significant impact on weed control efficacy but varied by location. Mechanical incorporation of preplant herbicides resulted in improved weed control and yield compared to sprinklers. Early-season weed control, whether by herbicides or hand weeding, resulted in significant yield increase in most site-years.

“It was just one moment that I felt like I was being judged”: Pregnant and postpartum black Women's experiences of personal and group-based racism during the COVID-19 pandemic

BackgroundRacial inequities in maternal and child health outcomes persist: Black women and birthing people experience higher rates of adverse outcomes than their white counterparts. Similar inequities are seen in coronavirus disease (COVID-19) mortality rates. In response, we sought to explore the intersections of racism and the COVID-19 pandemic impact on the daily lives and perinatal care experiences of Black birthing people. MethodsWe used an intrinsic case study approach grounded in an intersectional lens to collect stories from Black pregnant and postpartum people residing in Fresno County (July–September 2020). All interviews were conducted on Zoom without video and were audio recorded and transcribed. Thematic analysis was used to group codes into larger themes. ResultsOf the 34 participants included in this analysis, 76.5% identified as Black only, and 23.5% identified as multiracial including Black. Their mean age was 27.2 years [SD, 5.8]. Nearly half (47%) reported being married or living with their partner; all were eligible for Medi-Cal insurance. Interview times ranged from 23 to 96 min. Five themes emerged: (1) Tensions about Heightened Exposure of Black Lives Matter Movement during the pandemic; (2) Fear for Black Son's Safety; (3) Lack of Communication from Health Care Professionals; (4) Disrespect from Health Care Professionals; and (5) Misunderstood or Judged by Health Care Professionals. Participants stressed that the Black Lives Matter Movement is necessary and highlighted that society views their Black sons as a threat. They also reported experiencing unfair treatment and harassment while seeking perinatal care. ConclusionsBlack women and birthing people shared that exposure to racism has heightened during the COVID-19 pandemic, increasing their levels of stress and anxiety. Understanding how racism impacts Black birthing people's lives and care experiences is critical to reforming the police force and revising enhanced prenatal care models to better address their needs.

A note on the specimens of Kittonia hannae ‘hannai’  (Bacillariophyta) figured in Long et al. (1946)

In 1939, Lefébure & Chenevière described the Cretaceous fossil species Kittonia hannae Lefébure & Chenevière (1939: 23 pl. 1, fig. 3, see Sims & Williams 2022: fig. 8). The specimen figured was from the Moreno Shale deposit, California, USA, supplied by Dallas Hanna (1887–1970): “Moreno shale, Moreno Gulch in the Panoche Hills, Fresno County, California” […] “Sec. 6, T. 15 S., R. 12 E., M.D.B. & M., Fresno County, California” (Hanna 1934: 352, see also Hanna in Long et al. 1946: 91, Hanna 1927, Rampi 1940, Goudkoff 1945). Other specimens of Kittonia hannae were from another Moreno Shale exposure, “Sec. 24, T. 14, S., R. 11 E., Fresno County, California” (Hanna in Long et al. 1946: 93, Brigger & Hanna 1965: 4). A detailed discussion of the Moreno deposit can be found in Hanna (1927: 10), Long et al. (1946), Nikolaev et al. (2001) and Davies et al. (2012), and a review of the genus Kittonia was undertaken by Brigger & Hanna (1965).

The need for booster sex education: findings of a formative evaluation in rural Fresno County, California

ABSTRACT Despite national guidelines advocating a comprehensive, age-appropriate, and sequential approach to sexual health education in schools, many young people in the USA do not receive sexual health information until high school. To date, there has been little research on the need for a supplemental round of sexual health education – a ‘booster’ – later in adolescence to reinforce and expand upon information and skills previously provided. In rural California, we conducted six focus groups with young people (N = 22, ages 14–20) and key informant interviews with youth-serving professionals (N = 10) to examine the sexual health education needs of youth as they complete high school. Five themes were identified, indicating a need for booster education that 1) reinforces existing sexual health knowledge; 2) expands beyond traditional areas of sexual health education; 3) addresses community stigma about adolescent health; and 4) prepares young people for the transition to adulthood. In addition, booster education should 5) be established within the school system to promote an environment that addresses and normalises health issues throughout the school year. Providing booster sexual health education may meet critical gaps in efforts to support the healthy sexual development of young people, especially those living in rural communities.

First Year Survey of Arthropods in California Hemp

Hemp is a newly (re)introduced crop to United States and California agriculture. A study was initiated in the summer of 2021 to survey the arthropods present in hemp in two regions of California: Fresno County in the Central Valley and Ventura County along the Central Coast. Eight hemp plots were sampled every two weeks from August to mid-October using a combination of D-vac samples, leaf collections, and visual observations. All samples were processed and ultimately recorded as the total number of specimens collected per morphospecies across all sampling dates, further broken down to express the number of specimens collected from the Central Valley and the Central Coast. D-vac sampling was the most reliable method for specimen collection and led to the recovery of arthropods from 11 orders, 69 families, and 157 morphospecies. Approximately 13,000 specimens were collected and processed, half of which were whiteflies (Hemiptera: Aleyrodidae). Of the specimens recovered, Hemiptera was the most representative order (with and without whiteflies), followed by Thysanoptera and then Hymenoptera. The most frequently collected specimen was Engytatus modestus (Hemiptera: Miridae). Very few pest species were recovered, cannabis aphid ( Phorodon cannabis ) being the only one that was observed in any noticeable density. Many generalist predators and parasitoid wasps were also collected. Findings from this survey provide baseline information on the arthropod species present in California hemp. This survey will be repeated and expanded in future growing seasons.

Using Community-Based Participatory Research to Design a Patient and Practitioner-Centered Group Prenatal Care Model.

In response to disproportionately high rates of infant mortality and preterm birth among women of color and women in poverty in Fresno County, California, community and academic partners coordinated a community-based participatory research (CBPR) project with local residents. Social isolation and stress, inaccessible prenatal care, and dissatisfaction with care experiences were identified as leading predictors of poor birth outcomes. The PRECEDE-PROCEED framework was used to lead the CBPR effort that resulted in the development of a model of group prenatal care, named Glow! Group Prenatal Care Program (Glow! Program). Group prenatal care (GPNC), which focuses on pregnancy health assessments, education, and peer support, has the potential to address the health and social priorities of women during pregnancy. As a result of the employed CBPR process and the extensive participation from stakeholders, this modified GPNC model responds to the unique needs of the at-risk community members, the agencies aiming to improve maternal-child health experiences and outcomes, and the prenatal care providers offering it to their patients. The methods from this study can be applied in the design and implementation of community-based health care interventions. Returning to community partners throughout the design, implementation, and evaluation phases underscored that health care interventions cannot be designed in silos, and require flexibility to respond to factors that promote improved maternal and infant outcomes, which affect the end goal for the intervention.

First Report of Fusarium falciforme (FSSC 3 + 4) Causing Rot of Industrial Hemp (Cannabis sativa) in California.

Industrial hemp (Cannabis sativa) is a newly legal crop in California that is grown for cannabidiol oil, fiber and seed. In August 2019, whole plant decline and root rot were observed affecting <5% of plants in two industrial fields in Fresno County, CA. Symptoms included chlorotic, collapsed foliage, stem vascular discoloration, and root rot with abundant mycelial growth. Stem and root segments (1-2 cm) from three to five diseased plants were agitated in 0.1% tween-20 and soaked in 70% ethanol for 30 s and 1% NaOCl for 2 min. After incubating for 5 to 7 days on 1:10 potato dextrose agar (PDA) amended with tetracycline, Fusarium selective medium (FSM), and PARP (pimaricin + ampicillin + rifampicin + pentachloronitrobenzene [PCNB] agar) medium, white to pale cream aerial mycelium emerged from tissue of all plants on PDA and FSM but not PARP. Isolates cultured on 0.1% potassium chloride agar formed heads of microconidia on long monophialides consistent with the Fusarium solani species complex (FSSC) (Leslie and Summerell 2008). To obtain pure cultures of two isolates (CS529 and CS530), a single-hyphal tip was excised and grown on PDA. DNA was extracted from actively growing mycelium (PrepMan Ultra kit). The translation elongation factor gene (EF-1α) was amplified via PCR using EF1/EF2 primers (O'Donnell et al. 1998). Sequences of the two isolates were identical and deposited under accession number MW892973 in GenBank. The 599 bp sequence was 99.33% identical to FSSC 3 + 4 (Fusarium falciforme) accessions FD_01443_EF-1a based on FUSARIUM-ID BLAST analysis. To evaluate pathogenicity, stems of hemp plants (cv. 'Berry Blossom'; n=8 plants per isolate) were wounded by penetrating the epidermis in an area about 0.5-cm square by 1-mm deep and 8-inches above the soil line. A 0.5 cm-diameter plug of 7-day old F. falciforme-colonized PDA was placed against the wound. Inoculation sites were loosely wrapped with parafilm for 2 days. A negative control consisted of a sterile PDA plug (n=3). Treatments were arranged in a completely randomized design in a greenhouse. The experiment was conducted once, due to regulatory restrictions at campus facilities. At 61 days post-inoculation, external stem lesions were significantly larger in diameter (P < 0.05; Tukey's HSD) in plants inoculated with CS529 (8 ± 1 mm) compared to the control (2 ± 0 mm), and larger but not significant for CS530 (6 ± 1 mm). Internal stem lesions (i.e., rot in stele) were observed in plants inoculated with CS529 (9 ± 3 mm); stem rot was very minor in plants treated with CS530 (1 ± 1 mm) and nonexistent for control plants. No other disease symptoms were observed. F. falciforme was isolated from stems of CS529- and C530-inoculated plants. Sequences of re-isolates matched 100% with accession MW892973. These results suggest that F. falciforme causes rot in hemp in California. These studies specifically confirm stem rot abilities; field observations of root rot indicate root rotting abilities, but further tests are needed for confirmation. This is the first report of F. falciforme causing disease in industrial hemp. FSSC was described as causing foot rot in hemp in Italy (Sorrentino et al. 2019), but these isolates belonged to phylogenetic species 5 (F. solani) not F. falciforme. In addition, F. falciforme was reported as causing root rot in hydroponically grown cannabis (Punja and Rodriguez 2018). These studies provide the foundation for development of management tools for hemp disease.

Educators' Perspectives on Integrating Technology Into Sexual Health Education: Implementation Study.

BackgroundIn the last decade, the use of technology-based sexual health education has increased. Multiple studies have shown the feasibility of technology-based interventions, while a subset has also shown efficacy in improving youths’ sexual health outcomes such as increased condom use and knowledge. However, little is known about health educators’ experiences in integrating technology to augment sexual health curricula.ObjectiveThe purpose of this study was to assess the perceptions and experiences of health educators regarding the incorporation of technology into a sexual health education program designed for underserved youth in Fresno County, California, and to identify facilitators and challenges to incorporating technology into the in-person curriculum.MethodsThis implementation study used data collected as part of a cluster randomized controlled trial to evaluate In the Know (ITK), an in-person sexual health education curriculum that includes technology-based content, such as a resource locator, videos, and games, which can be accessed through a mobile app or website. Data from implementation logs from each cohort (n=51) and annual interviews (n=8) with health educators were analyzed to assess the health educators’ experiences using the technology and adaptations made during the implementation.ResultsThe health educators reported that technological issues affected implementation to some degree: 87% of the time in the first year, which decreased to 47% in the third year as health educators’ familiarity with the app increased and functionality improved. Technology issues were also more common in non–school settings. Successes and challenges in 3 domains emerged: managing technology, usability of the ITK app, and youth engagement. The health educators generally had positive comments about the app and youth engagement with the technology-based content and activities; however, they also noted certain barriers to adolescents’ use of the mobile app including limited data storage and battery life on mobile phones.ConclusionsHealth educators require training and support to optimize technology as a resource for engaging with youth and providing sensitive information. Although technology is often presented as a solution to reach underserved populations, educational programs should consider the technological needs and limitations of the participants, educators, and settings.International Registered Report Identifier (IRRID)RR2-10.2196/18060

Vertical accuracy of the USGS 3DEP program data: study cases in Fresno County and in Davis, California

3D Elevation Program (3DEP) aims to generate and disseminate high-resolution topographic elevation data from the source data products including lidar point clouds, original DEMs from which the 3DEP standard DEM datasets were produced, and additional data types produced from IfSAR collections. As such, the accuracy of 3DEP data varies due to the inconsistent quality of the source data. Hence, in order to test vertical accuracy of the current 3DEP data, two precise leveling data sets which are collected in the San Joaquin Experimental Range (SJER) in Fresno County and CalFire site in Davis, California are used as the baselines and the differences are computed. In the earlier studies, assessment of 3DEP data is accomplished using large-area elevation datasets. Nevertheless, these large-area elevation datasets are not as precise as differential (precise) leveling data sets. In this study, two relatively small sites (SJER and CalFire site) are surveyed utilizing precise leveling. These two project sites also differ from each other in terms of terrain relief and land cover. The results show that attainable precision is almost the same for 1/3 arc-second and 1 arc-second data sets. The data sets used for CalFire site are more precise than the data sets used for SJER site. CalFire site data sets are more accurate than SJER data sets. 1 arc-second data provides as good elevation information as 1/3 arc-second data. Terrain relief and land cover are important factors on vertical accuracy coming from 3DEP data.

In the Struggle: Scholars and the Fight Against Industrial Agribusiness in California

In the Struggle: Scholars and the Fight Against Industrial Agribusiness in California

First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California.

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.